Office Action Predictor
Last updated: April 15, 2026
Application No. 18/473,015

ISOLATION AND CHARACTERIZATION OF NOVEL TISSUE-SPECIFIC PROMOTERS IN MAIZE

Non-Final OA §101§102§103§112
Filed
Sep 22, 2023
Examiner
DELEO, VICTORIA LYNN
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Wisconsin Alumni Research Foundation
OA Round
1 (Non-Final)
38%
Grant Probability
At Risk
1-2
OA Rounds
2y 4m
To Grant
-2%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allow Rate
8 granted / 21 resolved
-21.9% vs TC avg
Minimal -40% lift
Without
With
+-40.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 4m
Avg Prosecution
40 currently pending
Career history
61
Total Applications
across all art units

Statute-Specific Performance

§101
9.8%
-30.2% vs TC avg
§103
26.8%
-13.2% vs TC avg
§102
18.3%
-21.7% vs TC avg
§112
35.7%
-4.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 21 resolved cases

Office Action

§101 §102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of SEQ ID NO: 1 (php20719a (clob2)) in the reply filed on 6/20/2025 is acknowledged. Claims 16-18 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 6/20/2025. Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i). The restriction is made FINAL. Status of Claims Claims 1-15, 19 & 20 are under examination on the merits. Claim Objections Claims 7 & 10 are objected to because of the following informalities: Claim 7 (line 2): “draught” should read --drought--. Claim 10 (line 1): “agrobacterium” should be capitalized. Appropriate correction is required. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1, 2, 5 and 8 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural phenomenon without significantly more. The claim(s) recite(s) a construct comprising a promoter of a maize php20719a gene operably linked to a transgene (claim 1), wherein the construct is a vector (claim 2), wherein the construct comprises the native 2 kilobase sequence immediately upstream of the translation initiation site (claim 5), and wherein the construct allows for tissue-specific expression (claim 8). The specification defines a construct as a polynucleotide formed by combining at least two components from different sources, which can be natural or synthetic (page 6, lines 8-10), a vector as a polynucleotide that is capable of transporting another polynucleotide to which it is linked (page 6, lines 14-15) and a transgene as genetic material that one wishes to transfer into an organism or cell (page 8, lines 20-21). This judicial exception is not integrated into a practical application because the specification defines transgene to encompass genes or fragments that are intended to be used as transgenes. The construct of claim 1, 5 or 8 and the vector of claim 2 are not required to be transgenic, so they are not a practical application distinct from the natural product of the 2000 bp upstream of the maize php20719a gene linked to the native maize gene and found on a chromosome, which reads on a vector. The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because although a construct requires two different sources, the specification allows that the sources can be natural or synthetic. The resulting recombinant construct of a promoter sequence excised from a naturally source recombined with a synthesized coding sequence, for example, would not have any inherent characteristics that would make it patentably distinct from the full maize php20719a gene with promoter extracted from a natural source or synthesized (claims 1 & 5). The natural coding sequence would be operably linked to its natural promoter. The method of recombination and the source of each part of the construct would not in themselves confer markedly different characteristics. The vector carrying the recombinant construct (claim 2) would likewise not necessarily comprise distinct characteristics from naturally occurring vectors like chromosomes carrying the full maize php20719a gene. Tissue-specific expression (claim 8) is an inherent feature of the promoter of php20719a and would not distinguish the claimed invention from a natural phenomenon. Claims 3-4 and 6-7 do comprise markedly different characteristics relative to the natural phenomenon, including that the vector is an Agrobacterium vector (claim 3), the construct is a DNA donor template (claim 4), or the transgene encodes a reporter, pharmaceutical or a nutrient (claim 6) or a protein that confers resistance or an increase in yield or nutritional content (claim 7). Claim Rejections - 35 USC § 112 Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-15, 19 & 20 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 1 (lines 2-3) & 8 (line 2) recite “php20719a (clob2)”. The text within the parentheses renders the claim indefinite because it is unclear whether the limitations within the parentheses are part of the claimed invention. If the limitation within the parentheses is intended to provide an alternative name for the gene, wording to that effect like “also known as…” would make the limitation clear. The instant specification teaches that the php20719a promoter is equivalent to the clo2b promoter (page 6, lines 6-7) but does not mention a clob2 promoter. Dependent claims 2-15, 19 & 20 are also indefinite. Claim 1 requires “the promoter of a maize gene selected from the group consisting of ris2, lhcb10, php20719a (clo2b), nas2, aa2m, and expb14 and portions or fragments thereof”. It is unclear if the “portions or fragments thereof” refers to portions or fragments of the maize genes or portions or fragments of the promoters of maize genes. Because there is more than one distinct interpretation of the limitations, claim 1 and dependent claims 2-15, 19 & 20 are indefinite. Claim 3 requires “the construct of claim 3”. It is indefinite as to which claim (1 or 2), and which corresponding construct, this claim should depend on. Claim 5 requires a “functional fragment” in line 5. The instant specification defines a functional fragment as a fragment capable as functioning as a promoter but less than the full-length SEQ ID NO: 1 (page 7 lines 25-28). The specification defines a promoter as a DNA sequence that defines where transcription of a gene begins (page 7, lines 9-10). However, promoters comprise features that provide different activity and specificity relative to other promoters. Claim 5 is indefinite because it is not clear whether the functional fragment requires the activity of the promoter of claim 1 or if fragments with any promoter function are encompassed. The term “increase” in claim 7 is a relative term which renders the claim indefinite. The term “increase” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Because the claim language does not define the level of maize yield or nutritional content the increase is relative to, nor how much the yield or nutritional content must change in order to be considered an increase, claim 7 is indefinite. Claim 8 is drawn to the construct of claim 1, wherein the construct is selected from the group consisting of ris2, lhcb10, php20719a (clob2) and fragments thereof. However, the construct of claim 1 requires a promoter operably linked to a transgene and the specification defines a construct as a polynucleotide formed by combining at least two components from different sources (page 6, lines 8-10). ris2, lhcb10, and php20719a are naturally occurring maize genes. The specification allows that a transgene encompasses portions of a gene (page 8, lines 1-2), so ris2, lhcb10, and php20719a (clo2b) and fragments thereof could be interpreted to mean these natural maize genes including the associated regulatory elements including the native promoters. However, this interpretation of claim 8 still would not meet the specification’s definition of a construct. Because it is unclear whether the construct of claim 8 is intended to encompass a construct with the promoter of php20719a or just a construct that consists of php20719a the claim is indefinite. Claim 20 recites the limitation "the transgenic maize" in line 1. There is insufficient antecedent basis for this limitation in the claim. Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1 & 5 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claims 1 & 5 are drawn to a construct comprising a promoter, wherein the promoter is the promoter of a php20719a gene, also known as a clo2b gene. It is unclear if “portions or fragments thereof” (claim 1, line 3) refers to portions or fragments of the maize genes or portions or fragments of the promoters of maize genes. For this rejection, the claim has been interpreted to encompass portions or fragments of the promoter. Claim 5 is further drawn to the promoter comprising the native 2 kilobase sequence immediately upstream of the translation initiation site of the maize gene, SEQ ID NO: 1, or a functional fragment of either option. It is indefinite whether the functional fragment of claim 5 requires the activity of the promoter of claim 1 or if fragments with any promoter function are encompassed. This Written Description rejection is over functional fragments with the promoter activity of the promoter of claim 1. The specification defines a promoter as a DNA sequence that defines where transcription of a gene begins (page 7, lines 9-10). The specification defines a functional fragment as a fragment capable as functioning as a promoter but less than the full-length SEQ ID NO: 1 and that these fragments include at least 100bp of the 2000bp sequences in the examples (page 7 line 25-page 8 line 2). The specification does not define a “portion”, only suggests that a portion is preferably a functional fragment. Thus, claim 1 broadly requires a portion of a php20719a promoter, while claim 5 requires fragments at least 100bp long of the php20719a promoter that functions as a promoter. The instant specification has provided 8 nucleotide sequences of promoters, one of which (SEQ ID NO: 1) is a php20719a promoter (page 7, lines 18-21). The specification teaches that php20719a is an embryo-specific promoter (page 20, lines 4-11). The instant specification has described that functional fragments of 499 or 400bp near the gene-proximal end of promoters other than php20719a are able to serve as minimal promoters (page 20, line 25- page 21, line 13). No functional fragments of the php20719a promoter are described. No functional fragments only 100bp long of any promoter are described. The specification has not described the cis elements or other features of the 1956 bp-long SEQ ID NO: 1 that are responsible for the function of embryo-specific expression. The specification has not provided any examples of 100bp-long fragments of SEQ ID NO: 1 that retain the function of the php20719a promoter. The maize clo2b/php20719a gene is known in the art to encode a caleosin protein (Lizong et al (2014) Int. J. Agric. Biol. 16: 261-268 (published 6/4/2014, hereafter Lizong), abstract, figure 2) and is also known as the GRMZM2G139797 gene model (table 1). ZmClo2b was shown to express exclusively in the seed (Lizong page 267, paragraph 2). The location of the ZmClo2b gene in the maize genome was also known (Lizong table 1), so the native 2 kilobase sequence immediately upstream of the translation initiation site (instant claim 5) was known. Jia teaches a mutant in which expression of the ZmCLO2b gene was eliminated although the gene itself was not deleted (Jia et al (2016) G3 Genes|Genomes|Genetics. 6(8): 2385-2395; published 8/1/2016; hereafter, Jia. page 2389, right column, paragraph 2). Jia suggests that the causative mutation may be found in the intergenic regions close to ZmCLO2b, but does not describe those regions, their features, or their promoter ability. Chen et al CN104651358 A (published 5/27/2015, hereafter Chen) teaches an embryo-specific promoter with a sequence with 99.9% sequence identity to instant SEQ ID NO: 1 (Chen SEQ ID NO: 1, see alignment below). Chen also teaches truncated promoter fragments that retain function of initiating gene expression but tissue specificity was altered (paragraph [0019-0020]). The shortest functional truncated sequence taught by Chen is 182bp long (paragraph [0130], Chen SEQ ID NO: 2), which is longer than the 100bp required by the instant specification for a fragment. ZmClo2b is known as a promoter with seed-specific expression in maize, and fragments as short as 182bp were known to function as a promoter. The structural features contributing to the promoter activity of the ZmClo2b promoter are not described, nor any functional fragments of the promoter comprising as few as 100 nucleotides. The instant specification fails to make up for the lack of knowledge in the art. Because there is no description in the specification of how the structure of SEQ ID NO: 1 relates to the structure of the encompassed functional fragments, one of skill in the art would not recognize that Applicant was in possession of the necessary common attributes or features of the genus in view of the disclosed species. Hence, Applicant has not, in fact, described promoters of php20719a (clo2b) or functional fragments thereof over the full scope of the claims, and the specification fails to provide an adequate written description of the claimed invention. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 1-3, 5, 6, 8-10, 12-15, & 19-20 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Chen et al CN104651358 A (published 5/27/2015, hereafter Chen; uploaded with English machine translation of the Description appended). Claims 1-3, 5, 6, 8-10, 12-15, & 19-20 are drawn to a construct comprising a promoter operably linked to a transgene wherein the promoter is the promoter of a php20719a maize gene, vectors, and maize plants comprising said construct, and a method for driving expression of a transgene in a maize plant comprising introducing the construct into a maize plant. It is unclear if “portions or fragments thereof” (claim 1, line 3) refers to portions or fragments of the maize genes or portions or fragments of the promoters of maize genes. For this rejection, the claim has been interpreted to encompass portions or fragments of the promoter. Chen discloses a maize gene Zm85502 with a promoter sequence (Chen SEQ ID NO: 1) that has 99.9% sequence identity to instant SEQ ID NO: 1. See alignment below. Chen SEQ ID NO: 1 is missing a single nucleotide at the 3’ end relative to instant SEQ ID NO: 1. BCK96993 ID BCK96993 standard; DNA; 2000 BP. XX AC BCK96993; XX DT 10-MAR-2016 (first entry) XX DE Maize Zm85502 gene promoter, SEQ ID 1. XX KW Zm85502 gene; crop improvement; ds; promoter; seed; transgenic plant. XX OS Zea mays. XX CC PN CN104651358-A. XX CC PD 27-MAY-2015. XX CC PF 24-NOV-2014; 2014CN-10682994. XX PR 24-NOV-2014; 2014CN-10682994. XX CC PA (CHAG-) CHINESE ACAD AGRIC SCI BIOTECHNOLOGY RES. XX CC PI Chen R, Fan Y, Li Y, Tian J, Wang L, Zhao J, Zhou X, Liu X; XX DR WPI; 2015-45670T/73. XX CC PT Tissue specific promoter for increasing crop seed quality and new CC PT varieties of transgenic plants with modified or cultivated plant traits CC PT comprises nucleobases given in specification. XX CC PS Claim 1; SEQ ID NO 1; 29pp; Chinese. XX CC The present invention relates to a novel tissue specific promoter of SEQ CC ID NO: 1 (see BCK96993) useful for increasing crop seed quality and new CC varieties of transgenic plants with modified or cultivated plant traits. CC The complementary sequence of the promoter is capable of hybridizing CC under stringent conditions, where the polynucleotide shows tissue CC specific promoter function. The polynucleotide sequence shows homology of CC 60\% or more, preferably 80\% or more and more preferably 90\% or more. The CC variants are obtained by deleting, substituting or inserting one or more CC bases and the polynucleotide variant of SEQ ID NO: 2 (see BCK96994) and CC the polynucleotide variants still has a tissue-specific promoter CC function. The invention also provides an expression vector comprising the CC recombinant plant-specific promoter or promoter deletion fragments. The CC present sequence is a maize Zm85502 gene promoter, which is used in the CC invention for constructing the transgenic plant of the invention with CC modified or cultivated plant traits. XX SQ Sequence 2000 BP; 674 A; 376 C; 295 G; 655 T; 0 U; 0 Other; Query Match 99.9%; Score 1955; Length 2000; Best Local Similarity 100.0%; Matches 1955; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGGCTATGTCCAGTAACGCTATCTCTATCATCTCTCCAATCATATCATTTATCCTATTTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 45 AGGCTATGTCCAGTAACGCTATCTCTATCATCTCTCCAATCATATCATTTATCCTATTTT 104 Qy 61 TTATTTTAAATTTATCATCTATATATTTTTACACGATCATATAAACATTATAATGAAACG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 105 TTATTTTAAATTTATCATCTATATATTTTTACACGATCATATAAACATTATAATGAAACG 164 Qy 121 TATAGAAAAAAGAATTTTAGTCACTATATATAAAAACACAGATATGAAGATATTAACCTC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 165 TATAGAAAAAAGAATTTTAGTCACTATATATAAAAACACAGATATGAAGATATTAACCTC 224 Qy 181 ATGTACTAGCAACTCCAAAAGGCTCTATATATTCTTCCTAATCTATATAAATATATTTTT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 225 ATGTACTAGCAACTCCAAAAGGCTCTATATATTCTTCCTAATCTATATAAATATATTTTT 284 Qy 241 TAAAATATATATATATATATCTTTCAATAACTTATCTAAATGACTATCCATAAATATAGA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 285 TAAAATATATATATATATATCTTTCAATAACTTATCTAAATGACTATCCATAAATATAGA 344 Qy 301 CATCTTATATTTTAGGTTTCTCGCTATTCAAATATAGAAAACATGAATGATTCTTAGAAT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 345 CATCTTATATTTTAGGTTTCTCGCTATTCAAATATAGAAAACATGAATGATTCTTAGAAT 404 Qy 361 ACAAACAAGATATAGACTGTTAGAGATTAAAAAGATGTAGAAAATGGTTTTTATACAAAT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 405 ACAAACAAGATATAGACTGTTAGAGATTAAAAAGATGTAGAAAATGGTTTTTATACAAAT 464 Qy 421 AATTATTTAAATAATGATTAAATGATAACTTAAAGAGTGAAATTTAGAATGACTCAAGAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 465 AATTATTTAAATAATGATTAAATGATAACTTAAAGAGTGAAATTTAGAATGACTCAAGAC 524 Qy 481 GTTCTAAATTTAGGTTCTCTCCTCTCTGTATCGACGAAATTTTGGCTTTTGTTCTTTCTC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 525 GTTCTAAATTTAGGTTCTCTCCTCTCTGTATCGACGAAATTTTGGCTTTTGTTCTTTCTC 584 Qy 541 TCTACCTTGGCCGCGTTCGCACGTGCTCGCTGCCCTAGATGATTTTTTTTTGTTTGTGAC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 585 TCTACCTTGGCCGCGTTCGCACGTGCTCGCTGCCCTAGATGATTTTTTTTTGTTTGTGAC 644 Qy 601 ATGATTAAGGGCTTGAGGATTAGTATGGATTGGAAATTATTTTGGTTTACTAAAAGTATC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 645 ATGATTAAGGGCTTGAGGATTAGTATGGATTGGAAATTATTTTGGTTTACTAAAAGTATC 704 Qy 661 TTAAGAGACTCTTTATTTTTAACTCTCAATTTAACTCTTTATTTGTTTATTTCTCTATAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 705 TTAAGAGACTCTTTATTTTTAACTCTCAATTTAACTCTTTATTTGTTTATTTCTCTATAA 764 Qy 721 ATATTAAAATTTATATATAACATCTCATTACAACAGACTCTCTAACATACAAGTTAACTT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 765 ATATTAAAATTTATATATAACATCTCATTACAACAGACTCTCTAACATACAAGTTAACTT 824 Qy 781 GGCCAGCGAGAGTTGCTAGCTAAATTTGGTTAGTGAGAAAGTTAATTTATAGAACCAGAT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 825 GGCCAGCGAGAGTTGCTAGCTAAATTTGGTTAGTGAGAAAGTTAATTTATAGAACCAGAT 884 Qy 841 AACTTAGAAAGTTAAATGACTAGTCTGTTGAAGAGCTATTATGTTATTAAGTGGCTAAAA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 885 AACTTAGAAAGTTAAATGACTAGTCTGTTGAAGAGCTATTATGTTATTAAGTGGCTAAAA 944 Qy 901 TTTAGTTTGACAAACTATTTAACTAGTTTATTGGAGATACTCTAAAGATTTAAAGTCATC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 945 TTTAGTTTGACAAACTATTTAACTAGTTTATTGGAGATACTCTAAAGATTTAAAGTCATC 1004 Qy 961 CGATCTCTAACGATCCCATGAATTAAGATTCTAAAGGGTCTAGGTGTCGATACCATCCGT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1005 CGATCTCTAACGATCCCATGAATTAAGATTCTAAAGGGTCTAGGTGTCGATACCATCCGT 1064 Qy 1021 ATTCAGGCGTCCGTTGAAAATAGTCTTACAGCTAGGGTTGGATATCGAGTAAATTTGACT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1065 ATTCAGGCGTCCGTTGAAAATAGTCTTACAGCTAGGGTTGGATATCGAGTAAATTTGACT 1124 Qy 1081 CGCCTCGTCCGAGTTTAAACTGGCTCGTTAAACTAACGAACCACATAGTCAGCTTGACTC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1125 CGCCTCGTCCGAGTTTAAACTGGCTCGTTAAACTAACGAACCACATAGTCAGCTTGACTC 1184 Qy 1141 GACTCATTTACTAGCTCGTTTAGGTTGCGATCCTAAGTAAAAAAACAATATGTATATAAA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1185 GACTCATTTACTAGCTCGTTTAGGTTGCGATCCTAAGTAAAAAAACAATATGTATATAAA 1244 Qy 1201 ATAATCCATTTCTAGTTAATTTTAACTAATCTAATAATATAAAAATTATGCTTATACCCA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1245 ATAATCCATTTCTAGTTAATTTTAACTAATCTAATAATATAAAAATTATGCTTATACCCA 1304 Qy 1261 TAGTTTCACATACCACATCAATGTAACATTAAACTGATACAATTCATCACTTGTCAATTT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1305 TAGTTTCACATACCACATCAATGTAACATTAAACTGATACAATTCATCACTTGTCAATTT 1364 Qy 1321 ACAATTTATAATTCACATATATATTCGTCAGTTTAATAATAGTTATATTCGTATAGACCA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1365 ACAATTTATAATTCACATATATATTCGTCAGTTTAATAATAGTTATATTCGTATAGACCA 1424 Qy 1381 ATTTAACATGTAGACATAGTTCATCAATAATTAGTTTAACTCATGAGTAATAAACACTAC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1425 ATTTAACATGTAGACATAGTTCATCAATAATTAGTTTAACTCATGAGTAATAAACACTAC 1484 Qy 1441 ACATAAATATAACATATTCATCAATTATTACTATATCAATTATTACTATATATATATATA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1485 ACATAAATATAACATATTCATCAATTATTACTATATCAATTATTACTATATATATATATA 1544 Qy 1501 GTTTTGTTTTGCTAAAATATAATACCTCCTTGTTTAGCTCACAAAATAGCTCCTTACAAA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1545 GTTTTGTTTTGCTAAAATATAATACCTCCTTGTTTAGCTCACAAAATAGCTCCTTACAAA 1604 Qy 1561 CCAAGCTTGAATATCAGTTTAACTTATAAAAAAATTCAACGAGTCAGAGTTAAATTGAGC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1605 CCAAGCTTGAATATCAGTTTAACTTATAAAAAAATTCAACGAGTCAGAGTTAAATTGAGC 1664 Qy 1621 TCACGAGCATTTCGTTCTGTCTACTTCTACCATCAAGCACCAAAACCAGCGGAGCGGGCC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1665 TCACGAGCATTTCGTTCTGTCTACTTCTACCATCAAGCACCAAAACCAGCGGAGCGGGCC 1724 Qy 1681 GGACGAGGGACGACAAGAAACCATTTCTGGTACGGCTCGCGACACGTTACAGCCTAGCAG 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1725 GGACGAGGGACGACAAGAAACCATTTCTGGTACGGCTCGCGACACGTTACAGCCTAGCAG 1784 Qy 1741 GGACGGCCGCCATGCACGCGCCCACGTCGCGTCCGCTGACGCGCCACGTCCCGCGCCACC 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1785 GGACGGCCGCCATGCACGCGCCCACGTCGCGTCCGCTGACGCGCCACGTCCCGCGCCACC 1844 Qy 1801 GCCGAGCCGCTTTATATATCTGTACTACACCGCAGCCGGCGCAGCGGAATACACGCCAGA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1845 GCCGAGCCGCTTTATATATCTGTACTACACCGCAGCCGGCGCAGCGGAATACACGCCAGA 1904 Qy 1861 AACTAATCCAGATAGCTAGCCTTTGATTTCTCACTTCAATCTGACGAAGTGCACACCTAG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1905 AACTAATCCAGATAGCTAGCCTTTGATTTCTCACTTCAATCTGACGAAGTGCACACCTAG 1964 Qy 1921 GCAACAAACTCGAACGCGCGCGGTAGTGGAGCCGA 1955 ||||||||||||||||||||||||||||||||||| Db 1965 GCAACAAACTCGAACGCGCGCGGTAGTGGAGCCGA 1999 Chen discloses that a GUS reporter gene driven by Chen SEQ ID NO: 1 is specifically expressed only in the embryo of corn seeds (paragraph [0018], figure 7). Chen discloses a pCAMBIA3301 vector comprising the promoter and truncated promoter fragments of different lengths, some of which were shown to have promoter function (paragraph [0129-0137], figure 9). This vector comprising an embryo-specific promoter that comprises a fragment comprising all but one nucleotide of instant SEQ ID NO: 1 linked to a GUS reporter gene reads on instant claims 1, 2, 5, 6 & 8. Chen discloses another vector, p85502G3, comprising the promoter of Chen SEQ ID NO: 1 and a reporter gene GUS (figure 5, paragraph [0111]), introduced into maize embryos by gene gun bombardment to have high intensity expression in embryos (paragraphs [0112-0114]). This method is described as a transient expression system and the expression specifically only in the embryo of the corn seeds (paragraph [0018]). This reads on a method for driving expression of a transgene in a maize plant wherein the construct comprising a fragment of a clo2b promoter is maintained as extrachromosomal DNA and the expression is embryo-specific (instant claims 9 & 13-15), because Chen SEQ ID NO: 1 comprises a sequence of at least 100 nucleotides of the clo2b promoter of instant SEQ ID NO: 1. Chen also discloses a stable transformation of maize using the vector p85502G3 transformed into maize with Agrobacterium mediated transfection (paragraphs [0115-0125]), which reads on instant claims 9, 10 & 12 and the maize plants themselves of instant claims 19-20. The vector used for Agrobacterium transformation reads on an Agrobacterium vector (instant claim 3). Chen discloses a motivation to use tissue-specific promoters to drive expression of target genes to achieve molecular improvement of maize and the production of maize varieties with special uses (paragraph [0007]). Claims 1-3, 5, 6, 8-10, 12-15, & 19-20 are anticipated by Chen. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim(s) 1-3, 5-10, 12-15, & 19-20 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al CN104651358 A (published 5/27/2015, hereafter Chen) in view of Gordon Kamm et al (1990) The Plant Cell. 2: 603-618 (published 7/1/1990, hereafter Gordon Kamm). Claims 1-3, 5, 6, 8-10, 12-15, & 19-20 are summarized above. Claim 7 is drawn to the construct wherein the transgene encodes a protein that confers resistance to an infection, insect or herbicide. The teachings of Chen are presented above. In addition, Chen envisions the tissue-specific promoter operably linked to a marker sequence that provides herbicide resistance such as a hygromycin or glufosinate resistance gene, in order to determine the activity of the marker sequence (paragraph [0049]). Chen does not teach that the herbicide resistance gene encodes a protein. Gordon Kamm teaches a vector encoding a bar gene as a selectable marker for the identification of transformed maize cells (page 615, left column, paragraph 1-right column, paragraph 1, figure 11). The herbicide used by Gordon Kamm for selection comprised glufosinate (page 616, left column, paragraph 3). Before the filing date of the instant application, it would have been obvious to one of ordinary skill in the art to modify the construct taught by Chen to incorporate a glufosinate resistance gene encoding a protein taught by Gordon Kamm. One of ordinary skill in the art would have been motivated to use a glufosinate herbicide resistance gene in order to determine activity of the marker sequence, as taught by Chen. One of ordinary skill in the art would have had a reasonable expectation of success using the Gordon Kamm glufosinate resistance gene because both methods involved maize transformation. Thus, instant claims 1-3, 5-10, 12-15, & 19-20 are obvious over Chen in view of Gordon Kamm. Claim(s) 1-6, 8-15, & 19-20 are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al CN104651358 A (published 5/27/2015, hereafter Chen) in view of Chen et al (2022) Plant Physiology. 188: 1780–1794 (available 2/2/2022, hereafter Chen 2022). Claim 4 is drawn to a construct that is a DNA donor template for CRISPR-mediated homology-directed repair. Claim 11 is drawn to a method for driving expression of a transgene comprising introducing a construct via CRISPR-mediated homology directed repair. The teachings of Chen are presented above. Chen does not teach CRISPR-mediated homology directed repair or that the construct comprising the promoter is a DNA donor template. Chen 2022 teaches that homology directed repair enables installation of mutations and fragments in a predefined manner in organisms and can enable introduction of favorable alleles without introducing undesirable genes or traits (page 1781, right column, paragraph 1). Chen 2022 teaches that homology directed repair has been used to generate herbicide resistant maize or to increase grain yield by replacing a native ARGOS8 promoter with a GOS2 promoter (page 1784, left column, paragraph 1). Cas9 can be used for homology-directed repair methods by inducing double stranded breaks, and a donor template with homology to the target sequence can be inserted to the target site (figure 1). Before the time of filing of the instant application, it would have been obvious to one of ordinary skill in the art to modify the invention of Chen to use CRISPR-mediated homology directed repair rather than undirected transgene insertion. One of ordinary skill in the art would have been motivated to use CRISPR-mediated homology directed repair because the installation of the construct comprising a php20719a promoter would not introduce undesirable genes or traits. One of ordinary skill in the art would have had reasonable expectation of success, because CRISPR-mediated homology directed repair had successfully been used in maize previously. Thus, a method for driving expression of a transgene in a maize plant comprising introducing via CRISPR-mediated homology-directed repair would be obvious over Chen and Chen 2022 (instant claim 11), and in such a method the construct being a DNA donor template (instant claim 4) would also be obvious. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-Th 7:30am-5pm EST; F 7:30am-12pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Shubo (Joe) Zhou can be reached at (571) 272-0724. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /VICTORIA L DELEO/Examiner, Art Unit 1662 /Anne Kubelik/Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Sep 22, 2023
Application Filed
Aug 07, 2025
Non-Final Rejection — §101, §102, §103
Apr 08, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584117
Use of Gene Encoding Gibberellin 3Beta-Hydroxylase of Glycine Max, GmGA3ox1
2y 5m to grant Granted Mar 24, 2026
Patent 12577577
COMPOSITIONS AND METHODS TO INCREASE RESISTANCE TO PHYTOPHTHORA SOJAE IN SOYBEAN
2y 5m to grant Granted Mar 17, 2026
Patent 12545926
NUCLEIC ACID MOLECULES FOR CONFERRING INSECTICIDAL PROPERTIES IN PLANTS
2y 5m to grant Granted Feb 10, 2026
Patent 12522839
USE OF ZLMYB1 AND ZLMYB2 GENES FROM ZIZANIA LATIFOLIA IN INCREASING ANTHOCYANIDIN CONTENT OF RICE SEED
2y 5m to grant Granted Jan 13, 2026
Patent 12460220
METHOD FOR PROMOTING EXPRESSION OF FOREIGN GENE IN SOYBEAN, ARABIDOPSIS OR TOBACCO USING GENE PROMOTER pEIF1 OR pEIF1-I
2y 5m to grant Granted Nov 04, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
38%
Grant Probability
-2%
With Interview (-40.0%)
2y 4m
Median Time to Grant
Low
PTA Risk
Based on 21 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in for Full Analysis

Enter your email to receive a magic link. No password needed.

Free tier: 3 strategy analyses per month