DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 6/16/2026 has been entered.
Claim Status
Claims 1-26 pending and being examined.
All previous objections and rejections not set forth below have been withdrawn in view of Applicant’s amendments to the claims.
It is suggested that the full name of “RFS”, i.e, “Regulator of Flowering and Stress”, be recite in claims 1, 18 and 26 because there is also other gene/protein “Raffinose Synthase” in a plant which is also known as RFS (Wang et al., Cloning and Expression of a Gene Encoding a Raffinose Synthase in the Resurrection Plant Boea hygrometrica, 2012, Chinese Bulletin of Botany, 47:44–54) (English translation of the prior art is attached herewith).
Claim Rejections - 35 USC § 112(a)
Scope of Enablement
Claims 1-26 remain rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a polypeptide having 100% sequence identity to SEQ ID NO: 1, does not reasonably provide enablement for all the myriad variants of polypeptides having at least 95% sequence identity to SEQ ID NO: 1 while the modified polypeptide, when expressed, delay flowering time, increase shoot dry weight, and/or increase tolerance to drought. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
Claims 1-26 are broadly drawn to a plant cell, plant seed, or plant comprising at least one heterologous promotor operably linked to a nucleic acid segment encoding a RFS polypeptide that has at least 95% amino acid sequence identity to SEQ ID NO: 1, while overexpression of the polypeptide delays flowering time, increases shoot dry weight, and/or increases tolerance to drought.
The Applicant describes a polypeptide comprising SEQ ID NO: 1, encoded by the polynucleotide SEQ ID NO: 2 from A. thaliana (page 11-12, para 0032-0034).
The Applicant does not describe any representative working example of a polypeptide having less than 100% identity to SEQ ID NO: 1. The Applicant describes the newly identified plant-specific gene family (Regulator of Flowering and Stress family, RFS) (spec, p.2, para 0007, line 3-4) comprising a single N-terminal transmembrane helix and a conserved but uncharacterized domain in the RFS polypeptide (Spec, page 10-11, para 0030). The term “Regulator of Flowering and Stress (RFS) family” for the newly characterized protein(s) (but were known before) is also coined by the Applicant themselves ((Yang et al., A stress-inducible protein regulates drought tolerance and flowering time in Brachypodium and Arabidopsis, 2023, Plant Physiology, 191: 643–659 (published on 20 October 2022); p.644, right column, para 2, line 1-3)).
However, the Applicant does not describe if any of the domain(s) in the RFS confer(s) any of the claimed biological function(s) including delaying flowering. The Applicant does not provide any guidance that would enable any skilled artisan to mutate up to 5% or up to 9 amino acids along the entire length of the 191 amino acid long SEQ ID NO: 1, while gaining or maintaining one or more function(s) of the RFS polypeptide comprising delayed flowering, increased shoot dry weight, and/or drought tolerance.
Current status of the art also does not provide any guidance to enable any skilled artesian to mutate up to 9 amino acids along the entire length of the polypeptide comprising SEQ ID NO: 1 while maintaining one or more of the said function(s).
Using the BLAST® search of instant SEQ ID NO: 1 in the GenBank reveals only one known (zinc finger CCHC-type) but seemingly unrelated protein while almost all proteins are uncharacterized or hypothetical proteins (data not shown).
Nearest prior art, Cheng et al. (Araport11: a complete reannotation of the Arabidopsis thaliana reference genome, 2017, The Plant Journal, 89, 789–804), GenBank Accession No. Q9M250 (published in 2006) and Alexandrov et al. (US 2018/0223303 Al, published in 2018; SEQ ID NOs: 405171 and 3218584) describe a polypeptide sequence comprising 100% identity to SEQ ID NO: 1. However, none of them describe any of the biological functions including flowering time, shoot dry weight, and/or tolerance to drought being related to the polypeptide.
The Applicant describes identifying orthologs of (Arabidopsis) RFS gene in various monocots and eudicots (spec, p.66, para 00238, line 1-2). However, the Applicant does not describe how the genes/proteins are identified and/or why those genes and/or the proteins are believed to be the orthologs of AtRFS gene/protein.
The Applicant describes several proteins including SEQ ID NOs: 13, 21 and 29, claiming to be orthologs of AtRFS protein (SEQ ID NO: 1) from different plant species including soybean, sorghum and barley, respectively. However, SEQ ID NO: 1 is showing far less sequence identity than 95% with SEQ ID NOs: 13 (40.0%), 21 (28.1%), and 29 (30.3 %) (data not shown). It is noted here that there are many genes known in the art that delay flowering when overexpressed, e.g., AtAHL20 (Tayengwa et al., Overexpression of AtAHL20 causes delayed flowering in Arabidopsis via repression of FT expression, 2020, BMC Plant Biology, 20:559; Title and abstract). The same is also true for abiotic stresses including draught, as described for EDT1 gene by Zheng et al. (Over-Expression of Arabidopsis EDT1 Gene Confers Drought Tolerance in Alfalfa (Medicago sativa L.), 2017, Front. Plant Sci., 8:2125; title and abstract).
The Applicant does not provide any guidance on how to use a protein having less than 100% identity to instant SEQ ID NO: 1, so far the use of the protein and/or the plant expressing the protein is concerned and in context of the present invention.
Undue trial and error experimentations would be needed for any skilled artisan to mutate up to 5% of SEQ ID NO: 1 while the mutated polypeptide gaining or retaining one or more of said function(s) relevant to this invention.
Based on breadth of the claims, lack of any working example, lack of guidance in the instant description or in prior art, the specification at the time of the application filed would not have taught one skilled in the art how to use the full scope of the claimed invention without performing undue experiments.
Written Description
Claims 1-26 remain rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventors, at the time the application was filed, had possession of the claimed invention.
Claims 1-26 are broadly drawn to a plant cell, plant seed, or plant, or a method of generating such a plant that overexpresses a RFS polypeptide that has at least 95% amino acid sequence identity to SEQ ID NO: 1 using a heterologous promoter conferring one or more gain-of function trait(s) comprising delayed flowering, increased shoor dry weight, and/or abiotic stress comprising drought tolerance.
The Applicant describes a RFS polypeptide comprising SEQ ID NO: 1, encoded by the polynucleotide SEQ ID NO: 2 from A. thaliana (page 11-12, para 0032-0034). An RFS polypeptide encoded by an RFS gene comprises specific functions such as overexpression of BdRFS (Bd4g31140) significantly delayed flowering/heading time, enhanced biomass accumulation and drought tolerance while knockout mutants of RFS genes in A. thaliana or B. distachyon had early flowering phenotypes and were hypersensitive to water deficit (spec, p.11, para 0030, line 4-7).
However, the Applicant does not describe any representative number of species having less than 100% identity to SEQ ID NO: 1, while claiming the broad genus.
Mutating up to 5% amino acid residues in 191 amino acid long SEQ ID NO: 1 would allow mutating up to 9 amino acids. The Applicant describes the newly identified plant-specific RFS gene family comprising a single N-terminal transmembrane helix and a conserved but uncharacterized domain in the RFS polypeptide (Spec, page 10-11, para 0030). However, the Applicant does not describe if any of the domain(s) is related to and/or confer any of the claimed biological function(s).
The Applicant also does not describe any structure function relationship to enable a skilled artisan to mutate up to 9 amino acid residues anywhere in the entire length of SEQ ID NO: 1 (or any other polynucleotide sequence encoding a RFS protein) including in the single N-terminal transmembrane helix domain/motif and/or in the conserved but uncharacterized domain while achieving and/or retaining one or more of the function(s) comprising delayed flowering, increased shoot dry weight, and/or increased abiotic stress including drought tolerance which are characteristics of protein to become an RFS protein.
Nearest prior art, Cheng et al. (Araport11: a complete reannotation of the Arabidopsis thaliana reference genome, 2017, The Plant Journal, 89, 789–804), GenBank Accession No. Q9M250 (published in 2006) and Alexandrov et al. (US 2018/0223303 Al, published in 2018; SEQ ID NOs: 405171 and 3218584) describe a polypeptide sequence comprising 100% identity to SEQ ID NO: 1. However, none of them describe any of the biological functions including flowering time, shoot dry weight, and/or tolerance to drought being related to the polypeptide. Moreover, another nearest prior art Paldi et al. (WO 2015/170325 A2, published in 2015) describes the RFS protein being involved not in flowering time but in stress tolerance of a plant when infected with a plant pathogen (p.4, line 10-16), as discussed below.
The Applicant describes identifying orthologs of (Arabidopsis) RFS gene in various monocots and eudicots (spec, p.66, para 00238, line 1-2). However, the Applicant does not describe how the genes/proteins are identified and/or why those genes and/or the proteins are believed to be the orthologs of the AtRFS gene/protein as recited in the claims.
The Applicant describes several proteins including SEQ ID NOs: 13, 21 and 29, claiming to be orthologs of AtRFS protein (SEQ ID NO: 1) from different plant species including soybean, sorghum and barley, respectively. However, SEQ ID NO: 1 is showing far less sequence identity than 95% with SEQ ID NOs: 13 (40.0%), 21 (28.1%), and 29 (30.3 %) (data not shown).
It is noted here that there are many genes/proteins known the art that delay flower when overexpressed, e.g., AtAHL20 (Tayengwa et al.; Title and abstract) and/or confer drought tolerance/resistance, as discussed above.
Considering the breadth of the claims, lack of representative species of the broad genus claimed, lack of structure function relationship of the broad genus claimed, the Applicant does not appear to have been in possession of the claimed genus at the time this application was filed.
Response to Applicant’s arguments:
The Applicant’s arguments are fully considered but not found persuasive. Regarding 112(a) Scope of Enablement rejection, the Applicant referred to the Example 10 of the Written Description Training Materials from 2008 ("Guidelines") provided by the Patent Office (response, p.7-8) to conclude, “the Guidelines conclude under the written description requirement that those of ordinary skill in the art would be able to make and identify variants having 95% identity to a recited nucleic and/or amino acid sequence routinely” (response, p.8, para 5).
The Applicant arguses, “… knowledge of the genetic code and Applicant's disclosure to guide them, those of ordinary skill in the art are fully capable of determining any nucleic or amino acid sequence having 95% homology or higher to another sequence” (response, p.7, para 2, line 3-7).
In traverse of the written description rejection, the Applicant also argues, “The application as-filed discloses many homologues to the RFS protein from A. Thaliana of SEQ ID NO: 1. For example, the specification in paragraphs [0033] to [0067] provides the amino acid sequence for RFS homologues in SEQ ID NOs: 4, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35” and “The specification also discloses protein sequence alignment releaved a high degree of conservation in the N-terminal transmembrane domain and C-terminus of proteins (FIG. 12)."
Regarding Applicant’s response to the scope of enablement rejection: The Examiner respectfully disagrees. It is unclear why written description training materials are being referred to in response to an enablement rejection. Written description and enablement are distinct issues under 35 U.S.C. 112. Nonetheless, the claim in example 10 in the Guidelines does not recite any function unlike the instant claims. For that claim in the example 10, it just a matter of determining the structures (sequences) that differ from SEQ 3 by 5%. The instant claims recite that the nucleic acid segment encodes a RFS polypeptide. Therefore, polypeptides that differ in amino acid sequence from SEQ ID NO: 1 must have the functionality of the RFS polypeptide of SEQ ID NO: 1. Moreover, the Applicant is reminded that the training materials referred to has been archived by the Office.
Knowledge of genetic code would surely enable a skilled artisan to make a nucleic or amino acid sequence having 95% homology or higher to another sequence. However, the claim requires the nucleic acid segment to encode a RFS polypeptide. Thus, the skilled artisan can make a polynucleotide sequence encoding a polypeptide sequence having 95% sequence identity to instant SEQ ID NO: 1, but the artisan would not be able to determine which of such sequences retain RFS functionality without undue trial and error experimentations.
Regarding 112(a) written description rejection, the relevant instant claims recite “… RFS polypeptide that has at least 95% amino acid sequence identity to SEQ ID NO: 1…”, which is interpreted as a sequence that include any variation within SEQ ID NO: 1 maintaining at least 95% sequence identity throughout the entire length of the protein and not just within specific domain(s)/motif(s) of the proteins and retain all the functions of a RFS protein. Moreover, it is well known in the art that many proteins including many transcription factors with diverse functions contain one or more conserved domains/motifs (Zenker et al., Many transcription factor families have evolutionarily conserved binding motifs in plants, 2025, Plant Physiology, 198:kiaf205) and do not qualify as orthologs to each other.
A skilled artisan would acknowledge that a change of even one amino acid along the entire length of a polypeptide can drastically alter the function of the mutated polypeptide.
The Applicant does describe identifying orthologs of (Arabidopsis) RFS gene in various monocots and eudicots (spec, p.66, para 00238, line 1-2). However, the Applicant does not describe how the genes/proteins are identified and/or why those genes and/or the proteins are believed to be orthologs of AtRFS gene/protein.
A skilled artisan would also know that there are many genes known in the art that delay flowering when overexpressed, e.g., AtAHL20 (Tayengwa et al.; Title and abstract), but are not orthologs of each other or an ortholog of the RFS gene/protein. The same is true for abiotic stress including draught, as described for EDT1 gene by Zheng et al. (title and abstract).
The Applicant describes several proteins including SEQ ID NOs: 13, 21 and 29, claiming to be orthologs of AtRFS protein (SEQ ID NO: 1) from different plant species including soybean, sorghum and barley, respectively. However, SEQ ID NO: 1 is showing far less sequence identity than 95% with SEQ ID NOs: 13 (40.0%), 21 (28.1%), and 29 (30.3 %) (data not shown). The instant specification does not describe or explain why these diverse sequences are considered to be orthologs.
Claim Rejections - 35 USC § 102(a)
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1, 4, 7 and 18-19 are rejected under 35 U.S.C. 102(a)(1) as anticipated by Paldi et al. (WO 2015/170325 A2, published in 2015).
Claim 1 is drawn to a plant cell, plant seed, or plant comprising at least one heterologous promotor operably linked to a nucleic acid segment encoding a RFS polypeptide that has at least 95% amino acid sequence identity to SEQ ID NO: 1, wherein the promoter and nucleic acid segment is endogenously expressed or encoded in an expression system. Claim 18 is broadly drawn to a method of producing the plant or the plant cells of claim 1.
Paldi et al. describes a method of increasing yield, growth rate, vigor, biomass, fruit quality or stress tolerance of a citrus plant when infected with a plant pathogen, the method comprising introducing into the citrus plant an isolated nucleic acid agent comprising a nucleic acid sequence which specifically reduces the expression of at least one plant pathogen resistance gene product of the plant, thereby modulating at least one plant pathogen resistance response and increasing yield, growth rate, vigor, biomass, fruit quality or stress tolerance of the citrus plant when infected with a plant pathogen (p.4, line 10-16). Besides citrus, Paldi et al. also used tomato plants (p.65, line 2-3).
Paldi et al. teaches various plant pathogen resistance genes (Arabidopsis homologs) including SEQ ID NO: 125 (claim 16; p.6, line 11-13; p.28, line 29; p.32, Table II), which is encoding a protein having at least 95% sequence identity to instant SEQ ID NO: 1, as shown below.
RESULT 1
BCH13392
ID BCH13392 standard; DNA; 576 BP.
AC BCH13392;
DT 31-DEC-2015 (first entry)
DE Arabidopsis thaliana AT3G43110.1 gene, SEQ ID 125.
KW AT3G43110.1; biomass; crop improvement; ds; fruit; gene silencing; pathogen resistance; plant; plant growth stimulator; rna interference;
seed yield increasing; stress tolerance; transgenic plant.
OS Arabidopsis thaliana.
CC PN WO2015170325-A2.
CC PD 12-NOV-2015.
CC PF 04-MAY-2015; 2015WO-IL050469.
PR 04-MAY-2014; 2014US-0988234P.
PR 04-MAY-2014; 2014US-0988235P.
PR 04-MAY-2014; 2014US-0988236P.
PR 04-MAY-2014; 2014US-0988237P.
PR 04-MAY-2014; 2014US-0988246P.
CC PA (FORR-) FORREST INNOVATIONS LTD.
CC PI Boncristiani H, Ilan S, Maori E, Paldi N, Wellner A;
DR WPI; 2015-71072F/79.
CC PT Increasing yield, growth rate, vigor, biomass, fruit quality or stress
tolerance of infected plant, by introducing agent comprising nucleic acid
sequence specifically reducing pathogen resistance gene product
expression into plant.
CC PS Claim 16; SEQ ID NO 125; 123pp; English.
CC The present invention relates to a novel method for increasing yield, growth rate, vigor, biomass, fruit quality or stress tolerance of a Citrus plant when infected with a plant pathogen. The method comprises: introducing into Citrus plant an isolated nucleic acid agent comprising anucleic acid sequence which specifically reduces the expression of plant pathogen resistance gene product of the plant, for modulating at least one plant pathogen resistance response. The invention also provides: (1) an isolated nucleic acid agent comprising a nucleic acid sequence which
reduces the expression of plant pathogen resistance gene, where in the nucleic acid agent is a siRNA, shRNA, hpRNA, miRNA and ihpRNA; (2) a nucleic acid construct comprising a nucleic acid sequence encoding the isolated nucleic acid agent; (3) a bacterial host cell comprising the nucleic acid construct; (4) a Citrus plant comprising the exogenous isolated nucleic acid agent; (5) a transgenic plant comprising the exogenous isolated nucleic acid agent; and (6) an agrochemical composition comprising the isolated nucleic acid agent and a plant-beneficial compound such as fertilizer, an antibiotic, a biocide, a pesticide, a pest repellent, an herbicide, and a plant hormone. The method prevents adverse effects of plant pathogen resistance response on the infected plant. The present sequence is an Arabidopsis thaliana AT3G43110.1 gene, used in the invention for producing a pathogen resistance transgenic plant.
SQ Sequence 576 BP; 158 A; 92 C; 188 G; 138 T; 0 U; 0 Other;
Alignment Scores:
Length: 576
Score: 1036.00 Matches: 191
Percent Similarity: 100.0% Conservative: 0
Best Local Similarity: 100.0% Mismatches: 0
Query Match: 100.0% Indels: 0
Gaps: 0
US-18-465-840-1 (1-191) x BCH13392 (1-576)
Qy 1 MetAlaThrLeuAspSerProLeuGluValLeuAlaPheAspTyrValAsnPheValPhe 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGGCGACTTTGGATTCTCCGTTAGAGGTTTTGGCTTTCGACTACGTTAACTTCGTCTTT 60
Qy 21 AsnAsnLeuTrpThrTrpIleAlaValValThrAlaAlaValSerPheTrpArgIleArg 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 AACAATCTTTGGACATGGATCGCCGTCGTGACGGCCGCCGTTAGTTTCTGGCGGATCCGA 120
Qy 41 AlaThrThrThrThrThrThrSerGlyGlyGlyArgAspAsnGlyLeuIleAspGluSer 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 GCCACTACCACTACCACCACCAGCGGAGGTGGTAGAGACAATGGCTTAATAGATGAATCT 180
Qy 61 PheLeuGluProProLysProGlnAlaThrLysAlaAlaLeuLeuMetGluThrLysPro 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 TTTCTTGAGCCACCAAAACCACAAGCGACAAAGGCTGCTCTCCTTATGGAGACGAAACCT 240
Qy 81 ProArgValLysValThrGluThrGluAspTrpSerLeuLeuLeuCysLysAspGlyVal 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 CCTAGAGTCAAGGTAACGGAGACTGAGGATTGGAGTTTGTTGTTGTGTAAGGACGGAGTA 300
Qy 101 ThrLysGlyLysLeuThrValTyrTyrGluGluGluIleAspGlyGluArgGluGluAsp 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 ACGAAGGGGAAGCTAACCGTGTACTACGAAGAAGAGATTGACGGAGAGAGAGAAGAAGAT 360
Qy 121 AspGlyGluThrThrAlaValLysTyrGlyGlyGlyGluSerGlyGluTrpTrpGluArg 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 GACGGAGAGACAACGGCCGTTAAGTATGGAGGAGGTGAGAGTGGAGAATGGTGGGAGAGA 420
Qy 141 TrpGluArgValValLysMetArgAsnGlyAspGluGlyTrpTyrArgTyrValAspLeu 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 TGGGAGAGAGTGGTGAAGATGAGAAATGGAGATGAAGGTTGGTACCGTTACGTGGATTTA 480
Qy 161 ThrValIleAsnGlyAsnValValArgLeuTrpAspAlaAsnArgValArgAsnGlyGly 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 ACGGTGATTAACGGAAATGTTGTGAGGTTGTGGGATGCTAACCGTGTACGTAACGGTGGT 540
Qy 181 TrpValSerValGlnArgLysGluCysTyrGly 191
|||||||||||||||||||||||||||||||||
Db 541 TGGGTTAGTGTGCAACGTAAGGAGTGTTATGGT 573
Although Paldi et al. does not refer to the polypeptide as a RFS polypeptide, SEQ ID NO: 125 encodes a protein having the same structure (100% sequence identity) of instant SEQ ID NO: 1 and originated in the same plant species, Arabidopsis (A. thaliana). Thus, it is inherent that SEQ ID NO: 125, as taught by Paldi et al., is the same polypeptide of instant SEQ ID NO: 1 and would be having the same functions. It is well known in the art and also asserted by Paldi et al. that expression of any specific polynucleotide comprises transcription of the heterologous DNA sequence into mRNA operably linked to one or more promoter sequence(s) (reads on to “heterologous promoter”) functional in a host cell into mRNA (p. 50, line 20-23; p.54, line 8-9). Paldi et al. describes developing transgenic plants via various methods known in the art (p.54, line 15-16) which includes Agrobacterium-mediated transformation and particle bombardment (p.54, line 18-20) using recombinant DNA construct operably linked to a promoter that is functional in the host plant. A transgenic plant developed via agrobacterium-mediated transformation or by bombardment using microparticles coated with a recombinant DNA inherently would integrate the transgene in a non-native location in the host genome, as recited in claim 4.
Paldi et al. describes downregulating specific genes using a dsRNA sequence of up to 600 nucleotide long (p.43, line 21-22) corresponding to the coding sequence (which is 573 nucleotide long for SEQ ID NO: 125, as shown above) of a gene and also comprises an RNA complement of the gene's coding sequence (p.42, line 18-20). Thus, Paldi et al. describes using full length of the polynucleotide sequence encoding a peptide set forth by SEQ ID NO: 125 operably linked to a heterologous promoter in a plant, as recited in claim 1.
Regarding claims 7, Paldi et al. describes that the plant is an agricultural crop like citrus or a Solanaceous plant (p.4, line 28-29) and harvesting harvestable organs or biomass (fruit, flower, and seed) (p.243, line 15-16; line 20-22), as recited in claim 19.
It is noted, however, that claim 1 does not require the RFS polypeptide to be expressed. Accordingly, Paldi et al. anticipates the claimed invention.
Alternatively, if the dsRNA expression of Paldi is not considered to meet the limitation of expressing a nucleic acid segment encoding SEQ ID NO:1, then the following obviousness analysis under 35 USCS 103 is presented below.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-12 and 17-26 are rejected under 35 U.S.C. 103 as being unpatentable over Paldi et al. (WO 2015/170325 A2, published in 2015) in view of Smyth et al. (Gene silencing: Cosuppression at a distance, 1997, Current Biology, 7:R793–R795), Alexandrov et al. (US 2018/0223303 Al, published in 2018), Koropatkin et al. (How glycan metabolism shapes the human gut microbiota, 2012, Nat. Rev. Microbiol., 10(5): 323–335) and Cano et al. (Production of Oligosaccharides from Agrofood Wastes, 2020, Fermentation, 6:31).
Paldi et al. describes a plant with increased yield, growth rate, vigor, biomass, fruit quality or stress tolerance when infected with a plant pathogen, expressing a polynucleotide sequence encoding a RFS polypeptide comprising at least 95% amino acid sequence identity to SEQ ID NO: 1, as discussed above.
It is again noted that while instant claim 1 recites “the promoter and nucleic acid segment is endogenously expressed”, the claim does not require the RFS polypeptide to be expressed.
However, Paldi et al. does not explicitly describe expressing the dsRNA using a heterologous promoter to produce an RFS protein encoded by the dsRNA.
It would have been prima facie obvious and within the scope of an ordinary skill in the art before the time the application was filed to downregulate the gene encoding a RFS polypeptide that has at least 95% amino acid sequence identity to SEQ ID NO: 1, with a realistic expectation of success to develop specific and beneficial traits including increased resistance to a pest/pathogen in citrus, tomato, or any other economically important plants (as recited in claims 7-12) in a breeding program, and this would result in the Applicant’s claimed invention.
An ordinarily skilled artisan would have been motivated to downregulate the gene encoding a protein having at least 95% sequence identity to instant SEQ ID NO: 1 using a dsRNA sequence which is full length cDNA set forth by SEQ ID NO: 125, as taught by Paldi et al., using well known techniques of RNAi (comprising the full length sequence of the coding region encoding the RFS polypeptide) or co-suppression (when a plant carries a full length transgenic copy of the target gene or its cDNA sequence, which is well-known in the art (Smyth et al.; title and abstract)). Using RNAi or co-suppression would have been an experimental design choice of the artisan without changing the outcome.
Regarding claims 2 and 21, Inducible promoters are well known in the art (Alexandrov et al.; page 207, para 2005, line 12; page 220, para 2261, last line; page 220, para 2267, line 6-7) which would have been beneficial to downregulate the RFS polypeptide only when the plant experience target pathogen attack/infection.
Regarding claim 3 and 22, tissue specific promoters are well known in the art (Alexandrov et al.; page 219, para 2261, line 5) and an ordinarily skilled artisan would have been motivated to use such promoters to downregulate the RFS polypeptide only in the specific tissue affected by the target pathogen.
Regarding claims 5-6 and 23, CaMV35S promoter is well known (Alexandrov et al.; page 221, para 2283, line 31-32) to constitutively express heterologous genes in a plant. An ordinarily skilled artisan would have been motivated to use the strong and constitutive CaMV35S promoter to significantly and constitutively downregulate the expression of the RFS polypeptide for plants in agroclimatic zones with frequent target pathogen attack on the (host) crop especially when they pathogen infection is more systemic throughout the plant. An ordinarily skilled artisan would also have been motivated to replace the endogenous promoter of the endogenous RFS gene with the heterologous 35SCaMV promoter by using a well-known standard technique of CRISPR-Cas, which would satisfy all the claim limitations of claim 6.
Regarding claims 7-12, Alexandrov et al. describes commercially important agricultural crops including corn, soybean, soybean, wheat and rice (page 2, para 0032, last 2 lines) (claims 7-9), sorghum (page 221, para 2280, 2nd last line) (claim 10), sugar beet (page 228, Table 3) (claim 11), and cotton (page 228, Table 3) (claim 12).
Regarding claim 17, Alexandrov et al. describes several drought responsive genes (page 4, para 0074). An ordinarily skilled artisan would have been motivated to develop new genotypes including transgenic plants with increased drought tolerance (page 81, last line; page 138, para 1593; page 139, table “stress response”) and stack such trait(s) on top of the pathogen resistance trait, as described by Paldi et al. and as discussed above.
Regarding claim 19, Alexandrov et al. describes genes that modulate plant biomass (page 37, para 0660, line 7-12). Any ordinarily skilled artisan would know and would been motivated to harvest biomass including seeds from the transgenic plants with increased biomass especially the seeds (grains) in crops where the grains/seeds are of economic importance.
Regarding claim 20, Alexandrov et al. describes generation of transgenic plants with enhanced yield including biomass either directly or via increasing tolerance/ resistance against various biotic and/or abiotic stresses (page 32, para 0569, line 5-7). It describes yield (including biomass such as fresh and dry weight during any time in plant life, including maturation and senescence), root/tuber yield (such as number, size, weight, harvest index, content and composition, (i.e. amino acid, jasmonate, oil, protein and starch), number of flowers, seed yield, number, size, weight, harvest index, content and composition ( e.g. amino acid, jasmonate, oil, protein and starch), and fruit yield (such as number, size, weight, harvest index, post harvest quality, content and composition, ( e.g. amino acid, jasmonate, oil, protein and starch) (page 33, para 0609, line 10-20). Starch is a glycan consists of glucose monomers (or monosaccharides) (Koropatkin et al.; page 22, Focus Box 1, line 1). Isolating commercially important starch and other carbohydrates including oligosaccharides is a known and routine process in the art (Cano et al. (Production of Oligosaccharides from Agrofood Wastes, 2020, Fermentation, 6:31; abstract and entire article).
Regarding claims 24-26, Alexandrov et al. describes exposing the plants to abiotic stresses (page 145, para 1640, line 7-8) including various environmental stresses such as drought (page 23, para 0388, line 3-6). An ordinarily skilled artisan would have been motivated to combine abiotic stresses including various environmental stresses such as drought resistance trait with the pathogen resistance trait, as described by Paldi et al.
Conclusion
No claim is allowed.
Communication
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
J.C.
/Jay Chatterjee/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
Prosecution Insights