DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s remarks and amendments to the claims filed October 14, 2025 are acknowledged. Claims 1-17 were amended. Claims 1-26, and 31 are pending.
Election/Restriction
Claims 25-26 remain withdrawn pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention. Accordingly, claims 1-24 and 31 are under examination herein.
Withdrawn Rejections
The amendments to the claims are sufficient to overcome the § 112(d) rejection raised in the prior action. This rejection is withdrawn, accordingly.
Applicant’s remarks and amendments to the claims have been thoroughly considered but are not found persuasive to place the claims in condition for allowance for the reasons that follow. Any rejection or objection not reiterated herein has been overcome by amendment.
Claim Objections
Claims 2-17 are objected to because of the following informalities:
Claims 2-17 recite “The template RNA or DNA of claim 1.” Claim 1 recites “A template RNA, or a DNA encoding the same.” It would be preferable to amend claims 2-17 to recite either “The template RNA or the DNA encoding the same of claim 1,” or “The template RNA or the DNA of claim 1,” so that the terminology is consistent with that of claim 1.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-24, and 31 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The rejections that follow are maintained from the prior action with modification, or new, as necessitated by Applicant’s amendments to the claims.
(Maintained and modified) Claim 1 recites “[a] template RNA, or a DNA encoding the same, comprising, from 5’ to 3’: a gRNA spacer… compris[ing] the nucleic acid sequence according to SEQ ID NO: 20,623.” The skilled artisan would interpret the terms “template RNA” and “gRNA spacer” as referring to sequences of contiguous RNA nucleotides. However, the sequence listing provides that SEQ ID NO: 20623 is a “DNA” sequence (see “moltype” in the corresponding sequence listing entry). The structure required of the gRNA spacer and template RNA is unclear because the skilled artisan would not have understood these molecules to comprise a stretch of DNA nucleotides, but this is what the plain language of the claim appears to require. It is not clear whether the claim reads on a template RNA comprising a “gRNA spacer” which is actually a DNA sequence, or whether the claim intends to require that the template RNA comprise an RNA sequence 100% identical to the DNA sequence set forth in SEQ ID NO: 20623. This confusion is not rescued by the claim encompassing “a DNA encoding the same,” because the limitations in (a)-(d) are elements of the “template RNA,” which the skilled artisan, again, would understand to be composed of RNA nucleotides.
Claims 2-24, and 31 are rejected for depending from claim 1 and failing to remedy the indefiniteness.
It is noted that claims 10 and 12 also require that elements of the template RNA, i.e., PBS sequence and gRNA scaffold, respectively, comprise “the nucleic acid sequence according to SEQ ID NO:…,” in which the recited SEQ ID NOs are also “DNA” sequences (see “moltype” for SEQ ID NOs: 21433 and 20427). These claims are also confusing for the reasons outlined above.
Claim 4 recites that “the heterologous object sequence has a length of 6-16 nucleotides.” Claim 1 recites heterologous object sequence length ranges in (i)-(iv). The ranges are set forth in the alternative, i.e., “between 4-12 nucleotides,” “12-15 nucleotides,” “15-21 nucleotides,” or “21-26 nucleotides,” and paired with different PBS sequence length ranges. The range recited in claim 4 is not a narrower range of any of the alternatively recited ranges in claim 1, and overlaps only partially with three of the recited ranges. It is not clear how or if the range recited in claim 4 further limits the previously recited ranges. It is, therefore, also unclear which of the alternative PBS sequence length ranges must be selected to meet the claim scope. The structure of the heterologous object sequence and PBS sequence are unclear, rendering the claim indefinite.
Response to Remarks - 35 USC § 112(b)
Applicant’s remarks regarding the § 112(b) rejections raised in the prior action have been reviewed. Regarding the rejection maintained above, Applicant states that “a person skilled in the art… would easily and clearly understand that SEQ ID NOs: 20,623, 21433, and 20427 provides nucleic acid sequence of a template RNA… and could readily replace the Ts in the sequence with Us based on the teachings in the instant specification.” These arguments are not found persuasive.
Claim 1 recites a template RNA comprising a gRNA spacer comprising “the nucleic acid sequence” set forth in SEQ ID NO: 20623. SEQ ID NO: 20623 is a “DNA” sequence. The phrase “the nucleic acid sequence according to…” requires the nucleic acid sequence, i.e., the DNA sequence set forth in SEQ ID NO: 20623. This is confusing for the reasons described above, and is not remedied by Applicant’s suggestion that the skilled artisan should replace the Ts in SEQ ID NO: 20623 with Us. There are no Us in the nucleic acid sequence of SEQ ID NO: 20623, and replacing Ts with Us would result in a mixed RNA/DNA sequence which comprises deoxyribonucleotides, i.e., the As, Gs, and Cs of SEQ ID NO: 20623. This interpretation would not meet the plain language of the claim, as the gRNA spacer would not actually comprise the nucleic acid sequence according to SEQ ID NO: 20623. This response applies similarly to claims 10 and 12.
Should it be Applicant’s intent to require that the elements of the template RNA comprise the RNA version of the recited SEQ ID NOs, Examiner recommends amending the claims to RNA sequences with, for example, 100% identity to the SEQ ID NOs. For example, claim 1 could be amended to recite: “wherein the gRNA spacer comprises an RNA sequence 100% identical to the nucleic acid sequence according to SEQ ID NO: 20,623….”
Notice to Joint Inventors
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim Rejections – 35 USC § 103 – Kweon in view of Conway and Anzalone
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-14, 17-24, and 31 are rejected under 35 U.S.C. 103 as being unpatentable over Kweon (Kweon et al., 23 February 2021, Molecular Therapy, 29(6), p. 2001-2007 and Supplemental Information and Table S2, of record), in view of Conway (Conway et al., Patent No. US 10,960,085 B2, published 30 March 2021, of record), and Anzalone (Anzalone et al., 21 October 2019, Nature, 576, p. 149-157, and Methods, Extended Data, and Supplementary Information, of record). The rejections that follow are maintained from the prior action with modification necessitated by Applicant’s amendments.
Regarding claims 1-4, 8, and 17, Kweon teaches a gene modifying system comprising a template RNA (“pegRNA”) and a gene modifying polypeptide (“PE2-SpRY”), or a nucleic acid encoding the gene modifying polypeptide (pg. 2001, right col.; pg. 2005, Plasmid DNA and pegRNAs). Kweon teaches the SpyCas9-SpRY domain allows for efficient prime editing of a desired target gene in a PAM-independent manner (pg. 2002-2003; Fig. 1D-E; pg. 2004-2005).
Kweon teaches the template RNA comprises from 5’ to 3’, a 20-nucleotide gRNA spacer that is complementary to a target gene (“a. Oligonucleotides for the spacer sequence (target-specific component)… Nx20 is the target spacer sequence”, Supplemental Information, Note S1), a gRNA scaffold that binds a SpyCas9-SpRY domain (“pegRNA scaffold sequence (common component)”), a heterologous object sequence (“RT template”) and a primer binding site (“PBS”) with at least 3 bases with 100% identity to a target gene (Supplemental Information, Note S1; Table S2, columns E-F, I). Kweon teaches PBS sequences (“PBS”) 9 and 11 nucleotides in length, which are within each of the ranges in claims 1 and 8 (Fig. 1F; Supplemental Information, Fig. S4; Table S2, column F). Kweon also teaches heterologous object sequences (“RT template”) within the ranges in instant claims 1 and 4, e.g., 9, 12, 14, and 16 (Fig. 1F; Supplemental Information, Fig. S4; Table S2, column H; pg. 2003).
Kweon does not teach I) a gRNA spacer that is complementary to a first portion of the human SERPINA1 gene, wherein the gRNA spacer comprises the RNA sequence according to SEQ ID NO: 20623, or II) a heterologous object sequence comprising a mutation region to correct a E342K mutation in a second portion of the human SERPINA1 gene, or a primer binding site (PBS) sequence with at least 3 bases 100% identical to a third portion of the human SERPINA1 gene.
However, Conway teaches “nuclease-driven” gene modifying systems to correct the E342K mutation in SERPINA1, and thereby resolve Alpha-1-antitrypsin (A1AT) deficiency (col. 14, lines 3-6). Conway teaches that the E342K mutation (“Glu342Lys substitution”) is the most common mutation in SERPINA1 that causes A1AT deficiency (col. 13, lines 16 to col. 14, line 6). Conway teaches that the E342K mutation is induced by a point mutation in the codon “GAG” (Glu) causing “AAG” (Lys) (Fig. 1A, bottom strand). Conway teaches that CRISPR/Cas9 systems, including those employing “functional derivatives” of naturally occurring Cas proteins, are appropriate for correcting the E342K mutation (col. 33, line 62 to col. 37, line 44; col. 40, Example 1). Conway teaches the exact sequences surrounding the E342K mutation in SERPINA1 (Fig. 1A-B; col. 9, lines 9-19). In Figs. 1A-B, Conway shows sequences to which SERPINA1-specific ZFNs bind in order to correct the E342K mutation (col. 9, lines 9-19). Between ZFN nuclease sites “25264” and “25277” is the E342K mutation (Fig. 1A, bottom strand). Conway teaches gRNA spacer sequences can be designed to target the region between known ZFN sites, which “advantageously relies upon proven nuclease targets” (col. 35, lines 30-43).
Anzalone teaches parameters for designing template RNAs (“pegRNA”) to induce a SpyCas9-mediated nick at a target sequence (Fig. 1B, Extended Data Fig. 3A). Anzalone teaches that SpyCas9 prime editors induce a nick at the +1-edit position of the PAM-containing strand (Fig. 1B). Anzalone teaches that this nick allows hybridization of the PBS of the template RNA to the PAM-containing strand, and subsequently, the direct polymerization of a desired DNA sequence contained within the heterologous object sequence (“RT template”) of the template RNA.
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have applied the template RNA design principles taught by Anzalone to the SERPINA1 sequences taught by Conway, to create a SERPINA1-specific template RNA in the gene modifying system taught by Kweon having a gRNA spacer of SEQ ID NO: 20623. It would have amounted to applying a known technique to known SERPINA1 sequences and a known gene modifying system, to yield predictable results.
Conway teaches the exact sequence surrounding the SERPINA1 E342K mutation, and that the E342K mutation is induced by a point mutation in the codon “GAG” (Glu) causing “AAG” (Lys) (Fig. 1A, bottom strand). A skilled artisan applying the principles of Anzalone (Fig. 1B, Extended Data Fig. 3A) to create a SERPINA1-specific template RNA for the gene modifying system taught by Kweon, would create a template RNA comprising a 20-nucleotide gRNA spacer complementary to a non-PAM containing strand (i.e., Conway Fig. 1A, top strand), which hybridized such that the +1-editing position in the PAM-containing strand was immediately prior to (i.e., left of) the point mutation (i.e., between the codons “GAC” (Asp) and “AAG” (Lys) in Conway Fig. 1A, bottom strand)(see Fig. A below). Accordingly, the 20-nucleotide gRNA sequence complementary to the non-PAM containing strand would be CTGTGCTGACCATCGACAAG, which is 100% identical to instant SEQ ID NO: 20623 (see Fig. B below, wherein the gRNA spacer derived from Anzalone’s design principles is italicized).
Because I) Kweon teaches a gene modifying system that allows for prime editing of a desired target gene in a PAM-independent manner, II) the exact sequences encompassing the E342K mutation in SERPINA1 were known as evidenced by Conway, and III) design parameters for template RNAs (“pegRNAs”) were known as evidenced by Anzalone, a skilled artisan would have had a reasonable expectation of success in designing a template RNA having the gRNA spacer of SEQ ID NO: 20623 that would allow editing of the E342K mutation in SERPINA1. A skilled artisan would have been motivated to create a SERPINA1-specific template RNA for the gene modifying system of Kweon because I) Conway teaches that the E342K mutation in SERPINA1 causes A1AT deficiency, which may be corrected by Cas9 proteins or their functional variants, and II) Kweon teaches a system employing a functional variant of Cas9 (SpyCas9-SpRY nickase) that allows for PAMless prime editing of a desired target gene.
PNG
media_image1.png
583
633
media_image1.png
Greyscale
Regarding claim 6, Kweon teaches the heterologous object sequences (“RT template”) comprise from 5’ to 3’ a post-edit homology region, a mutation region (“w/mutations”) and a pre-edit homology region (Table S2, column G).
Regarding claims 11-12, Kweon teaches the gRNA scaffold has a sequence 100% identical to instant SEQ ID NO: 20427 (see alignment of record)(“the reverse complementary sequence of the gRNA scaffold is as follows 5’-gcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaac-3’”, Supplemental Information, Note S1).
Regarding claim 18, Kweon teaches that DNA (“plasmids”) encoding the gene modifying polypeptide and template RNA was transformed into cells (pg. 2005, Mammalian cell culture and transfection) and that transformation resulted in prime editing (Fig. 1). Kweon is silent as to whether the nucleic acid encoding the gene modifying polypeptide comprises RNA. However, because the only practicable way to achieve prime editing following transfection with plasmid DNA, is for the DNA encoding the template RNA and gene modifying polypeptide to first be synthesized into RNA within the transfected cells, Kweon teaches the nucleic acid encoding the gene modifying polypeptide comprises RNA.
Regarding claims 19-21, Kweon teaches that the gene modifying polypeptide PE2-SpRY was constructed by cloning the coding sequence of SpyCas9 (“spCas9”) variant SpRY isolated from pCMV-T7-SpRY-P2A-EGFP (Addgene plasmid #139989) into pCMV-PE2 (Addgene plasmid #13775) (pg. 2001, right col.; pg. 2005, Mammalian cell culture and transfection). Kweon introduced an additional H840A mutation to SpyCas9-SpRY to render it a nickase (pg. 2001). Kweon teaches that SpyCas9-SpRY is fused to a M-MLV reverse transcriptase (RT) (pg. 2001, left col.). Kweon is silent as to a linker disposed between the M-MLV RT domain and the SpyCas9-SpRY domain. However, Anzalone teaches that the pCMV-PE2 plasmid contains a “flexible linker” between the Cas9 H840A nickase domain and the M-MLV RT domain (Supplementary Information, pg. 24-25). Thus, because Kweon teaches cloning the coding sequences of SpyCas9-SpRY into pCMV-PE2, Kweon as evidenced by Anzalone teaches a linker disposed between the M-MLV RT domain and the SpyCas9-SpRY domain.
Regarding claim 31, while the claim further limits the simian foamy virus (SFV) option recited in claim 21 to a specific simian foamy virus (i.e., SFV3L), the RT domain may still be any of the other options, e.g., the M-MLV RT domain indicated above.
Regarding claims 22-23, because the claim bodies recite a structurally complete invention, the preamble term “pharmaceutical” recites an intended use for the composition which does not structurally limit the claim. See MPEP 2111.02(II). Kweon teaches a composition comprising the gene modifying system and a plasmid vector (“transfection was conducted using 400 ng of plasmids and 0.6 µL of Lipofectamine 2000”, pg. 2005, Mammalian cell culture and transfection). Because a plasmid vector is a pharmaceutically acceptable excipient or carrier, Kweon teaches the limitations of claims 22-23.
Regarding claim 24, and as stated above in paragraph 19, Kweon teaches a method of making the template RNA by introducing DNA encoding the template RNA into a host cell under conditions that allow for the production of the template RNA (pg. 2005, Mammalian cell culture and transfection; Fig. 1).
Regarding claim 5, as stated above, Kweon teaches heterologous object sequences (“RT template”) within the ranges in instant claims 1 and 4, e.g., 9, 12, 14, and 16 (Fig. 1F; Supplemental Information, Fig. S4; Table S2, column H; pg. 2003). Kweon teaches that PE2-SpRY did not demonstrate a preference for heterologous object sequences of 10, 14, or 16 nucleotides in length (pg. 2003; Fig. S4). Kweon emphasizes that heterologous object sequence length must be optimized to maximize the editing activity of PE2-SpRY (pg. 2003, right col.). Kweon does not teach that the heterologous object sequence has a length of 6 nucleotides (claim 5).
Anzalone also teaches that the length of the heterologous object sequence (“RT template length”) must be optimized to maximize prime editing efficiency (pg. 153, left col.). Anzalone systematically examined the impact of heterologous object sequences 7-20 nucleotides in length on editing efficiency (Fig. 2B). Anzalone teaches that some target sites prefer longer RT templates (e.g., FANCF preferred templates more than 15 nucleotides), whereas other target sites prefer shorter RT templates (e.g., HEK4 preferred templates between 7-10 nucleotides in length)(Fig. 2B; pg. 153, left col.). Because length preferences differed between targets, Anzalone suggests starting with heterologous object sequences 10-16 nucleotides and testing shorter and longer RT templates during template RNA optimization for a particular target (pg. 153, left col.).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have optimized the PBS sequence length in the SERPINA1-specific template RNA using the optimization method taught by Anzalone, to arrive at a heterologous object sequence 6 nucleotides long. It would have amounted to applying a known optimization method to a “base” heterologous object sequence, to yield predictable and improved results. The obviousness of applying the template RNA design principles taught by Anzalone to the sequences taught by Conway, to create a SERPINA1-specific template RNA in the gene modifying system taught by Kweon is recited above in paragraph 16 and applied here. Because I) Kweon and Anzalone teach “base” heterologous object sequences, II) optimization of heterologous object sequence length was routine in the art as evidenced by Kweon and Anzalone, and because III) Anzalone teaches optimization methods that include templates “shorter or longer” than 10-16 nucleotides, a skilled artisan would have reasonably predicted that applying Anzalone’s method of testing sequences would result in an optimal heterologous object sequence length for editing at the SERPINA1 target site. A skilled artisan would have been motivated to optimize the heterologous object sequence length because Kweon and Anzalone both teach that such optimization is necessary to improve editing activity.
Regarding claim 7, Kweon does not teach that the heterologous object sequence has an RNA sequence of TTTCTC. However, as stated above in paragraph 16 and for the reasons recited therein, a skilled artisan applying the principles of Anzalone (Fig. 1B, Extended Data Fig. 3A) to create a SERPINA1-specific template RNA for the gene modifying system taught by Kweon, would create a template RNA comprising the gRNA spacer of SEQ ID NO: 20623. Accordingly, the +1-editing position would be between codons “GAC” (Asp) and “AAG” (Lys) in Conway Fig. 1A, bottom strand)(see Fig. A above).
Regarding claim 7, applying the template RNA design principles of Anzalone to the sequences of Conway, a skilled artisan would have included the RNA sequence TTTCTC in the heterologous object sequence, such that following reverse transcription, the point mutated codon “AAG” (Lys) immediately following the nick induced by SpyCas9-SpRY would be corrected to “GAG” (Glu). Kweon teaches heterologous object sequences (“RT templates”) 9-17 nucleotides in length (Fig. 1F; Supplemental Information, Fig. S4; Table S2, column H), and thus, each of the heterologous object sequences prepared using the design principles of Anzalone would encode the subsequent codon “AAA” in the heterologous object sequence with the RNA sequence “TTT”.
The obviousness of applying the template RNA design principles taught by Anzalone to the SERPINA1 sequences taught by Conway, to create a SERPINA1-specific template RNA in the gene modifying system taught by Kweon is recited above in paragraph 16 and applied here with regard to claim 7.
Regarding claim 9, as stated above, Kweon teaches PBS sequences 9 and 11 nucleotides in length. Kweon also teaches that PBS sequence length influences prime editing efficiency (pg. 2003, Fig. 1F), and suggests that optimization of PBS length is essential to maximize the editing activity of PE2-SpRY (pg. 2003, right col.). Kweon does not teach that the PBS sequence has a length of 10 nucleotides.
Anzalone also teaches that PBS sequence length influences prime editing efficiency (pg. 152, right col.). Anzalone systematically examined the impact of PBS sequence lengths between 7-17 nucleotides in length for various target sites (Fig. 2A). Anzalone teaches that no PBS sequence length was strictly predictive of editing efficiency across the various target sites (pg. 152, right col.). Accordingly, Anzalone suggests starting with a PBS length of about 13 nucleotides and testing different PBS lengths during template RNA optimization for a particular target (pg. 153, left col.).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have optimized the PBS sequence length in the SERPINA1-specific template RNA using the optimization method taught by Anzalone, to arrive at a PBS sequence 10 nucleotides long. It would have amounted to applying a known optimization method to a “base” PBS sequence, to yield predictable, improved results. The obviousness of applying the template RNA design principles taught by Anzalone to the sequences taught by Conway, to create a SERPINA1-specific template RNA in the gene modifying system taught by Kweon is recited above in paragraph 16 and applied here. Because I) Kweon and Anzalone teach “base” PBS sequences, II) optimization of PBS sequence length was routine in the art as evidenced by Kweon and Anzalone, and because III) Anzalone teaches optimization methods that encompass PBS sequences 10 nucleotides long, a skilled artisan would have reasonably predicted that applying Anzalone’s method would result in an optimal PBS sequence length for editing at the SERPINA1 target site. A skilled artisan would have been motivated to optimize the PBS sequence length because Kweon and Anzalone both teach that such optimization is necessary to improve editing activity.
Regarding claim 10, as stated above, Kweon teaches PBS sequences 9 and 11 nucleotides in length. Applying the template RNA design principles of Anzalone to the sequences of Conway, a skilled artisan would have included a PBS sequence 9 or 11 nucleotides in length that was complementary to the nucleotides immediately before the nick on the PAM-containing strand. As shown in Fig. C below, the 11 nucleotide PBS sequence would have the RNA sequence of instant SEQ ID NO: 21433 (i.e., “GTCGATGGTC” bolded in Fig. C below).
PNG
media_image2.png
287
505
media_image2.png
Greyscale
The obviousness of applying the template RNA design principles taught by Anzalone to the SERPINA1 sequences taught by Conway, to create a SERPINA1-specific template RNA in the gene modifying system taught by Kweon is recited above in paragraph 16 and applied here with regard to claim 10.
Regarding claims 13-14, Kweon teaches the scaffold of SEQ ID NO: 20427, PBS sequences 9 and 11 nucleotides, and heterologous object sequences between 9-17 nucleotides. Thus, in view of the sequences of Conway and design principles of Anzalone, Kweon teaches a template RNA 87.5% identical to instant SEQ ID NO: 24956 (see alignment of record and Fig. D below). Kweon does not teach that the template RNA is at least 90% identical to SEQ ID NO: 24956 or is the RNA sequence of SEQ ID NO: 24956.
However, as stated above in paragraphs 23 and 25, applying the optimization method of Anzalone to the “base” PBS sequence and heterologous object sequence lengths taught by Kweon and Anzalone would have been obvious to one skilled in the art before the effective filing date of the claimed invention. Anzalone and Kweon teach that PBS and heterologous object sequence length impact editing efficiency (Anzalone, Fig. 2A-B; Kweon, Fig. 1F, S4), and thus, they strongly suggest that testing combinations of PBS and heterologous object sequence length is a necessary and routine step in template RNA optimization. Indeed, both Anzalone and Kweon teach combining different PBS and heterologous object sequence lengths as part of the template RNA optimization process (Anzalone, Fig. 2A-B; Kweon, Fig. 1F, S4). A template RNA with a 6-nucleotide object sequence and a 10-nucleotide PBS sequence is 100% identical to instant SEQ ID NO: 24956 (see alignment of record and Fig. E below).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have optimized the PBS sequence length and heterologous object sequence length in the SERPINA1-specific template RNA using the optimization method taught by Anzalone, to arrive at the template RNA of SEQ ID NO: 24956. It would have amounted to applying a known optimization method to a “base” template RNA sequence, to yield predictable, improved results. The obviousness of applying the template RNA design principles taught by Anzalone to the sequences taught by Conway, to create a SERPINA1-specific template RNA 87.5% identical to SEQ ID NO: 24956 is recited above and applied here. Because I) Kweon and Anzalone teach “base” template RNA sequences, and II) optimization of the PBS and heterologous sequence length therein was routine in the art as evidenced by Kweon and Anzalone, a skilled artisan would have reasonably predicted that applying Anzalone’s method would result in an optimal template RNA for editing at the SERPINA1 target site. A skilled artisan would have been motivated to optimize both sequence lengths in the template RNA because Kweon and Anzalone teach that such optimization is necessary to improve editing activity for a specific target site.
PNG
media_image3.png
603
868
media_image3.png
Greyscale
Claim Rejections – 35 USC § 103 – Kweon, Conway, and Anzalone in further view of IDT
Claims 15-16 are rejected under 35 U.S.C. 103 as being unpatentable over Kweon (Kweon et al., 23 February 2021, Molecular Therapy, 29(6), p. 2001-2007 and Supplemental Information and Table S2, of record), Conway (Conway et al., Patent No. US 10,960,085 B2, published 30 March 2021, of record), and Anzalone (Anzalone et al., 21 October 2019, Nature, 576, p. 149-157, and Methods, Extended Data, and Supplementary Information, of record) as applied to claims 1-14, 17-24, and 31 above, and in further view of IDT (Integrated DNA Technologies, “Should pegRNAs for CRISPR prime editing include chemical modifications?”, published 24 November 2020, retrieved 25 April 2024 from The Wayback Machine, of record). The rejections that follow are maintained from the prior action.
The teachings of Kweon, Conway, and Anzalone are recited above and applied as to claims 1-14, 17-24, and 31 therein. Briefly, Kweon, Conway, and Anzalone render obvious the template RNA according to SEQ ID NO: 24956 for the reasons above in paragraph 27. It is noted that SEQ ID NO: 24956 is 100% identical to the sequence of SEQ ID NO: 24146 (see alignment of record). Thus, Kweon, Conway, and Anzalone also render obvious a template RNA having the sequence of SEQ ID NO: 24146 for the reasons above in paragraph 27.
Kweon, Conway, and Anzalone do not teach that the template RNA comprises one or more chemically modified nucleotides (claim 15), or the chemical modifications set out in SEQ ID NO: 24146 (claim 16).
However, IDT teaches that including three 2’-OMe bases and three phosphorothioate linkages on each end of a template RNA (“pegRNA”) results in higher levels of CRISPR prime editing. The chemical modifications set forth in IDT are identical to the chemical modifications set forth in SEQ ID NO: 24146 wherein the first and last three nucleotides are 2’-OMe, and the first and last three linkages are phosphorothioate.
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have improved the template RNA of SEQ ID NO: 24146, with the chemical modifications taught by IDT. It would have amounted to applying known chemical modifications to improve a known template RNA sequences to yield predictable results. The obviousness of improving the elements of the template RNA with the optimization method of Anzalone to arrive at the template RNA of SEQ ID NO: 24146 is described in paragraph 27 and applied here. A skilled artisan would have had a reasonable expectation that applying the specific chemical modifications taught by IDT would improve the “base” template RNA of SEQ ID NO: 24146 because IDT teaches that the modifications result in higher levels of CRISPR editing. Because IDT teaches the specific chemical modifications improve prime editing efficiency, a skilled artisan would have been motivated to apply the modifications to the “base” template RNA of SEQ ID NO: 24146.
Response to Remarks - 35 USC § 103
Applicant’s remarks regarding the § 103 rejections raised in the prior action have been thoroughly considered, but are not found persuasive to overcome the rejection for the reasons that follow.
Applicant analyzes the teachings and alleged deficiencies of the cited references (remarks, pg. 10-11), and concludes that none of “the cited references, either alone or in combination [] teach or suggest each and every one of the elements of the claims.” Applicant specifically alleges that the skilled artisan would not have arrived at a gRNA spacer comprising the sequence of SEQ ID NO: 20623 based on Conway, or Conway in view of Kweon or Anzalone “without extensive experimentation” (remarks, pg. 13, emphasis preserved). Applicant alleges that the skilled artisan would have instead tried to use Conway’s ZFN editing site sequences, i.e., “25264” and “25277.” Applicant also alleges that “[f]ollowing a review of Conway, a person skilled in the art would not have had any motivation to select a system recited in Anzalone or Kweon from various gene editing approaches known in the art without any teachings or even suggestion from the cited references alone or in combination that such a system would be advantageous” (remarks, pg. 12, emphasis preserved). Applicant alleges that skilled artisan, while being “likely [to] select… a canonical CRISPR/Cas-based system,” would not have selected the instantly claimed CRISPR/Cas system for correcting the E342K mutation based on Conway’s disclosure (remarks, pg. 12). Applicant also cites evidence that Conway “has already demonstrated successful gene editing of the SERPINA1 gene using zinc finger nucleases (ZFN),” and thus, referencing Ex Parte Rinkevich, Appeal No. 2007-1317, Applicant alleges that “any alleged motivation provided by the Office to modify the disclosure of cited references to arrive at the presently claimed subject matter is a solution without a problem.” Similarly, elsewhere in the remarks (pg. 15-16), Applicant alleges that the Office has used impermissible hindsight to formulate the rejection. In support, Applicant again focuses on the alleged deficiency of the prior art with respect to the gRNA spacer comprising the sequence of SEQ ID NO: 20623.
Applicant’s remarks regarding the alleged deficiencies of Kweon, Conway, and Anzalone with respect to the instant claims have largely been addressed in the prior action (see paragraph 33). Examiner agrees that none of the cited references alone teach (i.e., anticipate) each feature of the instantly claimed template RNA. Examiner has also acknowledged certain deficiencies in the cited references in each of the prior actions and above. MPEP 2145(X)(A) states that “[a]ny judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning, but so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971)” (emphasis added). As described in the following paragraphs, which are largely summarized from paragraph 33 of the prior action, the rejections made in the prior action and above address each feature of the instant claims, including the obviousness of the gRNA spacer comprising the sequence according to SEQ ID NO: 20623, by relying on what the teachings of the prior art would have suggested to the ordinarily skilled artisan as of the effective filing date.
Kweon provides a PAMless prime editing system comprising a template RNA comprising a scaffold that binds a SpyCas9-SpRY domain, a 20-nucleotide gRNA spacer that is complementary to a first portion of a target gene, a heterologous object sequence, and a primer binding site with at least 3 bases with 100% identity to a target gene. Conway teaches that a CRISPR/Cas system, including one employing “functional derivatives” of naturally occurring Cas proteins, is appropriate for correcting the E342K mutation.. MPEP 2145(X)(D)(1) states that “the prior art’s mere disclosure of more than one alternative does not constitute a teaching away from any of these alternatives because such disclosure does not criticize, discredit, or otherwise discourage the solution claimed….” Conway does not appear to criticize, discredit, or otherwise discourage the use of a CRISPR/Cas system, and explicitly suggests use of systems employing “functional derivatives,” which the skilled artisan would understand to include the system of Kweon. Furthermore, Kweon teaches their system allows for PAMless prime editing of a desired target gene, allowing the skilled artisan to adapt the ZFN-based system of Conway, to a CRISPR/Cas system which “advantageously relies upon proven nuclease targets.”
Conway teaches the exact sequences surrounding the E342K mutation in SERPINA1 and provides ZFN sites bordering the E342K mutation which are targeted to correct the E342K mutation. Furthermore, Conway teaches spacer sequences of CRISPR/Cas system gRNAs can be designed to target the region between known ZFN sites, which “advantageously relies upon proven nuclease targets” (“sgRNAs can be designed by utilization of a known target of DNA-binding domain… can be designed to known paired nuclease sites… identifying the spacer region between the ZFN-half sites… This method advantageously relies on proven nuclease targets”, col. 35, lines 30-43). Conway does not teach using the known ZFN site sequences themselves as gRNA spacers. There is no evidence in Conway, or the remaining prior art, that the skilled artisan would have tried to use Conway’s ZFN editing site sequences, i.e., “25264” and “25277,” as gRNA spacers as Applicant’s remarks allege.
The skilled artisan would recognize that the gRNA in a CRISPR/Cas system taught by Conway could be adapted to a template RNA as taught by Anzalone and Kweon, because both RNAs rely on a target specific-spacer sequences and Cas-specific scaffold sequences to direct editing to a desired target site. Anzalone teaches parameters for designing template RNAs to induce a SpyCas9-mediated nick at a desired target site and promote prime editing. Anzalone teaches that SpyCas9 prime editors induce a nick at the +1-edit position of the PAM-containing strand, and that this nick allows hybridization of the PBS of the template RNA to the PAM-containing strand, and subsequently, the direct polymerization of a desired DNA sequence contained within the heterologous object sequence (“RT template”) of the template RNA. The sequence comprising Conway’s proven ZFN target sites comprises SEQ ID NO: 20623 (see Fig. A-B above; Conway Fig. 1A). The skilled artisan, guided by the teachings of Conway regarding the use of CRISPR/Cas systems and a proven nuclease target site in SERPINA1 surrounding the E342K mutation, and understanding the prime editing strategy and design principles described by both Anzalone and Kweon, would have arrived at a template RNA with the specific components of the claimed template RNA, including a gRNA spacer sequence comprising SEQ ID NO: 20623.
It is not apparent that selection of the instantly claimed template RNA would have required extensive experimentation as Applicant asserts, or that a CRISPR/Cas prime editing system would not have been an obvious means to correct the SERPINA1 E342K mutation based on the prior art. There is no apparent deficiency in the rejection of the prior action or above with respect to the specific combination of elements in the instant claims; each element is addressed, using what the teachings of the prior art would have suggested to those of ordinary skill.
The decision in Ex Parte Rinkevich, Appeal No. 2007-1317 has also been reviewed with respect to Applicant’s arguments regarding hindsight reasoning. There is no evidence in the prior art or Applicant’s remarks that the skilled artisan would have considered Conway as “solving” Alpha-1-antitrypsin (A1AT) deficiency caused by an E342K mutation in SERPINA1. Conway teaches the use other systems, including “functional derivatives” of CRISPR/Cas systems. It is not clear why Conway would provide alternative systems to correct the E342K mutation in SERPINA1, were it true that the problem was “solved” by Conway’s ZFN-based system as Applicant alleges. Liu (of record), which was published after Conway, but prior to the effective filing date of the claimed invention, teaches a prime editing CRISPR/Cas strategy to correct the E342K mutation in SERPINA1 (see Fig. 3). Again, were the problem considered “solved” by Conway’s ZFN-based system as Applicant alleges, it is not clear why Liu, the ordinarily skilled artisan, would employ a different system prior to the effective filing date of the claimed invention.
Applicant also submits that “the Office’s position that “Anzalone and Kweon both demonstrate that such optimization [of the RT sequence length and/or PBS sequence length] was routine and well within the purview of the skilled artisan” is an oversimplification of the efforts to identify and select the sequences and lengths of the claimed heterologous object sequence and PBS sequence and does not supply the predictability required to support an obviousness rejection” (remarks, pg. 13-14). Applicant alleges that “Kweon and Anzalone provide contradictory teaching of how to optimize a pegRNA targeting different genes” (pg. 14, emphasis preserved). Applicant alleges that the skilled artisan would “not have had any guidance regarding how to optimize a pegRNA… [or] to arrive at the specific combinations of heterologous object sequence and PBS lengths recited in instant claim 1” (pg. 14).
First, the instant claims do not require any specific PBS sequence or heterologous object sequence. The instant claims do recite ranges of lengths for these elements, but examples within these ranges are either explicitly taught by or rendered obvious over the prior art as described above. Applicant appears to be relying, at least in part, on unclaimed elements to support the nonobviousness of the instant claims, and this is not found persuasive. Second, the quotes referenced by Applicant are not contradictory. Anzalone’s conclusions are based on analysis of more target genes, and more PBS sequence and heterologous sequence lengths than Kweon’s conclusions. Anzalone demonstrates that no PBS sequence length or G/C content is strictly predictive of editing efficiency across contexts, and that the optimal length of a heterologous object sequence also depends on the targeted gene (see at least Fig. 2). Kweon, based on an analysis of two different target genes, concludes that longer PBS sequences were more efficient in these contexts, but that there was no preference for heterologous object sequence length (see Fig. 1F). Kweon immediately follows these observations by stating that “[a]s prime editing activity depends on the lengths of the PBS and RT templates, optimization of pegRNAs is essential to maximize the activity of the PE2 variants” (pg. 2003, right col.). Based on Anzalone and Kweon, the skilled artisan would understand that the PBS sequence and heterologous object sequence length influences editing efficiency, and optimization for each target gene is required to produce the most effective template RNA. The prior art does not fail to provide “any” guidance as Applicant alleges. Anzalone and Kweon provide ample guidance for the skilled artisan to design a template RNA with the instantly claimed elements.
Applicant submits that Anzalone and Kweon illustrate “general unpredictability of the field of gene editing using their described systems” (pg. 14). Applicant asserts that “Anzalone has shown that even when targeting the same mutation, pegRNAs comprising different spacer sequences may result in different efficiency, or even failure, of prime editing” (pg. 14). Applicant cites Anzalone as stating “[m]uch additional research is needed to further understand and improve prime editing in a broad range of cell types and organisms, to assess off-target prime editing in a genome-wide manner, and to further characterize the extent to which prime editors might affect cells” (pg. 14, emphasis preserved). Applicant also cites Kweon as stating "as prime editing activities are highly dependent on the composition of pegRNAs, experimental optimization of the pegRNA is required to achieve efficient prime editing” (pg. 14-15, emphasis preserved).
These remarks have been previously addressed, and remain unpersuasive for the reasons described in paragraph 34 of the prior action.
Applicant also alleges that “[s]tarting from Kweon and looking to design a template RNA comprising the spacer sequence as presently claimed, which is not taught or suggested by the cited references, the skilled artisan could choose to design a template comprising a heterologous object sequence and a PBS sequence having an enormous number of lengths and of sequences. Testing and validating the large numbers of potential combinations would require undue experimentation.”
The instant rejection does not require that the skilled artisan “vary all parameters” or “try each of numerous possible choices” as Applicant’s remarks allege. The skilled artisan also would not have had to choose from an “enormous number of lengths and of sequences” for the heterologous object sequence and PBS sequence. The prior art teaches principles for designing and optimizing template RNA elements. The prior art template RNAs are successful across contexts (e.g., different target genes, different template RNA parameters, and different types of rewriting). As described above, the skilled artisan would have been directed to a gRNA spacer sequence comprising SEQ ID NO: 20623, based on the teachings of Conway regarding the use of proven nuclease sites, and the teachings of Kweon and Anzalone regarding gRNA spacer sequences. The skilled artisan would have been directed by the prior art to design a heterologous object sequence and PBS sequence within known prior art lengths, and optimize therefrom, to produce the most successful template RNA. The heterologous object sequence and PBS sequence lengths recited in the instant claims are either taught by or rendered obvious over the prior art. Although it is noted that no specific PBS sequence or heterologous object sequence is required of the instant claims, these sequences would also not represent an “enormous number” as Applicant alleges. The prior art clearly illustrates that the nucleotide sequences of these elements are selected based on their spatial relationship to the gRNA spacer sequence, i.e., they are not unlimited or unconstrained. Even still, the specific heterologous object sequence and PBS sequences required of particular dependent claims (e.g., claims 10, 14) may be derived by applying the template RNA design and optimization principles of the prior art to the SERPINA1 target sequence disclosed by Conway.
Taken together, it is not apparent that arriving at the instantly claimed template RNA elements would have required “undue experimentation” as Applicant alleges. The SERPINA1 target sequence was known, and design and optimization principles were known and routinely utilized by the ordinary skilled artisan to produce successful template RNAs. The instantly claimed template RNA elements are either taught or obvious over the prior art for the reasons described above. There is insufficient evidence that the skilled artisan would not have arrived at these elements based on the direction of the prior art, or that design of such a template RNA would have required more than what was routine for the ordinary skilled artisan.
Finally, Applicant submits that even if a prima facie case of obviousness had been established, it would be rebutted by surprising results resulting from the spacer corresponding to SEQ ID NO: 20623. Applicant alleges that “the template RNAs recited in claim 1 all have rewriting efficiencies of at least 0.5%, e.g., as shown in Figure 17A of the instant application.” Applicant alleges that the surprising results are commensurate with the scope of the claims. Applicant also alleges that none of Kweon, Anzalone, or Conway are appropriate prior art to compare the alleged surprising results of the instant claims.
Examiner agrees that the claims are commensurate in scope with Applicant’s alleged surprising editing efficiency of “at least 0.5%” in Fig. 17A. MPEP 716.02(b)(I) states that the “burden [is] on Applicant to establish results are unexpected and significant.” “The evidence relied upon should establish “that the differences in results are in fact unexpected and unobvious and of both statistical and practical significance.” Ex parte Gelles, 22 USPQ2d 1318, 1319 (Bd. Pat. App. & Inter. 1992). While Applicant states that template RNAs comprising the spacer sequence of SEQ ID NO: 20623 have the highest rewriting efficiencies amongst those in Fig. 16 of the instant specification, Applicant still has not provided any evidence that the rewriting efficiencies are unexpected and significant with respect to the prior art.
As described in the prior action, Kweon, while targeting different genes than the instant application, shows that a system similar to that used by Applicant to generate the results in Fig. 17A, generates editing efficiencies less than, equal to, and greater than 10.3%, which is the highest rewriting efficacy cited in Fig. 17A (see columns in Kweon, Table S1 corresponding to “PE2-spRY”). Based on Kweon’s prior art system, which is the closest art available for comparison to the system used by Applicant to generate the results in Fig. 17A, the skilled artisan would have reasonably expected the editing efficiencies depicted in Fig. 17A (i.e., 0.5% to 10.3%). These editing efficiencies exhibited by systems comprising a claimed template RNA are not “unexpected and significant” based on Kweon.
Applicant contends that Kweon is an insufficient reference for comparison because they teach different target genes, or don’t utilize the specific elements of the claimed template RNA. In the prior action in response to this same argument Examiner cited Liu, which shows editing efficiencies at the E342K site in SERPINA1 less than, equal to, and greater than 10.3% (Fig. 3). Liu’s system utilizes different template RNA elements, and a different Cas protein than the systems described in the specification or Kweon. Nevertheless, even should the editing efficiencies exhibited in systems comprising a claimed template RNA be compared to a system targeting the same mutation in SERPINA1, it is not apparent that Applicant’s rewriting efficacies are “unexpected and significant.”
In conclusion, Examiner maintains that the instant claims are obvious in view of Kweon, Anzalone, Conway, and IDT. Furthermore, in view of the objective evidence provided by Applicant, the scope of the claimed range of template RNAs, and the rewriting efficacies in the disclosure and prior art, it is reasonable to conclude that the disclosed rewriting efficacies would have been expected.
Nonstatutory Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
U.S. Patents
Claims 1-24, and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following U.S. Patents in view of Kweon (Kweon et al., 23 February 2021, Molecular Therapy, 29(6), p. 2001-2007 and Supplemental Information and Table S2, of record), Conway (Conway et al., Patent No. US 10,960,085 B2, published 30 March 2021, of record), Anzalone (Anzalone et al., 21 October 2019, Nature, 576, p. 149-157, and Methods, Extended Data, and Supplementary Information, of record), and IDT (Integrated DNA Technologies, “Should pegRNAs for CRISPR prime editing include chemical modifications?”, published 24 November 2020, retrieved 25 April 2024 from The Wayback Machine, of record). The rejections that follow are maintained from the prior action. Note: the numbering from the prior actions is preserved throughout this section.
Claims 24-26 of Patent No. 12,024,728 B2 drawn to a system with a generic template RNA and gene modifying polypeptide having a Cas9 nickase domain and a SFV RT domain (SEQ ID NO: 8,113) connected by a linker.
Claims 24-26 of Patent No. 12,031,162 B2 drawn to a system with a generic template RNA and gene modifying polypeptide having a Cas9 nickase domain and a AVIRE RT domain (SEQ ID NO: 8,003) connected by a linker.
Claims 24-26 of Patent No. 12,037,617 B2 drawn to a system with a generic template RNA and gene modifying polypeptide having a Cas9 nickase domain and a FLV RT domain (SEQ ID NO: 8,020) connected by a linker.
Claims 24-26 of Patent No. 12,123,034 B2 (identified as Application No. 18/447,681 in the prior action) drawn to a system with a generic template RNA and gene modifying polypeptide having a Cas9 nickase domain and a MLV RT domain (SEQ ID NO: 8,074) connected by a linker.
Claims 5-13 of Patent No. 12,270,029 (identified as Application No. 18/470,687 in the prior action) drawn to systems comprising a template RNA targeting a mutation in the human CFTR gene having a gRNA scaffold identical to instant SEQ ID NO: 20,427, and a gene modifying polypeptide having a SpyCas9 domain and a RT domain connected by a linker.
The claims of Patents I-IV are directed to generic template RNAs having the features of the instantly claimed template RNA, and gene modifying systems comprising the generic template RNA and a gene modifying polypeptide having a generic endonuclease domain, or a Cas9 nickase domain fused to a RT domain. The patented claims do not recite the gRNA spacer sequence, PBS sequence, or heterologous object sequence features of the instant claims, or the SpyCas9-SpRY domain of the instant claims.
The teachings of Kweon, Conway, Anzalone, and IDT are recited above in paragraphs 12-32.
Regarding Patents I-IV, it would have been obvious before the effective filing date of the claimed invention to have substituted the generic template RNA and Cas9 nickase domain of the patented claims, with the SERPINA1-specific template RNA and SpyCas9-SpRY domain taught by Kweon, Conway, Anzalone, and IDT. It would have amounted to a simple substitution of known elements by known means to yield predictable results. Regarding the template RNA, a skilled artisan would have a reasonable expectation of success in substituting the elements because I) Anzalone teaches template RNA design principles which can be applied to the SERPINA1 sequences taught by Conway, and II) Kweon and Anzalone teach target-specific template RNAs that edit a desired target when combined with a gene modifying polypeptide having a RT domain and a Cas9 nickase domain. Regarding the Cas9 nickase domain, a skilled artisan would have a reasonable expectation of success in substituting the elements because Kweon teaches the SpyCas9-SpRY nickase can edit target sites in a PAMless manner. A skilled artisan would have been motivated to substitute the template RNA and endonuclease domain of the patented claims because Conway teaches that the E342K mutation in SERPINA1 causes A1AT deficiency, which may be corrected by Cas9 proteins or their functional variants, e.g., the SpyCas9-SpRY nickase taught by Kweon.
The claims of Patent IX are directed to gene modifying systems comprising template RNAs having the core features of the instantly claimed template RNA but targeting a different gene, and a gene modifying polypeptide having a SpyCas9 nickase domain fused to a RT domain. The patented claims do not recite the gRNA spacer sequence, PBS sequence, or heterologous object sequence features of the instant claims, or the SpyCas9-SpRY domain of the instant claims.
Regarding Patent IX, the obviousness of substituting the template RNAs, and SpyCas9 nickase of the patented claims with the SERPINA1-specific template RNA and SpyCas9-SpRY domain taught by Kweon, Conway, Anzalone, and IDT is recited directly above and applied here.
Co-pending Applications
Claims 1-24, and 31 are rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following Co-pending Applications in view of Kweon (Kweon et al., 23 February 2021, Molecular Therapy, 29(6), p. 2001-2007 and Supplemental Information and Table S2, of record), Conway (Conway et al., Patent No. US 10,960,085 B2, published 30 March 2021, of record), Anzalone (Anzalone et al., 21 October 2019, Nature, 576, p. 149-157, and Methods, Extended Data, and Supplementary Information, of record), and IDT (Integrated DNA Technologies, “Should pegRNAs for CRISPR prime editing include chemical modifications?”, published 24 November 2020, retrieved 25 April 2024 from The Wayback Machine, of record). These are provisional double patenting rejections because the patentably indistinct claims have not in fact been patented. The rejections below are maintained from the prior Action. Note: the numbering from the prior action is preserved throughout this section.
Claims 25-26, 30-31 of Application No. 18/595,904 drawn to a system with a generic template RNA and gene modifying polypeptide having a Cas9 nickase domain and a RT domain of SEQ ID NO: 8,101, 8,103, or 8,104 connected by a linker.
Claims 110-132 of Application No. 17/929,116 drawn to a system for modifying DNA comprising a gene modifying polypeptide having a DBD domain, an endonuclease domain, and a RT domain, and a generic template RNA.
Claims 1-17, 19-25, and 31 of Application No. 18/495,276 drawn to a system with a template RNA targeting a mutation in the human PAH gene having a gRNA scaffold identical to instant SEQ ID NO: 20,427, and a gene modifying polypeptide having a SpyCas9 domain and a RT domain connected by a linker.
Claims 1-26 of Application No. 18/590,275 drawn to a system with a template RNA targeting a mutation in the human HBB gene having a gRNA scaffold identical to instant SEQ ID NO: 20,427, and a gene modifying polypeptide having a SpyCas9 domain and a RT domain connected by a linker.
The claims of co-pending Applications V and VI are directed to generic template RNAs having the features of the instantly claimed template RNA, and gene modifying systems comprising the generic template RNA and a gene modifying polypeptide having a generic endonuclease domain, or a Cas9 nickase domain fused to a RT domain. The co-pending claims do not recite the gRNA spacer sequence, PBS sequence, or heterologous object sequence features of the instant claims, or the SpyCas9-SpRY domain of the instant claims.
The teachings of Kweon, Conway, Anzalone, and IDT are recited above in paragraphs 12-32.
Regarding co-pending Application V and VI, it would have been obvious before the effective filing date of the claimed invention to have substituted the generic template RNA and Cas9 nickase domain of the co-pending claims, with the SERPINA1-specific template RNA and SpyCas9-SpRY domain taught by Kweon, Conway, Anzalone, and IDT. It would have amounted to a simple substitution of known elements by known means to yield predictable results. Regarding the template RNA, a skilled artisan would have a reasonable expectation of success in substituting the elements because I) Anzalone teaches template RNA design principles which can be applied to the SERPINA1 sequences taught by Conway, and II) Kweon and Anzalone teach target-specific template RNAs that edit a desired target when combined with a gene modifying polypeptide having a RT domain and a Cas9 nickase domain. Regarding the Cas9 nickase domain, a skilled artisan would have a reasonable expectation of success in substituting the elements because Kweon teaches the SpyCas9-SpRY nickase can edit target sites in a PAMless manner. A skilled artisan would have been motivated to substitute the template RNA and endonuclease domain of the co-pending claims because Conway teaches that the E342K mutation in SERPINA1 causes A1AT deficiency, which may be corrected by Cas9 proteins or their functional variants, e.g., the SpyCas9-SpRY nickase taught by Kweon.
The claims of co-pending Applications VIII and X are directed to specific template RNAs having the core features of the instantly claimed template RNA, but targeting different genes, as well as gene modifying systems comprising the template RNAs and a gene modifying polypeptide having a SpyCas9 nickase domain fused to a RT domain. The co-pending claims do not recite the gRNA spacer sequence, PBS sequence, or heterologous object sequence features of the instant claims, or the SpyCas9-SpRY domain of the instant claims.
Regarding co-pending Applications VIII and X, the obviousness of substituting the specific template RNAs, and SpyCas9 nickase of the co-pending claims with the SERPINA1-specific template RNA and SpyCas9-SpRY domain taught by Kweon, Conway, Anzalone, and IDT is recited above and applied here.
Response to Remarks – Nonstatutory Double Patenting
Examiner acknowledges Applicant’s request that the nonstatutory double patenting rejections be held in abeyance until the outstanding rejections are overcome. Applicant’s remarks do not address the propriety of the rejections, and no terminal disclaimers have been filed. The instant claims remain patentably indistinct from the claims in the patents and co-pending applications above.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600