DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Claims
Claims 1-30 are pending.
Claims 1-30 are examined herein.
The rejections to claims 21-22 under 35 USC 101 have been withdrawn.
Upon further review and consideration, the claims 1-6, 13, 15-23, and 27-30 do not appear free of the prior art with respect to SEQ ID NO: 1.
Claims 4-5, 7-12, 14, and 24-26 appear free of the prior art.
Claims 1-30 are rejected.
Priority
Application No. 18/462,847 filed on 09/07/2023 claims benefit of priority to provisional Application No. 63/375,114 filed on 09/09/2022.
Claim Interpretation
Claim 10 recites “A construct comprising at least one copy of a DNA molecule of claim 1, and an operably linked transcribable gene of agronomic interest”. Because the transcribable gene of agronomic interest is operably linked to the DNA molecule of claim 1, the claim is interpreted to require a construct comprising at least one copy of a DNA molecule of claim 1 (i.e. the DNA molecule of claim 1 is a sequence of a)-c) and the operably linked heterologous transcribable polynucleotide molecule), wherein the heterologous transcribable polynucleotide molecule comprises a transcribable gene of agronomic interest.
Claim 24 recites “A method of expressing a gene of agronomic interest in a plant or plant cell, the method comprising incorporating into a plant cell a construct comprising the DNA molecule of claim 1, operably linked to a transcribable gene of agronomic interest, wherein the DNA molecule is capable of driving the expression of the operably linked gene of agronomic interest in the plant cell”. Because the transcribable gene of agronomic interest is operably linked to the DNA molecule of claim 1, the claim is interpreted to require a construct comprising the DNA molecule of claim 1 (i.e. the DNA molecule of claim 1 is a sequence of a)-c) and the operably linked heterologous transcribable polynucleotide molecule), wherein the heterologous transcribable polynucleotide molecule comprises a transcribable gene of agronomic interest.
Improper Markush Grouping
Claims 1, 4, and 5 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of SEQ ID NOs: 1-15, 17-19, and 21-24 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons:
An ABSS sequence search of elected SEQ ID NO: 1 (See file wrapper 20250319_113538_us-18-462-847-1.rnpbm) returned results as low as 10.4% identity to SEQ ID NO: 1. All other non-elected species as they appear in the claims have less than 10.4% identity to SEQ ID NO: 1.
Hence, the included species of the claimed invention do not share both a substantial structural feature and a common function that flows from the substantial structural feature.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 112
Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
This rejection is modified from the rejection set forth in the Office Action dated 05/19/2025 in view of Applicants amendment of the claims.
Claims 1-3 and 6-30 rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 1-3 and 6-30 are broadly drawn to:
A DNA molecule comprising a DNA sequence selected from the group consisting of:
a) a sequence with at least 95 percent sequence identity to any of SEQ ID NOs: 1-15,17-19, and 21-24;
b) a sequence comprising any of SEQ ID NOs: 1-15, 17-19, and 21-24;
c) a fragment comprising at least 50 contiguous nucleotides of any of SEQ ID NOs: 1-15, 17-19, and 21-24 having at least 95 percent sequence identity thereof, wherein the fragment has gene-regulatory activity; and
d) combinations thereof,
wherein said sequence is operably linked to a heterologous transcribable polynucleotide molecule.
Specifically, the written description issue regards any fragment comprising at least 50 contiguous nucleotides of any of SEQ ID NOs: 1-15, 17-19, and 21-24 having at least 95 percent sequence identity thereof, wherein the fragment has gene-regulatory activity.
Applicant describes in working examples SEQ ID NOs: 6, 10, 12, 14, 15, and 18-22, which are promoter sequences, were tested in field grown cassava plants (examples 1-3, p. 51-58). Applicant also describes in working examples testing for expression in cassava plants with the remaining claimed promoter sequences of SEQ ID NOs: 1-5, 7-9, 11, 13, 16, 17, and 23-24 (examples 4-8, p. 58-69).
Applicant has not described any fragment comprising as few as 50 contiguous nucleotides of any of the recited regulatory sequences, wherein the fragment has gene-regulatory activity.
The prior art fails to remedy this deficiency. Regarding elected SEQ ID NO: 1 which is a 2,000 basepair sweet1 promoter derived from Manihot esculenta, there appears to be a dearth of description of fragments as few as 50 nucleotides in length that would be expected to have the required gene-regulatory function. A review of sequences that share identity with elected SEQ ID NO: 1 reveals sequences that have low sequence identity and no fragments of at least 50 contiguous nucleotides having 95% sequence identity to elected SEQ ID NO: 1, and moreover fail to describe the function of the sequence is a regulatory function (see file wrapper 20250319 _113538_us-18-462-847-1.rnpbm). For example, there is an identity gap between two sequential search results of SEQ ID NO: 1. One sequence, which is instant SEQ ID NO: 1, shows 100% identity, and the next most similar sequence search shows 13.1% identity (see search results in previous Office Action dated 05/19/2025, p. 5-10).
The instant specification does describe the genus of any fragment comprising as few as 50 contiguous nucleotides and having 95% identity to of any of the recited regulatory sequences wherein the fragment has gene-regulatory activity by virtue of example. There appears to be a dearth of description of the elected regulatory sequence that would be expected to have the required function (that function being gene regulatory activity). As such, the structural features that distinguish fragments comprising 50 nucleotides with 95% identity to SEQ ID NOs: 1-15, 17-19, and 21-24 and having gene-regulatory activity from other fragments comprising 50 nucleotides having 95% identity to SEQ ID NOs: 1-15, 17-19, and 21-24 are not described in the instant specification. The specification fails to provide an adequate written description to support the fragments comprising as few as 50 contiguous nucleotides having at least 95% identity that are able to effectively confer the functions of regulatory sequence. The limited examples of 100% identity to the full length of recited sequences do not describe the claimed genus by virtue of example. Therefore, one of ordinary skill in the art would not have recognized the Applicant to be in possession of the claimed invention at the time the application was filed.
Scope of Enablement
Claims 8, 9, 13-20, and 23-20 rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a DNA molecule comprising the sequence(s) as recited in claim 1 to have gene-regulatory function in cassava plants, does not reasonably provide enablement for the SEQ IDs recited in claim 1 to confer gene-regulatory function in any plant species. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims without undue experimentation.
In re Wands, 858 F.2d 731 (Fed. Cir. 1988) lists the following eight factors for determining whether undue experimentation would be required to practice an invention: (1) quantity of experimentation necessary; (2) amount of direction or guidance supplied; (3) presence or absence of working examples; (4) nature of the invention; (5) state of the prior art; (6) relative skill of those in the art; (7) predictability or unpredictability or the prior art; (8) breadth of the claims.
Applicant claims (in claim 1) a DNA molecule comprising a DNA sequence selected from the group consisting of:
a) a sequence with at least 95 percent sequence identity to any of SEQ ID NOs: 1-15,17-19, and 21-24;
b) a sequence comprising any of SEQ ID NOs: 1-15, 17-19, and 21-24;
c) a fragment comprising at least 50 contiguous nucleotides of any of SEQ ID NOs: 1-15, 17-19, and 21-24 having at least 95 percent sequence identity thereof, wherein the fragment has gene-regulatory activity; and
d) combinations thereof,
wherein said sequence is operably linked to a heterologous transcribable polynucleotide molecule.
Claims 8, 9, 13-20, and 23-20 are drawn to a plant, plant cell, plant seed, or progeny comprising the DNA molecule of claim 1, wherein the DNA sequence of claim 1 confers gene regulatory function to effectively confer various traits (e.g. increased yield as recited in claim 8) in the plant or part thereof. The claims encompasses the DNA sequence effectively confer gene-regulatory function in any plant species.
Essential to the invention are the DNA sequences ability to confer gene-regulatory activity in any plant species. Elected SEQ ID NO: 1 is a sweet1 promoter derived from Manihot esculenta. The genus of plant species that are encompassed by the structural limitations of the claims is very large, encompassing hundreds of thousands of species including highly genetically diverged plant species.
Applicant teaches in working examples that the SEQ IDs recited in claim 1 are assessed for gene-regulatory function in cassava plants (p. 51-69).
Applicant does not teach the SEQ IDs recited in claim 1 are able to confer the function of gene regulation in any other plant species, e.g. any other monocot species or dicot species. It is also known in the field that promoters derived from monocots often don’t efficiently express in dicot plants, and vice versa (see Park, 2459, introduction, ¶1). Such processes might fall within normal experimentation if the target genus is small, but when the potential number of plant species is as large as the genus presented by the instant claims, the trial-and-error nature of the process becomes undue experimentation.
Given the limited guidance supplied by Applicant, the breadth of the claims and the nature of the invention, as well as the unpredictability in the art, it would have required one skilled in the art undue trial and error experimentation to practice the claimed invention through the full scope of its claims
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-3, 6, 13, 15-16, 23, and 27-29 are rejected under 35 U.S.C. 103 as being unpatentable over NCBI Accession No. XM_021744876 (NCBI Accession No. XM_021744876 published on 09/28/2021) Porto (Porto, M. S., Pinheiro, M. P. N., Batista, V. G. L., dos Santos, R. C., de Albuquerque Melo Filho, P., & de Lima, L. M. (2014). Plant promoters: an approach of structure and function. Molecular biotechnology, 56(1), 38-49), and Rottmann (Rottmann, T., Fritz, C., Sauer, N., & Stadler, R. (2018). Glucose uptake via STP transporters inhibits in vitro pollen tube growth in a HEXOKINASE1-dependent manner in Arabidopsis thaliana. The Plant Cell, 30(9), 2057-2081).
Regarding claim 1, NCBI Accession No. XM_021744876 teaches a predicted Manihot esculenta bidirectional sugar transporter SWEET1 gene sequence (title), which has 100% identity to a fragment of instant SEQ ID NO: 1 (see below). Specifically, nucleotides 1 through 263 are 100% identical to a fragment of instant SEQ ID NO: 1. NCBI Accession No. XM_021744876 also teaches the coding sequence/ translation begins at the start codon that is nucleotide 264-266 of the sequence taught by NCBI Accession No. XM_021744876.
However, NCBI Accession No. XM_021744876 does not explicitly teach:
the fragment has gene-regulatory activity, and the fragment is operably linked to a heterologous transcribable polynucleotide molecule (remaining limitation of claim 1)
The DNA molecule of claim 1, wherein the DNA sequence is active as a promoter (claim 2)
The DNA molecule of claim 1, wherein the DNA molecule further comprises a heterologous regulatory element (claim 3)
The DNA molecule of claim 1, wherein the DNA sequence comprises gene regulatory activity (claim 6)
A transgenic plant cell comprising the recombinant DNA molecule of claim 1 (claim 13)
The transgenic plant cell of claim 13, wherein said transgenic plant cell is a dicotyledonous plant cell (claim 15)
A transgenic plant, or part thereof, comprising the DNA molecule of claim 1 (claim 16)
A method of expressing a transcribable polynucleotide molecule comprising obtaining a transgenic plant according to claim 16 and cultivating the plant, wherein the transcribable polynucleotide is expressed (claim 23)
A method of producing a transgenic plant cell comprising introducing the DNA molecule of claim 1 into a plant cell (claim 27)
The method of claim 27, wherein introducing said DNA molecule into said plant cell comprises transformation (claim 28)
The method of claim 28, further comprising regenerating a transgenic plant from said plant cell (claim 29)
Regarding the remaining limitation of claim 1 and claims 2-3, 6, 13, 15-16, 23, and 27-29, in analogous art, Porto teaches a promoter is found directly upstream a gene and may be identified by various elements including a TATA box, CAAT box, GC-box (p.39, Structure of Promoters in Eukaryotic Organisms, ¶1-2) (i.e. the sequence upstream the coding sequence and start codon taught by NCBI Accession No. XM_021744876 would reasonably be interpreted to have gene regulatory activity, is active as a promoter, and is a regulatory element). Porto also teaches several techniques (e.g. genome walking or thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) strategies) for isolating promoters are known in the art, and teaches a list of specific databases that are known and readily available for identifying and isolating promoters from genomic sequences (p. 43-44, Table 2). In other analogous art, Rottmann teaches using a SWEET1 promoter to express SWEET1-GUS fusion protein (i.e. expressing a heterologous transcribable polynucleotide) in transgenic Arabidopsis (i.e. dicotyledonous) plants (Fig. 9 A-C) transformed via Agrobacterium-mediated transformation to obtain lines (p. 2076).
It would therefore have been obvious to a person of ordinary skill in the art to modify the invention taught by NCBI Accession No. XM_021744876 to include the limitations of Porto and Rottmann to arrive at the instantly claimed method with a reasonable expectation of success because NCBI Accession No. XM_021744876 teaches the start codon of the Manihot esculenta bidirectional sugar transporter SWEET1 gene sequence begins at nucleotide 264, and also provides a known and readily available sequence (basepairs 1-263) upstream the start codon. Additionally, Porto teaches promoters are found upstream eukaryotic genes and provides various identifiable promoter elements, and Porto also provides several techniques and databases useful for identifying promoters from genomic sequences, therefore one having ordinary skill in the art would identify the region as the promoter and to have gene-regulatory activity with a reasonable expectation of success. One having ordinary skill in the art would have been motivated to combine the teachings to arrive at the instant claims because Rottmann teaches using a SWEET1 promoter to drive GUS expression in transgenic Arabidopsis plants to identify the expression pattern of the SWEET1 promoter (Fig. 9 A-C, p. 2066, Potential Contribution of SWEETs to Extracellular Sugar Concentrations in the Pistil, ¶1, p. 2074, ¶1), and it would be prima facie obvious to substitute one known SWEET1 promoter with another obvious, and easily identifiable SWEET1 promoter for the same purpose.
Claims 17-22 and 30 are rejected under 35 U.S.C. 103 as being unpatentable over NCBI Accession No. XM_021744876, Porto, and Rottmann as applied to claims 1 and 16 above, and further in view of Bhat (Bhat, S. R., & Srinivasan, S. (2002). Molecular and genetic analyses of transgenic plants:: Considerations and approaches. Plant Science, 163(4), 673-681).
Regarding claims 17-22 and 30, NCBI Accession No. XM_021744876, Porto, and Rottmann teach the limitations of claims 1 and 16 as set forth in the previous obviousness rejection. The teachings of NCBI Accession No. XM_021744876, Porto, and Rottmann as they are applied to claims 1 and 16 are set forth previously herein and are incorporated by reference.
However, NCBI Accession No. XM_021744876, Porto, and Rottmann do not explicitly teach:
A progeny plant of the transgenic plant of claim 16, or a part thereof, wherein the progeny plant or part thereof comprises said DNA molecule (claim 17)
A transgenic seed, wherein the seed comprises the DNA molecule of claim 1. (claim 18)
A method of producing a commodity product comprising obtaining a transgenic plant or part thereof according to claim 16 and producing the commodity product therefrom (claim 19)
The method of claim 19, wherein the commodity product is selected from the group consisting of protein concentrate, protein isolate, grain, starch, seeds, meal, flour, biomass, and seed oil (claim 20)
A commodity product comprising the DNA molecule of claim 1 (claim 21)
The commodity product of claim 21, wherein the commodity product is selected from the group consisting of protein concentrate, protein isolate, grain, starch, seeds, meal, flour, biomass, and seed oil (claim 22)
The method of claim 27, wherein introducing said DNA molecule into said plant cell comprises crossing the transgenic plant of claim 16 with another plant to produce a progeny plant comprising said plant cell (claim 30)
Regarding claims 17-22 and 30, in analogous art, Bhat teaches in the molecular and genetic analyses of transgenic plants, the general practice is to select the progenies (T1 plants) obtained after self-fertilization of the primary transgenics (T0 plants) for analysis, and Bhat advocates that in majority of cases, back cross-progenies (BC1F1 plants) would be a better option for analysis (p. 674, ¶1). Bhat teaches this is because the BC1F1 population not only offers a greater chance of obtaining single copy insertions but also allows better comparison among progeny plants to distinguish transgene effect from other effects (p. 674, ¶1).
It would therefore have been obvious to a person of ordinary skill in the art to modify the invention taught by NCBI Accession No. XM_021744876, Porto, and Rottmann to include the limitations of Bhat to arrive at the instantly claimed method with a reasonable expectation of success because Bhat teaches selfing or backcrossing to obtain progeny from transgenic plants to analyze transgenics and generate suitable lines for experimentation is common practice and known in the art (p. 674, ¶1). One having ordinary skill in the art would have been motivated to combine the teachings because obtaining progeny via selfing is the general practice to study transgenics, and backcrossing to nontransgenic plants to obtain progeny with the transgene insertion also has particular benefits of a greater chance of obtaining single copy insertions but also allows better comparison among progeny plants to distinguish transgene effect from other effects, as explicitly taught by Bhat (title, p. 674, ¶1). Additionally, because seed is a commodity product (claims 19-22) and Bhat teaches a method of obtaining progeny (i.e. seeds), the method of producing the seed commodity product and the seed commodity product itself is therefore also obvious in view of Bhat.
Closest Prior Art
Claims 4-5, 7-12, 14, and 24-26 appear free of the prior art with respect to elected SEQ ID NO: 1.
Regarding claims 4-5, 7-12, and 24-26 with respect to elected SEQ ID NO: 1, the closest prior art is NCBI Accession No. XM_021744876 published on 09/28/2021. NCBI Accession No. XM_021744876 teaches a predicted Manihot esculenta bidirectional sugar transporter SWEET1 sequence (title), which has 100% identity to a fragment of instant SEQ ID NO: 1 (see below).
However, NCBI Accession No. XM_021744876 does not disclose, teach, or otherwise render obvious: wherein said sequence has at least 97 percent sequence identity to the DNA sequence of SEQ ID NO: 1 (claim 4), wherein said sequence has at least 99 percent sequence identity to the DNA sequence of SEQ ID NO: 1 (claim 5), wherein the heterologous transcribable polynucleotide molecule comprises a gene of agronomic interest (claim 7), a construct comprising at least one copy of a DNA molecule of claim 1, and an operably linked transcribable gene of agronomic interest (claim 10; see claim interpretation), or a method of expressing a gene of agronomic interest in a plant or plant cell, the method comprising incorporating into a plant cell a construct comprising the DNA molecule of claim 1, operably linked to a transcribable gene of agronomic interest, wherein the DNA molecule is capable of driving the expression of the operably linked gene of agronomic interest in the plant cell (claim 24; see claim interpretation). As such, depending claims 8-9, 11-12, and 25-26 also appear free of the prior art.
Query 1738 CCATTCCCTGTGAGTTACTGTTAGCCCACTGTTCATAGACATCGCTCGAATTACCAAAGC 1797
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 CCATTCCCTGTGAGTTACTGTTAGCCCACTGTTCATAGACATCGCTCGAATTACCAAAGC 60
Query 1798 AACTTGAAAACAAGGAAATTTAAACCTCGCTGTTATTTGTTTCCTTCTCTATATAATCCA 1857
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 AACTTGAAAACAAGGAAATTTAAACCTCGCTGTTATTTGTTTCCTTCTCTATATAATCCA 120
Query 1858 TTGCCACTTCCCTCTTCCACTCATCGCATTGACATTTGTGAACCAACCTCTGAActttca 1917
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 121 TTGCCACTTCCCTCTTCCACTCATCGCATTGACATTTGTGAACCAACCTCTGAACTTTCA 180
Query 1918 gtttgattcttcttgaaactatttgtttcttgtctttgccttctcttttcttttgaaggt 1977
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 GTTTGATTCTTCTTGAAACTATTTGTTTCTTGTCTTTGCCTTCTCTTTTCTTTTGAAGGT 240
Query 1978 tatttctttcAATCTTGCTGAAA 2000
|||||||||||||||||||||||
Sbjct 241 TATTTCTTTCAATCTTGCTGAAA 263
Regarding claim 14, the obvious fragment with gene-regulatory activity (see 103 rejection above) is derived from the dicotyledonous species Manihot esculenta. Based on common, known practices in the art, it would not be obvious to use a dicot-derived regulatory sequence linked to a heterologous transcribable polynucleotide molecule in a monocotyledonous plant species.
For the reasons above, claims 7-12, 14, and 24-26 appear free of the prior art with regard to SEQ ID NO:1.
Response to Arguments
Applicant argues beginning on p. 6 of remarks dated 08/19/2025 the
following arguments:
Applicant argues claims 21-22 are not directed to a natural phenomenon, are directed to compositions made my humans, require significantly more than a natural phenomenon, and do not preempt the use of natural products.
This argument has been fully considered and is found not persuasive for
the following reason(s):
The rejection under 35 USC 101 has been withdrawn in view of Applicant’s amendments to the claims which limits fragments to at least 50 contiguous nucleotides of SEQ ID NO: 1 operably linked to the heterologous transcribable polynucleotide molecule.
Applicant argues beginning on p. 9 of remarks dated 08/19/2025 the
following arguments:
The Action rejects claims 1-30 under 35 U.S.C. § 112(a) for allegedly failing to comply with the written description requirement. The examiner states that the claims are broadly drawn to DNA molecules and transgenic plants comprising DNA sequences with at least 85%, 90%, or 95% sequence identity to SEQ ID NOs: 1-15, 17-19, and 21-24, or fragments thereof with gene- regulatory activity, and asserts that the specification does not sufficiently describe the full scope of these claims.
Initially, it is noted that the claims are amended to recite DNA molecules comprising a DNA sequence selected from the group consisting of: a) a sequence with at least 95 percent sequence identity to any of SEQ ID NOs: 1-15, 17-19, and 21-24; b) a sequence comprising any of SEQ ID NOs: 1-15, 17-19, and 21-24; c) fragment comprising at least 50 contiguous nucleotides of any of SEQ ID NOs: 1-15, 17-19, and 21-24 having at least 95 percent sequence identity thereof, wherein the fragment has gene-regulatory activity; and d) combinations thereof, wherein said sequence is operably linked to a heterologous transcribable polynucleotide molecule. To the extent that the rejection relates to DNA sequences having less than 95 percent identity to the recited sequences, or fragments comprising fewer than 50 contiguous nucleotides of the recited sequences, the rejection is moot in view of the amendments.
1. The Specification Provides Sufficient Written Description for the Claimed Genus The written description requirement is satisfied when the specification reasonably conveys to those skilled in the art that the inventor had possession of the claimed subject matter as of the
filing date. The Federal Circuit has held that possession may be shown by disclosure of a representative number of species falling within the scope of the genus, or by disclosure of structural features common to the members of the genus so that one of skill in the art can visualize or recognize the members of the genus (see MPEP 2163 (II)(A)(3)(a)(ii), citing Univ. of Cal. Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406).
a. Representative Species and Structural Features Are Disclosed The specification describes and exemplifies the sequences recited in the claims, for example in molecular detail in the sequence listing. As acknowledged in the Action, SEQ ID NOs:1-5, 7-9, 11, 13, 16, 17, 23, and 24 are demonstrated in working examples in cassava plants (Examples 4-8) and SEQ ID NOs:6, 10, 12, 14, 15, and 18-22 are demonstrated in field-grown cassava plants (Examples 1-3). The disclosure of each of the sequences recited in the claims together with the working examples in the specification clearly constitutes a representative number of species within the claimed genus, demonstrating possession of the invention. The specification further describes the structural features of the claimed DNA molecules, including their sequence identity to the recited sequence identifiers and their function as gene-regulatory elements operably linked to heterologous transcribable polynucleotide molecules.
b. Variants Having a Percent Identity to the Recited Sequences Are Supported by the Specification and Knowledge in the Art The claims as amended recite DNA molecules with at least 95% sequence identity to the recited sequence identifiers. The generation of variants having a high sequence identity to a base sequence is a routine practice in the field of molecular biology and genetic engineering, and those skilled in the art understand how to identify and generate such variants. This is also described in the specification at paragraphs [0090]-[0092] and [0101]. Further, it is well established in the art that minor sequence variations to a disclosed sequence (such as sequences having at least 95% identity) often retain the same functional properties, particularly for regulatory sequences. The assertion in the Action that functional variants are not sufficiently described is not supported, as the specification provides both the recited sequences in the sequence listing as well as description of variants and fragments. In view of this, a person of skill in the art can readily recognize support in the specification for variants within the scope of the claims.
c. Functional Fragments Are Adequately Described The recited fragments having gene-regulatory activity are also described in the specification, for example at paragraphs [0090] and [0091]. The specification explains that the recited fragments may be defined as defined as exhibiting promoter activity possessed by the starting promoter molecule from which they are derived (see paragraph [0090]). The ability to identify functional fragments of regulatory sequences is routine in the art, and the specification provides sufficient information for a person of skill in the art to recognize possession of such fragments.
2. The Specification Supports Use in a Range of Plant Species
The examiner contends that the working examples are limited to cassava and do not demonstrate utility in other plant species. However, the claims are directed to DNA molecules and constructs that are not inherently limited to cassava. The specification provides the sequences, regulatory context, and methods for introducing these constructs into plant cells, which are applicable to a wide range of plant species. Further, the specification clearly explains that the nucleic acid molecules and polynucleotide constructs of the present invention can be used for transformation of any plant species, including, but not limited to, monocots and dicots, and provides numerous examples of the possible plant species in which they may be used. The use of regulatory sequences across plant species is well established in the art, and those skilled in the art would understand how to apply the disclosed constructs to other monocotyledonous and dicotyledonous plants, as recited in the claims.
3. Application of the Written Description Guidelines to the Present Claims The USPTO's Written Description Guidelines (see "Guidelines for Patent Written Description Requirement") provide a structured framework for evaluating whether a patent specification satisfies 35 U.S.C. § 112(a). The Guidelines emphasize that the determination is based on whether the specification, as filed, reasonably conveys to those skilled in the art that the inventor had possession of the claimed invention as of the filing date. This is assessed by considering the level of skill in the art, the predictability of the technology, the nature of the claimed genus or species, and the presence of either a representative number of species or common structural features.
a. Representative Number of Species and Structural Features
The Guidelines state that for genus claims, written description can be satisfied by either (1) disclosure of a representative number of species falling within the scope of the genus, or (2) disclosure of structural features common to the members of the genus so that one of skill in the art can visualize or recognize the members of the genus. The number of species required to represent a genus will vary depending on the level of skill and knowledge in the art and the variability among the claimed genus (Guidelines, p. 2).
In the present application, the specification discloses SEQ ID NO:1-24 and provides working examples of a substantial number of the disclosed sequences. This satisfies the requirement for a representative number of species, as the disclosed sequences are not isolated examples but rather a collection that demonstrates the breadth of the claimed genus. The Guidelines provide that where the skill and knowledge in the art is high, fewer species are required, and here, the field of plant molecular biology is well developed, further supporting sufficiency.
b. Percent Identity and Structure-Function Correlation
The Guidelines specifically address claims reciting percent identity to a disclosed sequence. Where the art recognizes a correlation between structure (e.g., sequence identity) and function, and the specification provides at least one working example, the written description requirement is satisfied for claims reciting a range of sequence identity (Guidelines, Example 11B). The present specification provides both the full sequences and functional data for the regulatory activity of the disclosed sequences. The use of 95% identity thresholds is standard in the art, and the Guidelines recognize that, in such cases, the disclosure of a single sequence and its function, combined with the knowledge in the art, can be sufficient to support claims to variants within a defined identity range - especially when the function (e.g., gene regulation) is well understood to be conserved among such variants.
c. Functional Fragments and Routine Methods
The Guidelines further explain that when claims recite an activity (such as promoter activity) of a sequence recited by partial structure, the identification of domains responsible for the activity recited in the claims provides the necessary information for a person of skill in the art to conclude that Applicants would have been in possession of the claimed genus of nucleic acids based on the disclosure of a single sequence having the claimed activity (Guidelines, p. 42).
Specifically, the Guidelines explain that where there is an art-recognized structure-function relationship, there is information about which modifications can be made to a given sequence identifier and while maintaining the recited activity (Guidelines, p. 42).
In the instant case, the specification describes such art recognized domains at paragraph [0095], explaining that a promoter or promoter fragment may be analyzed for the presence of known promoter elements, i.e., DNA sequence characteristics, such as a TATA-box and other known transcription factor binding site motifs. The specification further explains that identification of such known promoter elements may be used by one of skill in the art to design variants of the promoter having a similar expression pattern to the original promoter.
Therefore, in the instant case, the disclosure of the recited sequences together with the identification of art-recognized domains involved in gene-regulatory activity is sufficient to provide written description for the entire genus of sequences within the scope of the claims. A person of skill in the art would therefore recognize in the instant case that Applicants were in possession of the claimed genus based on the description in the specification.
d. No Requirement to Exemplify Every Embodiment Finally, the Guidelines make clear that the written description requirement does not require that every possible embodiment within the scope of the claim be exemplified (Guidelines, p. 1, 3).
Instead, the focus is on whether the disclosure reasonably conveys possession of the claimed invention. The present specification, by providing multiple working examples, detailed sequence information, and functional data, as well as established methods for generating and testing variants and fragments, meets this standard.
The specification provides a detailed disclosure that satisfies the written description requirement of 35 U.S.C. § 112(a) for claims 1-30. The claims are supported by representative species, structural features, and functional data, and the specification conveys possession of the full scope of the claimed invention to those skilled in the art. In view of this the rejection is believed to be moot, and its withdrawal is respectfully requested.
This argument has been fully considered and is found not persuasive for
the following reason(s):
The written description rejection regarding low sequence identity has been withdrawn in view of Applicant’s amendments.
The written description rejection regarding fragments is maintained despite Applicant’s amendments. SEQ ID NO: 1 is a 2,000 bp cassava-derived SWEET1 promoter. Applicant has only provided description of the full length of the sequence having gene-regulatory activity, and has not provided any specified examples of fragments of the promoter or required sequences/domains/motifs necessary for a fragment to have promoter activity (see Written Description rejection above). With respect to fragments, Applicant only generally describes in ¶0091 promoter fragments may comprise promoter activity, as described above, and may be useful alone or in combination with other promoters and promoter fragments, such as in constructing chimeric promoters. Applicant generally describes in ¶0091 in specific embodiments, fragments of a promoter are provided comprising at least about 50, 95, 150, 250, 500, 750, 1000, 1250, 1500, 1750, or at least about 2000 contiguous nucleotides, or longer, of any of SEQ ID NOs: 1-24 or a polynucleotide molecule having promoter activity disclosed herein, and fragments of SEQ ID NOs: 1-24 may have the activity of the reference promoter sequence.
Applicant also only generally describes in ¶0092 compositions derived from any of the promoters presented as SEQ ID NO: 1-24, such as internal or 5' deletions, for example, can be produced using methods known in the art to improve or alter expression, including by removing elements that have either positive or negative effects on expression; duplicating elements that have positive or negative effects on expression; and/or duplicating or removing elements that have tissue or cell specific effects on expression. Applicant generally describes in in ¶0091 compositions derived from any of the promoters presented as SEQ ID NO: 1-24 comprised of 3' deletions in which the TATA box element or equivalent sequence thereof and downstream sequence is removed can be used, for example, to make enhancer elements.
However, Applicant fails to actually describe the specific required promoter elements and motifs and their respective locations within SEQ ID NO: 1 that would maintain the required function of gene regulatory activity, including in a sequence length as low as 50 contiguous nucleotides from the 2,000 bp sequence. Given the dearth of description in the prior art, the specification would have to describe these structure-function requirements for Applicant to have been in possession of the claimed genus.
Furthermore, for inventions in emerging and unpredictable technologies, or for inventions characterized by factors not reasonably predictable which are known to one of ordinary skill in the art, more evidence is required to show possession. For example, disclosure of only a method of making the invention and the function may not be sufficient to support a product claim other than a product-by-process claim. See, e.g., Fiers v. Revel, 984 F.2d at 1169, 25 USPQ2d at 1605; Amgen, 927 F.2d at 1206, 18 USPQ2d at 1021. Where the process has actually been used to produce the product, the written description requirement for a product-by-process claim is clearly satisfied; however, the requirement may not be satisfied where it is not clear that the acts set forth in the specification can be performed, or that the product is produced by that process. Furthermore, disclosure of a partial structure without additional characterization of the product may not be sufficient to evidence possession of the claimed invention. See, e.g., Amgen, 927 F.2d at 1206, 18 USPQ2d at 1021 ("A gene is a chemical compound, albeit a complex one, and it is well established in our law that conception of a chemical compound requires that the inventor be able to define it so as to distinguish it from other materials, and to describe how to obtain it. Conception does not occur unless one has a mental picture of the structure of the chemical, or is able to define it by its method of preparation, its physical or chemical properties, or whatever characteristics sufficiently distinguish it. It is not sufficient to define it solely by its principal biological property, e.g., encoding human erythropoietin, because an alleged conception having no more specificity than that is simply a wish to know the identity of any material with that biological property. We hold that when an inventor is unable to envision the detailed constitution of a gene so as to distinguish it from other materials, as well as a method for obtaining it, conception has not been achieved until reduction to practice has occurred, i.e., until after the gene has been isolated." (citations omitted)). In such instances the alleged conception fails not merely because the field is unpredictable or because of the general uncertainty surrounding experimental sciences, but because the conception is incomplete due to factual uncertainty that undermines the specificity of the inventor's idea of the invention. Burroughs Wellcome Co. v. Barr Labs. Inc., 40 F.3d 1223, 1229, 32 USPQ2d 1915, 1920 (Fed. Cir. 1994). Reduction to practice in effect provides the only evidence to corroborate conception (and therefore possession) of the invention.
For the reasons above, the Applicant's argument is not found persuasive
The written description rejection regarding the sequence or fragment of claim 1 able to effectively confer the function of gene-regulatory activity in any plant species is maintained despite Applicant’s amendments.
It is well understood in the art the promoters and regulatory sequences do not effectively maintain their function when used in a non-closely related species, e.g. dicot promoters are often not effective promoters in unrelated dicot plant species as well as monocot plant species, and vice versa. Because there is a dearth of description in the prior art regarding SEQ ID NO: 1, and Applicant only describes SEQ ID NO: 1 has gene-regulatory activity in cassava (from which SEQ ID NO: 1 is derived) and does not describe SEQ ID NO: 1 to effectively confer gene-regulatory activity in any other dicot or monocot species, one of ordinary skill in the art would not have recognized the Applicant to be in possession of the claimed invention at the time of filing.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JESSICA N STOCKDALE whose telephone number is (703)756-5395. The examiner can normally be reached M-F 8:30-5:00 CT.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
JESSICA N. STOCKDALE
Examiner
Art Unit 1663
/JESSICA NICOLE STOCKDALE/Examiner, Art Unit 1663
/CHARLES LOGSDON/Primary Examiner, Art Unit 1662