DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 07/31/2026. Claims 1-3, 5, 6, 8-24, 37 are currently pending. Claims 22, 23 are withdrawn from prosecution as being drawn to nonelected subject matter. Accordingly, claims 1-3, 5, 6, 8-21, 24, 37 are examined herein.
Election/Restrictions
Claims 22, 23 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected Group II, there being no allowable generic or linking claim. The restriction requirement mailed on 02/04/2026 is still deemed proper. Applicant's elected Group I without traverse in the reply filed on 07/31/2026.
Applicant elected the following species in response filed on 07/31/2026: System ID 2123, which includes a first attachment site sequence of SEQ ID NO: 10613 and a second attachment site sequence of SEQ ID NO: 10615, and a serine recombinase sequence of SEQ ID NO: 10611. At least claims 5 and 8-14 read on the elected species.
Based on sequence search, the elected species is free of prior art for some of the claims, hence the search is expanded to the genus. However, the restriction requirement mailed on 02/04/2026 is still deemed proper and is thereby maintained.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. This application claims priority to PRO 63/480,342 filed on 01/18/2023, and to PRO 63/376,048 filed on 09/16/2022.
Specification
The use of the terms IDT, NEB, New England Biolabs, OneShot, Qiagen, TransIT, Novocyte, Quanteon, DNAdvance, Beckman Coulter, Bio-Rad, ddPCR, Oxford Nanopore, Illumina, BluPippin, Sage Science, AMPure, Thermo Fisher Scientific, Sigma-Aldrich, Qubit, Agilent, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-3, 5, 6, 8-21, 24, 37 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 1, 2, 18-20, 24, 37, the phrase "e.g." renders the claim indefinite because it is unclear whether the limitation following the phrase is part of the claimed invention. See MPEP § 2173.05(d).
Regarding claims 5, 8-12, 14, the recitation of “Table 1” or “Table 2” is considered indefinite. MPEP 2173.05(s) states "Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim". Applicant can simply recite SEQ ID NOs in this case.
Regarding claim 8, it depends on a cancelled claim 7, hence claim 8 is incomplete because it has no proper parent claim, therefore its scope is unclear. See MPEP §608.01(n).
Those claims identified in the statement of rejection but not explicitly referenced in the rejection are also rejected for depending from a rejected claim but failing to remedy the indefiniteness therein.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-3, 5, 6, 8-21, 24, 37 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Abudayyeh (US20230272435A1, published on 08/31/2023, has priority to PRO 63/265,002 filed on 12/06/2021 with verified complete sequence and subject matter disclosure), as evidenced by Merrick (ACS Synth Biol. 2018;7(2):299-310; Listed in IDS filed on 09/15/2023). Claims 10 and 11 are evidenced by Van Duyne (Crit Rev Biochem Mol Biol. 2013;48(5):476-91; Listed in IDS filed on 09/15/2023).
Regarding claim 1, Abudayyeh teaches a method for integrating an exogenous nucleic acid into a human genome (Page 2,¶[0010]; Page 7, ¶[0044]; Page 17, ¶[00117]; Page 12, ¶[0074], step (b)), the method comprising: contacting a cell (Page 6, [0038]; Page 25, ¶[00157], last line; Page 36, ¶[00185]; Page 37, ¶[00189]), encompassing a human cell, with an exogenous nucleic acid comprising a nucleic acid sequence of interest and a first attachment site and a large serine integrase (Page 1, Background, [004]), e.g. Bxb1, a type of site-specific recombinases, as evidenced by Merrick (2018; Page 299, Abstract, line 3) or a polynucleotide encoding the serine recombinase, wherein the human genome comprises a second attachment site and recombination between the first and second attachment sites results in integration of the exogenous nucleic acid into the human genome (Abudayyeh, FIG. 2).
Regarding claim 2, Abudayyeh further teaches that “the size of the inserted gene or nucleic acid can vary from about 1 bp to about 50,000 bp” (Page 35, ¶[00181]), which is “up to 50kb”.
Regarding claim 3, based on the teaching of the instant specification (Page 35, ¶[0069], the last 2 lines), “the attP/B site that can specifically recombine with an attH site is referred to as an "attD site" (i.e., donor attachment site, e.g., an attachment site in a donor plasmid)” and “attachment sites in the human genome ("attH")” (¶[0069], line 14), Abudayyeh further teaches the first attachment site is or comprises a donor attachment (attD) site, and wherein the attD site comprises an attB sequence or an attP sequence (Abudayyeh, FIG. 2; Page 2, ¶[008]).
Regarding claim 5, Abudayyeh further teaches the method of claim 3, wherein the first attachment site, i.e. an attB site comprises a nucleic acid sequence at least 50% identical to an attB or attP sequence selected from Table 1. Abudayyeh discloses an attB, i.e. a first attachment site, in SEQ ID NO: 2132 and an attP, i.e. a second attachment site, in SEQ ID NO: 3132, in Table 8, on pages 343-344, nucleic acid ID N71930_1_145, associated with large serine integrase/recombinase with amino acid sequence set forth in SEQ ID NO: 1132. Based on EMBOSS Needle sequence identity comparison (www.ebi.ac.uk/jdispatcher/psa/emboss_needle), SEQ ID NO: 2132 has a 90.0% identity of the claimed first attachment site sequence set forth in the instant SEQ ID NO: 36232, and SEQ ID NO: 3132 has an 82.5% identity of the claimed second attachment site sequence set forth in the instant SEQ ID NO: 36233. See EMBOSS Needle alignment below:
Instant SEQ ID NO: 36232 attP : tgtcgccacc ttgttggtgt aattaggttg acgccaacag ggtgataaca
Abudayyeh SEQ ID NO: 2132 attB: tgtcgtcacc ttgttggtgt aattaggttt acaccaacaa ggtgacaaca
Instant SEQ ID NO: 36233 attB: tgttgccatt aggcgcatga ggtttacccc atttaatcct
Abudayyeh SEQ ID NO: 3132 attP: tcttttgtag ccattaggcg cattagattt actccattaa gccctaaagc
########################################
# Program: needle
# Rundate: Mon 5 Oct 2026 15:53:03
# Commandline: needle
# -auto
# -stdout
# -asequence emboss_needle-I20261005-155258-0661-37402213-p1m.asequence
# -bsequence emboss_needle-I20261005-155258-0661-37402213-p1m.bsequence
# -datafile EDNAFULL
# -gapopen 10.0
# -gapextend 0.5
# -endopen 10.0
# -endextend 0.5
# -aformat3 pair
# -snucleotide1
# -snucleotide2
# Align_format: pair
# Report_file: stdout
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: Abudayyeh SEQ ID NO: 2132
# 2: Instant SEQ ID NO: 36232
# Matrix: EDNAFULL
# Gap_penalty: 10.0
# Extend_penalty: 0.5
#
# Length: 50
# Identity: 45/50 (90.0%)
# Similarity: 45/50 (90.0%)
# Gaps: 0/50 ( 0.0%)
# Score: 205.0
#
#=======================================
Abudayyeh SEQ ID NO: 2132 1 tgtcgtcaccttgttggtgtaattaggtttacaccaacaaggtgacaaca 50
|||||.|||||||||||||||||||||||.||.||||||.|||||.||||
Instant SEQ ID NO: 36232 1 tgtcgccaccttgttggtgtaattaggttgacgccaacagggtgataaca 50
########################################
# Program: needle
# Rundate: Mon 5 Oct 2026 15:51:10
# Commandline: needle
# -auto
# -stdout
# -asequence emboss_needle-I20261005-155105-0484-78242917-p1m.asequence
# -bsequence emboss_needle-I20261005-155105-0484-78242917-p1m.bsequence
# -datafile EDNAFULL
# -gapopen 10.0
# -gapextend 0.5
# -endopen 10.0
# -endextend 0.5
# -aformat3 pair
# -snucleotide1
# -snucleotide2
# Align_format: pair
# Report_file: stdout
########################################
#=======================================
#
# Aligned_sequences: 2
# 1: Abudayyeh SEQ ID NO: 3132
# 2: Instant SEQ ID NO: 36233
# Matrix: EDNAFULL
# Gap_penalty: 10.0
# Extend_penalty: 0.5
#
# Length: 40
# Identity: 33/40 (82.5%)
# Similarity: 33/40 (82.5%)
# Gaps: 0/40 ( 0.0%)
# Score: 137.0
#
#=======================================
Abudayyeh SEQ ID NO: 3132 1 tcttt tgtagccattaggcgcattagatttactccattaagccct aaagc 50
|||.||||||||||||||.||.|||||.|||||.|..|||
Instant SEQ ID NO: 36233 1 tgttgccattaggcgcatgaggtttaccccatttaatcct 40
Regarding claim 6, Abudayyeh further teaches installing pseudo attP integration site in the target human genome for serine integrase/recombinase-mediated transgene integration (Page 26, ¶[00162]) thus, teaching the method of claim 1, wherein the second attachment site comprises an acceptor attachment site comprising an attP sequence. When human cells are used, these installed pseudo attP sites are considered attH sites based on the definition discussed above. The term acceptor attachment site (attA) is a functional definition, and FIG. 2 of Abudayyeh demonstrates that the installed pseudo attP attachment site in the cell genome has the exact function.
Regarding claim 8, it is interpreted that claim 8 is intended to depend from claim 6. See sequence identity analysis above in claim 5, Abudayyeh teaches a second attachment site comprising a nucleic acid sequence, set forth in SEQ ID NO: 3132, at least 82.5% identity of a claimed attP site selected from Table 1 with sequence set forth in the claimed SEQ ID NO: 36233, 82.5>50%.
Regarding claim 9, Abudayyeh teaches a serine integrase/recombinase sequence set forth in SEQ ID NO: 586, which has 99% sequence identity of the elected species, a large serine recombinase with amino acid sequence set forth in the claimed SEQ ID NO: 10611, selected from Table 1. And 99%>80%. See alignment below.
Query: Instant SEQ ID NO: 10611; Sbjct: Abudayyeh SEQ ID NO: 586
PNG
media_image1.png
816
870
media_image1.png
Greyscale
Regarding claim 10, Abudayyeh teaches a serine integrase/recombinase sequence set forth in SEQ ID NO: 880, which has 100% sequence identity of a large serine recombinase with amino acid sequence, selected from Table 1, set forth in the claimed SEQ ID NO: 1166. See sequence alignment below. All large serine recombinases (LSRs) have the three distinct domains: the amino-terminal catalytic domain, the recombinase domain, and the DNA-binding zinc ribbon domain, as evidenced by Van Duyne (2013; Page 477, Figure 1). Since the sequences are identical across the full protein length, all domains are included, measured using any method, Abudayyeh teaches all the claim’s limitations even without UCLUST algorithm analysis.
Query: Instant SEQ ID NO: 1166; Sbjct: Abudayyeh SEQ ID NO: 880
PNG
media_image2.png
670
868
media_image2.png
Greyscale
Regarding claim 11, Abudayyeh teaches a serine integrase/recombinase sequence set forth in SEQ ID NO: 781, which has 99% (539aa/540aa) sequence identity of a large serine recombinase with amino acid sequence, selected from Table 2, set forth in the claimed SEQ ID NO: 33021. See sequence alignment below. All large serine recombinases (LSRs) have the three distinct domains: the amino-terminal catalytic domain, the recombinase domain, and the DNA-binding zinc ribbon domain, as evidenced by Van Duyne (2013; Page 477, Figure 1). Since the sequences are nearly identical across the full protein length, with only a single amino acid in difference, all domains are included, measured using any method, Abudayyeh teaches all the claim’s limitations even without UCLUST algorithm analysis.
Query: Instant SEQ ID NO: 33021; Sbjct: Abudayyeh SEQ ID NO: 781
PNG
media_image3.png
744
859
media_image3.png
Greyscale
Regarding claim 12, Abudayyeh teaches a large serine integrase/recombinase with amino acid sequence set forth in SEQ ID NO: 880, which is identical in sequence to a recombinase selected from cluster 104, i.e. a recombinase as identified in Table 1 with amino acid sequence set forth in the claimed SEQ ID NO: 1166, see sequence alignment above.
Regarding claim 13, Abudayyeh teaches a serine integrase/recombinase sequence set forth in SEQ ID NO: 586, which has 99% sequence identity of the elected species, with amino acid sequence set forth in the claimed SEQ ID NO: 10611. And 99%>80%. See alignment in claim 9 above.
Regarding claim 14, Abudayyeh discloses an attB, i.e. a first attachment site, in SEQ ID NO: 2132 and an attP, i.e. a second attachment site, in SEQ ID NO: 3132, in Table 8, on pages 343-344, nucleic acid ID N71930_1_145, associated with large serine integrase/recombinase with amino acid sequence set forth in SEQ ID NO: 1132, which has 97% (497aa/515aa) sequence identity of a serine recombinase amino acid sequence set forth in the instant SEQ ID NO: 36231. See alignment below. Based on EMBOSS Needle sequence identity comparison above in claim 5, SEQ ID NO: 2132 has a 90.0% identity of the claimed first attachment site sequence set forth in the instant SEQ ID NO: 36232, and SEQ ID NO: 3132 has an 82.5% identity of the claimed second attachment site sequence set forth in the instant SEQ ID NO: 36233. See EMBOSS Needle alignment in claim 5 above.
Query: Instant SEQ ID NO: 36231; Sbjct: Abudayyeh SEQ ID NO: 1132
PNG
media_image4.png
741
861
media_image4.png
Greyscale
Regarding claim 15 and 16, Abudayyeh further teaches that the nucleic acid encoding the genome editing system is introduced into the cell as a “…mRNA, or a linear DNA” (Page 13, ¶[0078]).
Regarding claim 17, Abudayyeh further teaches incorporating “appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a host organism…for example, … a promoter …” (Page 36, ¶[00184]), and since human cells are contemplated in the disclosure and used Examples 2 and 3, Abudayyeh teaches the method of claim 1, wherein the polynucleotide encoding the serine recombinase is operably linked to a promoter that is active in the human cell.
Regarding claim 18, Abudayyeh further teaches the method of claim 1, wherein “the nucleic acid is introduced into the cell as a minicircle, a plasmid, mRNA or a linear DNA” (Page 13, ¶[0078]).
Regarding claims 19 and 20, Abudayyeh further teaches that the genome editing system is “introduced using a virus, a RNP, an mRNA, a lipid, or a polymeric nanoparticle” (Page 14, ¶[0096]). This method encompasses embodiments wherein the polynucleotide encoding the large serine recombinase is in the form of mRNA or comprises mRNA, and is delivered in the format of a lipid nanoparticle (LNP).
Regarding claim 24, Abudayyeh’s description for step (b) of the method on page 12, ¶[0074], and FIG. 2 describe the claimed method for obtaining integration of an exogenous nucleic acid comprising nucleic acid sequence of interest and a first attachment site intoa human genome comprising a second attachment site, the method comprising:
Contacting the first attachment site with a second attachment site in the presence of a serine recombinase, wherein the contacting step results in recombination between the first and second attachment sites (Abudayyeh, FIG. 2), and wherein recombination between the first and second attachment sites results in integration of the exogenous nucleic acid into the human genome.
Regarding claim 37, Abudayyeh teaches a system for integrating an exogenous nucleic acid comprising a nucleic acid sequence of interest into a human genome (Abudayyeh, FIG. 1 & 2), the system comprising: An exogenous nucleic acid comprising a nucleic acid sequence of interest and a first attachment site, and a serine recombinase or a polynucleotide encoding the serine recombinase (Page 20, Overview, ¶[00139]).
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DELPHINUS DOU YI YU/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
