DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application July 8, 2026 after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114.
Application Status
Applicant’s remarks and amendments to the claims filed July 8, 2026 are acknowledged. Claims 1-3, 5-7, 9-17, and 21 were amended, claims 4 and 8 were cancelled. Claims 1-3, 5-7, 9-26, and 31 are pending.
Election/Restriction
Claims 25-26 remain withdrawn pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Accordingly, claims 1-3, 5-7, 9-24, and 31 are under examination herein.
Withdrawn Rejections
Applicant’s remarks and the amendments to the claims have been thoroughly reviewed. The amendments to the claims are sufficient to overcome the claim objections and § 112(b) rejections raised in the prior action.
Applicant’s remarks and amendments to the claims have been thoroughly considered but are not found persuasive to place the claims in condition for allowance for the reasons that follow. Any rejection or objection not reiterated herein has been overcome by amendment.
Claim Objections
Claims 7, and 13-17 are objected to because of the following informalities:
Claim 7 recites “wherein the heterologous object sequence has an RNA sequence of TTTCTC.” It is reasonably clear the claim intends to require an RNA sequence identical to the sequence “TTTCTC.” The claims should be amended to recite “wherein the heterologous object sequence has an RNA sequence [[of]]100% identical to the nucleic acid sequence TTTCTC,” accordingly.
Claims 13-16 should be amended to recite “The template RNA or the DNA of claim 1, wherein the template RNA
Claim 17 should be amended to recite “the[[a]] template RNA or the DNA of claim 1…” because it is reasonably clear that the phrase “a template RNA or the DNA claim of claim 1” refers to the template RNA of claim 1.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 3 and 5 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. The rejections that follow are new.
Claim 3 recites that “the gRNA spacer has a length of 20 nucleotides.” SEQ ID NO: 20,623 is 20-nts in length, and therefore, the gRNA spacer of claim 1 already requires a gRNA spacer having a length of 20 nucleotides. Claim 3 fails to further limit the subject matter of the claim upon which it depends.
Claim 5 recites that “the heterologous object sequence has a length of 6 nucleotides.” Claim 1 recites that “the heterologous object sequence has a length of between 6-15 nucleotides,” and thus, claim 1 already requires a heterologous object sequence having a minimum length of 6 nucleotides. Claim 5 fails to further limit the subject matter of the claim upon which it depends.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Notice to Joint Inventors
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim Rejections – 35 USC § 103 – Kweon in view of Conway and Anzalone
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-3, 5-7, 9-14, 17-24, and 31 are rejected under 35 U.S.C. 103 as being unpatentable over Kweon (Kweon et al., 23 February 2021, Molecular Therapy, 29(6), p. 2001-2007 and Supplemental Information and Table S2, of record), in view of Conway (Conway et al., Patent No. US 10,960,085 B2, published 30 March 2021, of record), and Anzalone (Anzalone et al., 21 October 2019, Nature, 576, p. 149-157, and Methods, Extended Data, and Supplementary Information, of record). The rejections that follow are maintained from the prior action with modification necessitated by Applicant’s amendments.
Regarding claims 1-3, and 17, Kweon teaches a gene modifying system comprising a template RNA (“pegRNA”) and a gene modifying polypeptide (“PE2-SpRY”), or a nucleic acid encoding the gene modifying polypeptide (pg. 2001, right col.; pg. 2005, Plasmid DNA and pegRNAs). Kweon teaches the SpyCas9-SpRY domain allows for efficient prime editing of a desired target gene in a PAM-independent manner (pg. 2002-2003; Fig. 1D-E; pg. 2004-2005).
Kweon teaches the template RNA comprises from 5’ to 3’, a 20-nucleotide gRNA spacer that is complementary to a target gene (“a. Oligonucleotides for the spacer sequence (target-specific component)… Nx20 is the target spacer sequence”, Supplemental Information, Note S1), a gRNA scaffold that binds a SpyCas9-SpRY domain (“pegRNA scaffold sequence (common component)”), a heterologous object sequence (“RT template”) and a primer binding site (“PBS”) with at least 3 bases with 100% identity to a target gene (Supplemental Information, Note S1; Table S2, columns E-F, I). Kweon teaches PBS sequences (“PBS”) 9 and 11 nucleotides in length, which is within the range recited in claim 1 (Fig. 1F; Supplemental Information, Fig. S4; Table S2, column F). Kweon also teaches heterologous object sequences (“RT template”) having a length within the range recited in instant claim 1, e.g., 9, 12, 14, and 16 (Fig. 1F; Supplemental Information, Fig. S4; Table S2, column H; pg. 2003).
Kweon does not teach I) a gRNA spacer that is complementary to a first portion of the human SERPINA1 gene, wherein the gRNA spacer comprises an RNA sequence 100% identical to the nucleic acid sequence according to SEQ ID NO: 20623, or II) a heterologous object sequence comprising a mutation region to correct a E342K mutation in a second portion of the human SERPINA1 gene, or a primer binding site (PBS) sequence with at least 3 bases 100% identical to a third portion of the human SERPINA1 gene.
However, Conway teaches “nuclease-driven” gene modifying systems to correct the E342K mutation in SERPINA1, and thereby resolve Alpha-1-antitrypsin (A1AT) deficiency (col. 14, lines 3-6). Conway teaches that the E342K mutation (“Glu342Lys substitution”) is the most common mutation in SERPINA1 that causes A1AT deficiency (col. 13, lines 16 to col. 14, line 6). Conway teaches that the E342K mutation is induced by a point mutation in the codon “GAG” (Glu) causing “AAG” (Lys) (Fig. 1A, bottom strand). Conway teaches that CRISPR/Cas9 systems, including those employing “functional derivatives” of naturally occurring Cas proteins, are appropriate for correcting the E342K mutation (col. 33, line 62 to col. 37, line 44; col. 40, Example 1). Conway teaches the exact sequences surrounding the E342K mutation in SERPINA1 (Fig. 1A-B; col. 9, lines 9-19). In Figs. 1A-B, Conway shows sequences to which SERPINA1-specific ZFNs bind in order to correct the E342K mutation (col. 9, lines 9-19). Between ZFN nuclease sites “25264” and “25277” is the E342K mutation (Fig. 1A, bottom strand). Conway teaches gRNA spacer sequences can be designed to target the region between known ZFN sites, which “advantageously relies upon proven nuclease targets” (col. 35, lines 30-43).
Anzalone teaches parameters for designing template RNAs (“pegRNA”) to induce a SpyCas9-mediated nick at a target sequence (Fig. 1B, Extended Data Fig. 3A). Anzalone teaches that SpyCas9 prime editors induce a nick at the +1-edit position of the PAM-containing strand (Fig. 1B). Anzalone teaches that this nick allows hybridization of the PBS of the template RNA to the PAM-containing strand, and subsequently, the direct polymerization of a desired DNA sequence contained within the heterologous object sequence (“RT template”) of the template RNA.
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have applied the template RNA design principles taught by Anzalone to the SERPINA1 sequences taught by Conway, to create a SERPINA1-specific template RNA in the gene modifying system taught by Kweon having a gRNA spacer of SEQ ID NO: 20623. It would have amounted to applying a known technique to known SERPINA1 sequences and a known gene modifying system, to yield predictable results.
Conway teaches the exact sequence surrounding the SERPINA1 E342K mutation, and that the E342K mutation is induced by a point mutation in the codon “GAG” (Glu) causing “AAG” (Lys) (Fig. 1A, bottom strand). A skilled artisan applying the principles of Anzalone (Fig. 1B, Extended Data Fig. 3A) to create a SERPINA1-specific template RNA for the gene modifying system taught by Kweon, would create a template RNA comprising a 20-nucleotide gRNA spacer complementary to a non-PAM containing strand (i.e., Conway Fig. 1A, top strand), which hybridized such that the +1-editing position in the PAM-containing strand was immediately prior to (i.e., left of) the point mutation (i.e., between the codons “GAC” (Asp) and “AAG” (Lys) in Conway Fig. 1A, bottom strand)(see Fig. A below). Accordingly, the 20-nucleotide gRNA sequence complementary to the non-PAM containing strand would be CTGTGCTGACCATCGACAAG, which is 100% identical to instant SEQ ID NO: 20623 (see Fig. B below, wherein the gRNA spacer derived from Anzalone’s design principles is italicized).
Because I) Kweon teaches a gene modifying system that allows for prime editing of a desired target gene in a PAM-independent manner, II) the exact sequences encompassing the E342K mutation in SERPINA1 were known as evidenced by Conway, and III) design parameters for template RNAs (“pegRNAs”) were known as evidenced by Anzalone, a skilled artisan would have had a reasonable expectation of success in designing a template RNA having the gRNA spacer of SEQ ID NO: 20623 that would allow editing of the E342K mutation in SERPINA1. A skilled artisan would have been motivated to create a SERPINA1-specific template RNA for the gene modifying system of Kweon because I) Conway teaches that the E342K mutation in SERPINA1 causes A1AT deficiency, which may be corrected by Cas9 proteins or their functional variants, and II) Kweon teaches a system employing a functional variant of Cas9 (SpyCas9-SpRY nickase) that allows for PAMless prime editing of a desired target gene.
PNG
media_image1.png
583
633
media_image1.png
Greyscale
Regarding claim 6, Kweon teaches the heterologous object sequence (“RT template”) comprises from 5’ to 3’ a post-edit homology region, a mutation region (“w/mutations”) and a pre-edit homology region (Table S2, column G).
Regarding claims 11-12, Kweon teaches the gRNA scaffold has a sequence 100% identical to instant SEQ ID NO: 20427 (see alignment of record)(“the reverse complementary sequence of the gRNA scaffold is as follows 5’-gcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaac-3’”, Supplemental Information, Note S1).
Regarding claim 18, Kweon teaches that DNA (“plasmids”) encoding the gene modifying polypeptide and template RNA was transformed into cells (pg. 2005, Mammalian cell culture and transfection) and that transformation resulted in prime editing (Fig. 1). Kweon is silent as to whether the nucleic acid encoding the gene modifying polypeptide comprises RNA. However, because the only practicable way to achieve prime editing following transfection with plasmid DNA, is for the DNA encoding the template RNA and gene modifying polypeptide to first be synthesized into RNA within the transfected cells, Kweon teaches the nucleic acid encoding the gene modifying polypeptide comprises RNA.
Regarding claims 19-21, Kweon teaches that the gene modifying polypeptide PE2-SpRY was constructed by cloning the coding sequence of SpyCas9 (“spCas9”) variant SpRY isolated from pCMV-T7-SpRY-P2A-EGFP (Addgene plasmid #139989) into pCMV-PE2 (Addgene plasmid #13775) (pg. 2001, right col.; pg. 2005, Mammalian cell culture and transfection). Kweon introduced an additional H840A mutation to SpyCas9-SpRY to render it a nickase (pg. 2001). Kweon teaches that SpyCas9-SpRY is fused to a M-MLV reverse transcriptase (RT) (pg. 2001, left col.). Kweon is silent as to a linker disposed between the M-MLV RT domain and the SpyCas9-SpRY domain. However, Anzalone teaches that the pCMV-PE2 plasmid contains a “flexible linker” between the Cas9 H840A nickase domain and the M-MLV RT domain (Supplementary Information, pg. 24-25). Thus, because Kweon teaches cloning the coding sequences of SpyCas9-SpRY into pCMV-PE2, Kweon as evidenced by Anzalone teaches a linker disposed between the M-MLV RT domain and the SpyCas9-SpRY domain.
Regarding claim 31, while the claim further limits the simian foamy virus (SFV) option recited in claim 21 to a specific simian foamy virus (i.e., SFV3L), the RT domain may still be any of the other options, e.g., the M-MLV RT domain indicated above.
Regarding claims 22-23, because the claim bodies recite a structurally complete invention, the preamble term “pharmaceutical” recites an intended use for the composition which does not structurally limit the claim. See MPEP 2111.02(II). Kweon teaches a composition comprising the gene modifying system and a plasmid vector (“transfection was conducted using 400 ng of plasmids and 0.6 µL of Lipofectamine 2000”, pg. 2005, Mammalian cell culture and transfection). Because a plasmid vector is a pharmaceutically acceptable excipient or carrier, Kweon teaches the limitations of claims 22-23.
Regarding claim 24, and as stated above in paragraph 21, Kweon teaches a method of making the template RNA by introducing DNA encoding the template RNA into a host cell under conditions that allow for the production of the template RNA (pg. 2005, Mammalian cell culture and transfection; Fig. 1).
Regarding claim 5, as stated above, Kweon teaches heterologous object sequences (“RT template”) having a length within the range recited in instant claim 1, e.g., 9, 12, 14, and 16 (Fig. 1F; Supplemental Information, Fig. S4; Table S2, column H; pg. 2003). It is noted that Kweon’s heterologous object sequence lengths, therefore, “ha[ve] a length of 6 nucleotides,” however, in the interest of compact prosecution, claim 5 is also addressed hereinafter as being directed to a heterologous object sequence which is 6 nucleotides in length.
Kweon teaches that PE2-SpRY did not demonstrate a preference for heterologous object sequences of 10, 14, or 16 nucleotides in length (pg. 2003; Fig. S4). Kweon emphasizes that heterologous object sequence length must be optimized to maximize the editing activity of PE2-SpRY (pg. 2003, right col.).
Anzalone also teaches that the length of the heterologous object sequence (“RT template length”) must be optimized to maximize prime editing efficiency (pg. 153, left col.). Anzalone systematically examined the impact of heterologous object sequences 7-20 nucleotides in length on editing efficiency (Fig. 2B). Anzalone teaches that some target sites prefer longer RT templates (e.g., FANCF preferred templates more than 15 nucleotides), whereas other target sites prefer shorter RT templates (e.g., HEK4 preferred templates between 7-10 nucleotides in length)(Fig. 2B; pg. 153, left col.). Because length preferences differed between targets, Anzalone suggests starting with heterologous object sequences 10-16 nucleotides and testing shorter and longer RT templates during template RNA optimization for a particular target (pg. 153, left col.).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have optimized the PBS sequence length in the SERPINA1-specific template RNA using the optimization method taught by Anzalone, to arrive at a heterologous object sequence which is 6 nucleotides in length. It would have amounted to applying a known optimization method to a “base” heterologous object sequence, to yield predictable and improved results. The obviousness of applying the template RNA design principles taught by Anzalone to the sequences taught by Conway, to create a SERPINA1-specific template RNA in the gene modifying system taught by Kweon is recited above in paragraph 18 and applied here. Because I) Kweon and Anzalone teach “base” heterologous object sequences, II) optimization of heterologous object sequence length was routine in the art as evidenced by Kweon and Anzalone, and because III) Anzalone teaches optimization methods that include templates “shorter or longer” than 10-16 nucleotides, a skilled artisan would have reasonably predicted that applying Anzalone’s method of testing sequences would result in an optimal heterologous object sequence length for editing at the SERPINA1 target site. A skilled artisan would have been motivated to optimize the heterologous object sequence length because Kweon and Anzalone both teach that such optimization is necessary to improve editing activity.
Regarding claim 7, Kweon does not teach that the heterologous object sequence has an RNA sequence of TTTCTC. However, as stated above in paragraph 18 and for the reasons recited therein, a skilled artisan applying the principles of Anzalone (Fig. 1B, Extended Data Fig. 3A) to create a SERPINA1-specific template RNA for the gene modifying system taught by Kweon, would create a template RNA comprising the gRNA spacer of SEQ ID NO: 20623. Accordingly, the +1-editing position would be between codons “GAC” (Asp) and “AAG” (Lys) in Conway Fig. 1A, bottom strand)(see Fig. A above).
Regarding claim 7, applying the template RNA design principles of Anzalone to the sequences of Conway, a skilled artisan would have included the RNA sequence TTTCTC in the heterologous object sequence, such that following reverse transcription, the point mutated codon “AAG” (Lys) immediately following the nick induced by SpyCas9-SpRY would be corrected to “GAG” (Glu). Kweon teaches heterologous object sequences (“RT templates”) 9-17 nucleotides in length (Fig. 1F; Supplemental Information, Fig. S4; Table S2, column H), and thus, each of the heterologous object sequences prepared using the design principles of Anzalone would encode the subsequent codon “AAA” in the heterologous object sequence with the RNA sequence “TTT”.
The obviousness of applying the template RNA design principles taught by Anzalone to the SERPINA1 sequences taught by Conway, to create a SERPINA1-specific template RNA in the gene modifying system taught by Kweon is recited above in paragraph 18 and applied here with regard to claim 7.
Regarding claim 9, as stated above, Kweon teaches PBS sequences 9 and 11 nucleotides in length. Therefore, Kweon teaches a PBS which “has a length of 10 nucleotides,” however, in the interest of compact prosecution, claim 9 is also addressed hereinafter as being directed to a PBS which is 10 nucleotides in length.
Kweon also teaches that PBS sequence length influences prime editing efficiency (pg. 2003, Fig. 1F), and suggests that optimization of PBS length is essential to maximize the editing activity of PE2-SpRY (pg. 2003, right col.). Anzalone also teaches that PBS sequence length influences prime editing efficiency (pg. 152, right col.). Anzalone systematically examined the impact of PBS sequence lengths between 7-17 nucleotides in length for various target sites (Fig. 2A). Anzalone teaches that no PBS sequence length was strictly predictive of editing efficiency across the various target sites (pg. 152, right col.). Accordingly, Anzalone suggests starting with a PBS length of about 13 nucleotides and testing different PBS lengths during template RNA optimization for a particular target (pg. 153, left col.).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have optimized the PBS sequence length in the SERPINA1-specific template RNA using the optimization method taught by Anzalone, to arrive at a PBS sequence 10 nucleotides in length. It would have amounted to applying a known optimization method to a “base” PBS sequence, to yield predictable, improved results. The obviousness of applying the template RNA design principles taught by Anzalone to the sequences taught by Conway, to create a SERPINA1-specific template RNA in the gene modifying system taught by Kweon is recited above in paragraph 18 and applied here. Because I) Kweon and Anzalone teach “base” PBS sequences, II) optimization of PBS sequence length was routine in the art as evidenced by Kweon and Anzalone, and because III) Anzalone teaches optimization methods that encompass PBS sequences 10 nucleotides long, a skilled artisan would have reasonably predicted that applying Anzalone’s method would result in an optimal PBS sequence length for editing at the SERPINA1 target site. A skilled artisan would have been motivated to optimize the PBS sequence length because Kweon and Anzalone both teach that such optimization is necessary to improve editing activity.
Regarding claim 10, as stated above, Kweon teaches PBS sequences 9 and 11 nucleotides in length. Applying the template RNA design principles of Anzalone to the sequences of Conway, a skilled artisan would have included a PBS sequence 9 or 11 nucleotides in length that was complementary to the nucleotides immediately before the nick on the PAM-containing strand. As shown in Fig. C below, the 11 nucleotide PBS sequence would have the RNA sequence of instant SEQ ID NO: 21433 (i.e., “GTCGATGGTC” bolded in Fig. C below).
PNG
media_image2.png
287
505
media_image2.png
Greyscale
The obviousness of applying the template RNA design principles taught by Anzalone to the SERPINA1 sequences taught by Conway, to create a SERPINA1-specific template RNA in the gene modifying system taught by Kweon is recited above in paragraph 18 and applied here with regard to claim 10.
Regarding claims 13-14, Kweon teaches the scaffold of SEQ ID NO: 20427, PBS sequences 9 and 11 nucleotides, and heterologous object sequences between 9-17 nucleotides. Thus, in view of the sequences of Conway and design principles of Anzalone, Kweon teaches a template RNA 87.5% identical to instant SEQ ID NO: 24956 (see alignment of record and Fig. D below). Kweon does not teach that the template RNA is at least 90% identical to SEQ ID NO: 24956, or is the RNA sequence of SEQ ID NO: 24956.
However, as stated above in paragraphs 25 and 27, applying the optimization method of Anzalone to the “base” PBS sequence and heterologous object sequence lengths taught by Kweon and Anzalone would have been obvious to one skilled in the art before the effective filing date of the claimed invention. Anzalone and Kweon teach that PBS and heterologous object sequence length impact editing efficiency (Anzalone, Fig. 2A-B; Kweon, Fig. 1F, S4), and thus, they strongly suggest that testing combinations of PBS and heterologous object sequence length is a necessary and routine step in template RNA optimization. Indeed, both Anzalone and Kweon teach combining different PBS and heterologous object sequence lengths as part of the template RNA optimization process (Anzalone, Fig. 2A-B; Kweon, Fig. 1F, S4). A template RNA with a 6-nucleotide object sequence and a 10-nucleotide PBS sequence is 100% identical to instant SEQ ID NO: 24956 (see alignment of record and Fig. E below).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have optimized the PBS sequence length and heterologous object sequence length in the SERPINA1-specific template RNA using the optimization method taught by Anzalone, to arrive at the template RNA of SEQ ID NO: 24956. It would have amounted to applying a known optimization method to a “base” template RNA sequence, to yield predictable, improved results. The obviousness of applying the template RNA design principles taught by Anzalone to the sequences taught by Conway, to create a SERPINA1-specific template RNA 87.5% identical to SEQ ID NO: 24956 is recited above and applied here. Because I) Kweon and Anzalone teach “base” template RNA sequences, and II) optimization of the PBS and heterologous sequence length therein was routine in the art as evidenced by Kweon and Anzalone, a skilled artisan would have reasonably predicted that applying Anzalone’s method would result in an optimal template RNA for editing at the SERPINA1 target site. A skilled artisan would have been motivated to optimize both sequence lengths in the template RNA because Kweon and Anzalone teach that such optimization is necessary to improve editing activity for a specific target site.
PNG
media_image3.png
603
868
media_image3.png
Greyscale
Claim Rejections – 35 USC § 103 – Kweon, Conway, and Anzalone in further view of IDT
Claims 15-16 are rejected under 35 U.S.C. 103 as being unpatentable over Kweon (Kweon et al., 23 February 2021, Molecular Therapy, 29(6), p. 2001-2007 and Supplemental Information and Table S2, of record), Conway (Conway et al., Patent No. US 10,960,085 B2, published 30 March 2021, of record), and Anzalone (Anzalone et al., 21 October 2019, Nature, 576, p. 149-157, and Methods, Extended Data, and Supplementary Information, of record) as applied to claims 1-3, 5-7, 9-14, 17-24, and 31 above, and in further view of IDT (Integrated DNA Technologies, “Should pegRNAs for CRISPR prime editing include chemical modifications?”, published 24 November 2020, retrieved 25 April 2024 from The Wayback Machine, of record). The rejections that follow are maintained from the prior action.
The teachings of Kweon, Conway, and Anzalone are recited above and applied as to claims 1-3, 5-7, 9-14, 17-24, and 31 therein. Briefly, Kweon, Conway, and Anzalone render obvious the template RNA according to SEQ ID NO: 24956 for the reasons above in paragraph 29. It is noted that SEQ ID NO: 24956 is 100% identical to the sequence of SEQ ID NO: 24146 (see alignment of record). Thus, Kweon, Conway, and Anzalone also render obvious a template RNA having the nucleobase sequence of SEQ ID NO: 24146 for the reasons above in paragraph 29.
Kweon, Conway, and Anzalone do not teach that the template RNA comprises one or more chemically modified nucleotides (claim 15), or the chemical modifications set out in SEQ ID NO: 24146 (claim 16).
However, IDT teaches that including three 2’-OMe bases and three phosphorothioate linkages on each end of a template RNA (“pegRNA”) results in higher levels of CRISPR prime editing. The chemical modifications set forth in IDT are identical to the chemical modifications set forth in SEQ ID NO: 24146 wherein the first and last three nucleotides are 2’-OMe, and the first and last three linkages are phosphorothioate.
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have improved the template RNA of SEQ ID NO: 24146, with the chemical modifications taught by IDT. It would have amounted to applying known chemical modifications to improve a known template RNA sequences to yield predictable results. The obviousness of improving the elements of the template RNA with the optimization method of Anzalone to arrive at the template RNA of SEQ ID NO: 24146 is described in paragraph 29 and applied here. A skilled artisan would have had a reasonable expectation that applying the specific chemical modifications taught by IDT would improve the “base” template RNA of SEQ ID NO: 24146 because IDT teaches that the modifications result in higher levels of CRISPR editing. Because IDT teaches the specific chemical modifications improve prime editing efficiency, a skilled artisan would have been motivated to apply the modifications to the “base” template RNA of SEQ ID NO: 24146.
Response to Remarks - 35 USC § 103
Applicant’s remarks regarding the § 103 rejections raised in the prior action have been thoroughly considered, but are not found persuasive to overcome the rejection for the reasons that follow. First, Examiner acknowledges the amendments to the claims indicated in the section titled “Claimed subject matter,” and Applicant’s assertions that the subject matter is non-obvious.
In the section titled “No motivation to modify and arrive at the presently claimed spacer sequence,” Applicant alleges that the skilled artisan would not have been motivated to replace the ZFN system of Conway “e.g., with one described by Kweon or Anazlone,” because Conway does not teach aspects of the instantly claimed invention (e.g., “specific gRNA sequence that can be used in a CRISPR/Cas system… a gRNA sequence that targets SERPINA1… any specific Cas “function derivative,” much less one that further comprises a reverse transcriptase domain which is used in the system of Kweon and Anzalone”), and because Conway “already demonstrated successful gene editing of the SERPINA1 gene using zinc finger nucleases (ZFN).” Applicant further details alleged deficiencies of Conway, e.g., Conway allegedly recites several sequences surrounding the E342K mutation in SERPINA1, and provides multiple possible guide lengths for a guide sequence. Applicant, in summary, alleges that Conway is generic with respect to the instantly claimed spacer sequence, and does not provide guidance sufficient to lead the skilled artisan to arrive at the instantly claimed spacer sequence without “extensive experimentation.” Applicant’s remarks also allege that Conway’s Figure 1A “does not include the presently claimed spacer sequence.”
It is noted that Applicant’s remarks in this section rely primarily on alleged deficiencies of Conway, which, when considered alone, cannot be used to overcome the instant obviousness rejections which are based on a combination of references. For example, the rejections in the prior action and above do not rely on Conway alone to arrive at the claimed spacer sequence, and thus, Applicant’s remarks regarding the alleged deficiencies of Conway’s teachings alone with respect to the claimed spacer sequence are insufficient. Furthermore, while Applicant’s remarks allege that Conway’s Fig. 1A “does not include the presently claimed spacer sequence,” it is not clear how Applicant arrives at this conclusion because as shown in each of the prior actions, the sequence comprising Conway’s proven ZFN target sites does clearly contain the presently claimed spacer sequence of SEQ ID NO: 20623 “AAGCTGTGCT GACCATCGACG/AAGAAAGGGACTGAAGCTGCTGGGGCC” wherein the ZFN half-sites are underlined, the mutated G/A is bolded, and SEQ ID NO: 20623 is italicized (see also Fig. A-B above; Conway Fig. 1A). Applicant’s remarks directed to the alleged lack of motivation or guidance to arrive at the presently claimed spacer sequence based on the cited prior have been previously addressed, and remain unpersuasive for the reasons described in the prior action(s).
In the section titled “Designing the claimed template RNA as a whole, including lengths of the PBS and heterologous object sequence was not routine,” Applicant argues that “Claim 1, as currently amended, specifies, inter alia, that the heterologous object sequence has a length of between 6-15 nucleotides and the PBS has a sequence of between 8-12 nucleotides” which are “values based on Applicant’s data… that would give high activity in combination with the spacer SEQ ID NO: 20,623.” Applicant alleges that the cited prior art would “discourage” the skilled artisan from modifying the gene editing systems described in the references, and fail to “give any hint of what lengths of PBS and heterologous object sequence would be suitable when paired with the novel and non-obvious template RNA spacer of claim 1.”
Applicant appears to be relying, at least in part, on unclaimed elements to support the nonobviousness of the instant claims, and this is not found persuasive. The instant claims do not require a specific PBS or heterologous object sequence length, i.e., the heterologous object sequence “has” a length of between 6-15 nucleotides, or “has” a length of 6 nucleotides, and likewise, the PBS “has” a sequence of between 8-12 nucleotides, or “has” a length of 10 nucleotides. The claims, while setting a minimum length which the elements must have, are not limited to a length within the recited range. Examples of heterologous object sequence and PBS having the recited numbers of nucleotides are either explicitly taught by or rendered obvious over the prior art as described above. There is insufficient evidence that the skilled artisan would have been discouraged from using a known or obvious prior art number of nucleotides for a known element in a template RNA, or that the skilled artisan would have had to do any more than select or routinely optimize a known prior art number of nucleotides for the known elements when designing the template RNA.
Applicant alleges that the teachings of Kweon and Anazlone are “contradictory” with respect to the PBS lengths. Applicant also refers to an alleged lack of guidance in the references to optimize the PBS and heterologous object sequence lengths, and an alleged “general unpredictability” provided by Anzalone and Kweon.
These remarks related to quotes and their alleged meanings in Anzalone and Kweon have been previously addressed, and remain unpersuasive for the reasons described in the prior action(s).
Applicant also alleges that the number of possible PBS and heterologous object sequence combinations is large, and would need to be tested extensively to arrive at the claimed subject matter. Applicant also appears to allege that the instantly claimed obviousness rejection amounts to an improper “obvious to try” rationale because of the alleged lack of guidance to arrive at a template RNA comprising the recited spacer sequence, paired with a PBS and heterologous object sequence having allegedly “advantageous lengths,” an argument which is addressed below, and not in the response immediately following.
The remarks related to the number of combinations and an alleged improper “obvious to try” rationale have been previously addressed, and remain unpersuasive for the reasons described in the prior action(s).
Finally, Applicant submits, in the section titled “Surprising Results,” that even if a prima facie case of obviousness had been established, it would be rebutted by surprising results resulting from the spacer corresponding to SEQ ID NO: 20623.
Applicant’s remarks with respect to the evidence which supports the alleged surprising results has been considered. Fig. 15 does not appear to provide any specific information regarding the instantly claimed template RNA, and as shown in Fig. 18, the % indels resulting from different template RNA spacers appears quite similar. Based on Fig. 16, the instantly claimed spacer sequence may have higher “average” re-writing activity compared to the other spacers in the screen, but every other spacer in Fig. 16 produces re-writing efficacies within the range encompassed by the instantly claimed spacer sequence. Fig. 18 cannot be considered alone, because the instantly claimed spacer sequence is combined with specific, optimal, PBS and heterologous object sequences lengths which are not sufficiently representative of the template RNAs encompassed by the instant claims.
Indeed, and regarding the alleged “advantageous lengths” mentioned above, Fig. 17A provides a more representative view of the re-writing activity encompassed by the claimed scope of template RNAs, although it is noted that the results in Fig. 17A are still more limited than the instant claims, because the template RNAs therein are limited to specific sequences and sequence lengths of PBS and heterologous object sequence. The instant claims do not require a specific PBS or heterologous object sequence, and only limit the minimum sequence length of each element (i.e., the heterologous object sequence “has” a length of between 6-15 nucleotides, or “has” a length of 6 nucleotides, and the PBS “has” a sequence of between 8-12 nucleotides, or “has” a length of 10 nucleotides). As shown in Fig. 17A, the rewriting efficiencies of representative template RNAs encompassed by the claim, are between less than 0.1 and 10.3%. Based on the analysis of the closest prior art described in the prior action and below, these efficiencies would have been expected.
Applicant’s remarks related to the alleged deficiencies of Kweon, Anzalone, and Conway with respect to establishing whether the rewriting efficiencies are unexpected have been previously addressed, and remain unpersuasive for the reasons described in the prior action(s).
Regarding Liu, Applicant states that Liu uses “different template RNA elements and a different Cas protein than the systems described in the specification or Kweon, and fails to teach or suggest the presently claimed gRNA spacer.” Examiner has acknowledged the differences between Liu and the present claims in the prior action. Liu was cited for showing editing efficiencies at the E342K site in SERPINA1 which are less than, equal to, and greater than 10.3% (Fig. 3), which is the highest rewriting efficacy cited in Fig. 17A. Coupled with Kweon, which also shows editing efficiencies less than, equal to, and greater than 10.3.% (see columns in Kweon, Table S1 corresponding to “PE2-spRY”), the skilled artisan would have reasonably expected rewriting efficiencies between less than 0.1 and 10.3%, which are presently encompassed by the claims based on Fig. 17A.
Finally, Applicant’s remarks regarding the teachings of IDT are not found persuasive, because IDT was not relied upon to remedy the alleged deficiencies of Kweon, Conway, and Anzalone, which have been addressed above.
Nonstatutory Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
U.S. Patents
Claims 1-3, 5-7, 9-24, and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following U.S. Patents in view of Kweon (Kweon et al., 23 February 2021, Molecular Therapy, 29(6), p. 2001-2007 and Supplemental Information and Table S2, of record), Conway (Conway et al., Patent No. US 10,960,085 B2, published 30 March 2021, of record), Anzalone (Anzalone et al., 21 October 2019, Nature, 576, p. 149-157, and Methods, Extended Data, and Supplementary Information, of record), and IDT (Integrated DNA Technologies, “Should pegRNAs for CRISPR prime editing include chemical modifications?”, published 24 November 2020, retrieved 25 April 2024 from The Wayback Machine, of record). The rejections that follow are maintained from the prior action, or new as necessitated by patenting of Application No. 18/495,276. Note: the numbering from the prior actions is preserved throughout this section.
Claims 24-26 of Patent No. 12,024,728 B2 drawn to a system with a generic template RNA and gene modifying polypeptide having a Cas9 nickase domain and a SFV RT domain (SEQ ID NO: 8,113) connected by a linker.
Claims 24-26 of Patent No. 12,031,162 B2 drawn to a system with a generic template RNA and gene modifying polypeptide having a Cas9 nickase domain and a AVIRE RT domain (SEQ ID NO: 8,003) connected by a linker.
Claims 24-26 of Patent No. 12,037,617 B2 drawn to a system with a generic template RNA and gene modifying polypeptide having a Cas9 nickase domain and a FLV RT domain (SEQ ID NO: 8,020) connected by a linker.
Claims 24-26 of Patent No. 12,123,034 B2 drawn to a system with a generic template RNA and gene modifying polypeptide having a Cas9 nickase domain and a MLV RT domain (SEQ ID NO: 8,074) connected by a linker.
Claims 5-13 of Patent No. 12,270,029 B2 drawn to systems comprising a template RNA targeting a mutation in the human CFTR gene having a gRNA scaffold identical to instant SEQ ID NO: 20,427, and a gene modifying polypeptide having a SpyCas9 domain and a RT domain connected by a linker.
Claims 15-19, and 21-22 of Patent No. 12,544,458 B2 (identified as Application No. 18/495,276 in the prior action) drawn to a system with a template RNA targeting a mutation in the human PAH gene having a gRNA scaffold identical to instant SEQ ID NO: 20,427, and a gene modifying polypeptide having a SpyCas9 domain and a RT domain connected by a linker.
The claims of Patents I-IV are directed to generic template RNAs having the features of the instantly claimed template RNA, and gene modifying systems comprising the generic template RNA and a gene modifying polypeptide having a generic endonuclease domain, or a Cas9 nickase domain fused to a RT domain. The patented claims do not recite the gRNA spacer sequence, PBS sequence, or heterologous object sequence features of the instant claims, or the SpyCas9-SpRY domain of the instant claims.
The teachings of Kweon, Conway, Anzalone, and IDT are recited above in paragraphs 14-34.
Regarding Patents I-IV, it would have been obvious before the effective filing date of the claimed invention to have substituted the generic template RNA and Cas9 nickase domain of the patented claims, with the SERPINA1-specific template RNA and SpyCas9-SpRY domain taught by Kweon, Conway, Anzalone, and IDT. It would have amounted to a simple substitution of known elements by known means to yield predictable results. Regarding the template RNA, a skilled artisan would have a reasonable expectation of success in substituting the elements because I) Anzalone teaches template RNA design principles which can be applied to the SERPINA1 sequences taught by Conway, and II) Kweon and Anzalone teach target-specific template RNAs that edit a desired target when combined with a gene modifying polypeptide having a RT domain and a Cas9 nickase domain. Regarding the Cas9 nickase domain, a skilled artisan would have a reasonable expectation of success in substituting the elements because Kweon teaches the SpyCas9-SpRY nickase can edit target sites in a PAMless manner. A skilled artisan would have been motivated to substitute the template RNA and endonuclease domain of the patented claims because Conway teaches that the E342K mutation in SERPINA1 causes A1AT deficiency, which may be corrected by Cas9 proteins or their functional variants, e.g., the SpyCas9-SpRY nickase taught by Kweon.
The claims of Patents VIII and IX are directed to gene modifying systems comprising template RNAs having the core features of the instantly claimed template RNA but targeting a different gene, and a gene modifying polypeptide having a SpyCas9 nickase domain fused to a RT domain. The patented claims do not recite the gRNA spacer sequence, PBS sequence, or heterologous object sequence features of the instant claims, or the SpyCas9-SpRY domain of the instant claims.
Regarding Patents VIII and IX, the obviousness of substituting the template RNAs, and SpyCas9 nickase of the patented claims with the SERPINA1-specific template RNA and SpyCas9-SpRY domain taught by Kweon, Conway, Anzalone, and IDT is recited directly above and applied here.
Co-pending Applications
Claims 1-3, 5-7, 9-24, and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following Co-pending Applications in view of Kweon (Kweon et al., 23 February 2021, Molecular Therapy, 29(6), p. 2001-2007 and Supplemental Information and Table S2, of record), Conway (Conway et al., Patent No. US 10,960,085 B2, published 30 March 2021, of record), Anzalone (Anzalone et al., 21 October 2019, Nature, 576, p. 149-157, and Methods, Extended Data, and Supplementary Information, of record), and IDT (Integrated DNA Technologies, “Should pegRNAs for CRISPR prime editing include chemical modifications?”, published 24 November 2020, retrieved 25 April 2024 from The Wayback Machine, of record). These are provisional double patenting rejections because the patentably indistinct claims have not in fact been patented. The rejections below are maintained from the prior Action. Note: the numbering from the prior action is preserved throughout this section.
Claims 25-26, 30-31 of Application No. 18/595,904 drawn to a system with a generic template RNA and gene modifying polypeptide having a Cas9 nickase domain and a RT domain of SEQ ID NO: 8,101, 8,103, or 8,104 connected by a linker.
Claims 110-132 of Application No. 17/929,116 drawn to a system for modifying DNA comprising a gene modifying polypeptide having a DBD domain, an endonuclease domain, and a RT domain, and a generic template RNA.
Claims 1-26 of Application No. 18/590,275 drawn to a system with a template RNA targeting a mutation in the human HBB gene having a gRNA scaffold identical to instant SEQ ID NO: 20,427, and a gene modifying polypeptide having a SpyCas9 domain and a RT domain connected by a linker.
The claims of co-pending Applications V and VI are directed to generic template RNAs having the features of the instantly claimed template RNA, and gene modifying systems comprising the generic template RNA and a gene modifying polypeptide having a generic endonuclease domain, or a Cas9 nickase domain fused to a RT domain. The co-pending claims do not recite the gRNA spacer sequence, PBS sequence, or heterologous object sequence features of the instant claims, or the SpyCas9-SpRY domain of the instant claims.
The teachings of Kweon, Conway, Anzalone, and IDT are recited above in paragraphs 14-34.
Regarding co-pending Application V and VI, it would have been obvious before the effective filing date of the claimed invention to have substituted the generic template RNA and Cas9 nickase domain of the co-pending claims, with the SERPINA1-specific template RNA and SpyCas9-SpRY domain taught by Kweon, Conway, Anzalone, and IDT. It would have amounted to a simple substitution of known elements by known means to yield predictable results. Regarding the template RNA, a skilled artisan would have a reasonable expectation of success in substituting the elements because I) Anzalone teaches template RNA design principles which can be applied to the SERPINA1 sequences taught by Conway, and II) Kweon and Anzalone teach target-specific template RNAs that edit a desired target when combined with a gene modifying polypeptide having a RT domain and a Cas9 nickase domain. Regarding the Cas9 nickase domain, a skilled artisan would have a reasonable expectation of success in substituting the elements because Kweon teaches the SpyCas9-SpRY nickase can edit target sites in a PAMless manner. A skilled artisan would have been motivated to substitute the template RNA and endonuclease domain of the co-pending claims because Conway teaches that the E342K mutation in SERPINA1 causes A1AT deficiency, which may be corrected by Cas9 proteins or their functional variants, e.g., the SpyCas9-SpRY nickase taught by Kweon.
The claims of co-pending Application X are directed to specific template RNAs having the core features of the instantly claimed template RNA, but targeting different genes, as well as gene modifying systems comprising the template RNAs and a gene modifying polypeptide having a SpyCas9 nickase domain fused to a RT domain. The co-pending claims do not recite the gRNA spacer sequence, PBS sequence, or heterologous object sequence features of the instant claims, or the SpyCas9-SpRY domain of the instant claims.
Regarding co-pending Application X, the obviousness of substituting the specific template RNAs, and SpyCas9 nickase of the co-pending claims with the SERPINA1-specific template RNA and SpyCas9-SpRY domain taught by Kweon, Conway, Anzalone, and IDT is recited above and applied here.
Response to Remarks – Nonstatutory Double Patenting
Examiner acknowledges Applicant’s request that the nonstatutory double patenting rejections be held in abeyance until the outstanding rejections are overcome. Applicant’s remarks do not address the propriety of the rejections, and no terminal disclaimers have been filed. The instant claims remain patentably indistinct from the claims in the patents and co-pending applications above.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600
