DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Information Disclosure Statement
No IDS has been filed to date of the instant Office communication.
Drawings
The replacement drawings received on December 15, 2023 are objected to for failing to comply with the Sequence Rules. Specifically, Figure 2 discloses a nucleotide sequence of greater than 10 specific contiguous bases without a corresponding SEQ ID Number, nor in the Brief Description of Drawings.
Applicants must comply with this requirement for their reply to be considered fully responsive.
Claim Objections
Claim 51 is objected to under 37 CFR 1.75(c) as being in improper form because a multiple dependent claim cannot depend from another multiple dependent claim. See MPEP § 608.01(n). Accordingly, the claim 51 has not been further treated on the merits.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 48-50 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a New Matter Rejection.
Claim 48 is a newly submitted claim filed subsequent to the filing of the instant application.
PNG
media_image1.png
161
964
media_image1.png
Greyscale
Claim 48 recites the below limitation:
The application as filed does not contain a proper support for a primer comprising the bases of SEQ ID Number 10 followed by the sequence rD DDDMx.
The specification discloses that rD DDDMx is a blocking group and it is comprised by a gen1 primer:
“The gen1 primer comprises the following blocking group rDDDDMx.
However, the specification does not provide what such a “gen1 primer” is. The specification only provides a single description of this primer in Figure 11, wherein the specific sequence comprises the nucleotide sequence of SEQ ID Number 2, with a spacer on it’s 3’ end, i.e., single species.
In addition, application as originally filed also evidence that this was the only species the application contemplated:
PNG
media_image2.png
341
895
media_image2.png
Greyscale
Noe the claims as originally filed claims a blocked primer having the entirety of SEQ ID NO: 2, and a blocking group, wherein said blocking group is rDDDDMx. This would support for a sequence that comprises the entirety of SEQ ID NO: 2 and has the rDDDDMx region additionally. This does not, however, support for the present claim where rDDDDMx substitutes a portion of SEQ ID NO: 2.
For these reasons, the claim 48 introduces new matter. Claims 49 and 50 introduce new matter by of their dependency on claim 48.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 10, 38-44, and 52 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 10 recites the phrase, “a specialized dNTP that is recognized by the enzyme of (i)”. The enzyme of (i) is that which binds to uracil in a DNA strand and converts it into an apurinic site, which embraces a UDG (uracil DNA glycosylase), that simply acts on a dUTP. A dUTP is not a “specialized” dNTP. Therefore, it is unclear what metes and bounds surround the term, “specialized dNTP.”
Claim 38 is indefinite for containing a “+” in the middle of a nucleotide sequence without properly defining what that symbol is. For the purpose of prosecution, the symbol has been ignored1.
Claims 38 and 52 are indefinite because it is unclear whether or not all of the 90% homolog to the recited SEQ ID number embraces the required RNA base. For the purpose prosecution, all of homologs must comprise the recited RNA base.
Claims 39-41 are indefinite by way of its dependency on claim 38.
Claim 42 is indefinite because the claim is directed to a “fluorescent hybridization probe” but does not actively contain any fluorescent labels. Because natural nucleotide bases have intrinsic fluorescence2, there is a confusion in whether the present claim captures a naturally occurring sequence of bases or that which has a fluorescent moiety attached to the probe.
For the purpose of prosecution, the claim has been construed to be directed to naturally occurring bases with intrinsic fluorescence.
Claims 43 and 44 are indefinite by way of their dependency on claim 38 or 42.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 10 and 42-44 are rejected under 35 U.S.C. 101 because the claimed invention is directed to the judicial exception of naturally occurring product without significantly more. The claims recite a composition of naturally occurring elements (i.e., claim 10); and a composition comprising a nucleic acid sequence having a sequence portion found in nature (claims 42-44). This judicial exception is not integrated into a practical application because a combination of judicial exception does not make itself patent eligible.
The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception based on the analysis under the current Patent Eligibility Guidelines (herein, “PEG”) as discussed below.
Step 1 Inquiry under PEG
Step 1 inquiry under Patent Eligibility Guidelines (herein, “PEG”) determines whether or not the claimed invention is drawn to one of the recognized statutory classes of invention. Claims 10 and 42-44 satisfy the present inquiry as being drawn to a product, that is, a composition.
Step 2A Inquiry under PEG
A recently revised PEG now performs step 2A inquiry under a 2-prong analysis, and the subject claims analyzed accordingly as follows:
Prong 1:
Prong-1 inquiry under step 2A determines whether the claim(s) recites an abstract idea, a law of nature, or a natural phenomenon. As stated above, the claim 10 recites a combination of enzymes (i) and (ii) which exits in nature; and embraces a dUTP substrate which also exist in nature.
Claims 42-44 recite a nucleic acid sequence which is found in a portion of a naturally occurring sequence.
Claim 42 recites a nucleic acid sequence having the sequence of SEQ ID NO: 7, as shown below, having a 100% identity to a sequence found in nature3:
SEQ ID NO: 7 1 CCGAAGGCACTCCCGCAT 18
||||||||||||||||||
GenBank PX518757 416 CCGAAGGCACTCCCGCAT 399
And as stated above4, natural bases have an intrinsic fluorescence and therefore, the nucleic acid sequence of SEQ ID NO: 7 is found in a portion of a naturally occurring sequence.
Therefore, claim recites a judicial exception.
Prong 2:
Prong-2 inquiry under step 2A determines whether or not the claims recite additional elements that integrate the judicial exception into a practical application in a manner that imposes a meaningful limit on the judicial exception.
Claim 10 does not actively recite additional elements other than the list of naturally occurring products in a combination.
To this end, it has long been settled that a combination of judicial exceptions does not render that combination patent eligible.
In Ambry, the court held that a primer pair direct to an otherwise naturally existing gene were not patent eligible:
“The primer before us are not distinguishable from the isolated DNA found patent-ineligible in Myriad and are not similar to the cDNA found to be patent-eligible” (page 7)
The court found that the primers were not patent eligible because they contained the “identical sequence of the BRCA sequence directly opposite to the strand to which they are designed to bind” and that they were structurally identical to the ends of DNA strands found in nature” (page 7).
For example, in Ambry (citation omitted), one of the patents under suit was U.S. Patent 5,747,282, with specific claims 16 and 17:
PNG
media_image3.png
507
691
media_image3.png
Greyscale
Claims 16 and 17 of the ‘282 patent was drawn to a pair of primers (see reproduced claim 16):
PNG
media_image4.png
245
812
media_image4.png
Greyscale
Upon consideration of these pair of primers, the court stated the below:
PNG
media_image5.png
200
647
media_image5.png
Greyscale
Also in Myriad (citation omitted), the court stated, “neither naturally occurring compositions of matter, nor synthetically created compositions that are structurally identical to the naturally occurring compositions, are patent eligible” (Id. At 2117)
Based on the precedence discussed above, the claimed composition comprising a combination of naturally existing enzymes and substrate, while presented as a collection or combination, is nevertheless “not distinguishable” from the naturally exiting molecules and therefore, are deemed patent eligible.
As explained by the Supreme Court, in order to transform a judicial exception into a patent-eligible application, the additional element or combination of elements must do ‘more than simply stat[e] the [judicial exception] while adding the words ‘apply it’”. Alice Corp. v. CLS Bank, 573 U.S. __, 134 S. Ct. 2347, 2357, 110 USPQ2d 1976, 1982-83 (2014) (quoting Mayo Collaborative Servs. V. Prometheus Labs., Inc., 566 U.S. 66, 72, 101 USPQ2d 1961, 1965). Thus, for example, claims that amount to nothing more than an instruction to apply the abstract idea using a generic computer do not render an abstract idea eligible. Alice Corp., 134 S. Ct. at 2358, 110 USPQ2d at 1983. See also 134 S. Ct. at 2389, 110 USPQ2d at 1984 (warning against a § 101 analysis that turns on “the draftsman’s art”) (MPEP 2106.05(f))
Claim 42 recites an additional feature of the SEQ ID NO: 7 being in the form of a “probe.” However, this does not significantly add more to the base sequence as probe functions by complementarity base pairing which is inherent to the base sequence itself.
Claims 43 and 44 add an additional element to the probe of claim 42 by form of said probe being a composition together with generically recited “one or more primers for target nucleic acid amplification.”
However, a primer embraces a nucleic acid sequence that is found in a portion of a naturally occurring sequence (i.e., target), which is deemed a judicial exception.
As discussed above, combination of judicial exceptions in a composition do not result in a patent eligible exception.
Step 2B Inquiry under PEG
Step 2B inquiry of the PEG determines whether or not additional elements are provided and whether such elements amount to significantly more than the judicial exception in the claims.
As stated above, the claims do not recite any additional elements other than that each of the judicial exceptions is comprised in together a composition. This, however, does not amount to significantly more as discussed above.
Therefore, the present claims lack patent eligibility.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim 10 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Stein et al. (Nucleic Acids Research 2009, vol. 37, no. 18, e122, pages 1-9).
Stein et al. teach a composition comprising:
an enzyme that binds uracil in a DNA strand and converts it into an apurinic site;
an enzyme that cleaves DNA at apurinic sites (“USER Enzyme is a commercially available enzyme mixture composed of uracil DNA glycosylase and endonuclease VIII … the two enzymes excise uracil nucleotides from DNA”, page 3, 2nd column, 3rd paragraph); and
a specialized dNTP that is recognized by the enzyme of (i) (see Figure 1, “primers that specifically incorporate uracil nucleotides”).
Therefore, the invention as claimed is anticipated by Stein et al.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 42-44 are rejected under 35 U.S.C. 103 as being unpatentable over Cho et al. (KR 2013 0046324A, published May 2013).
With regard to claim 42, Cho et al. teach a probe for detecting Cronobacter sakazakii, said probe being CS_103, having the below sequence:
5’-GATGCGGGAGTGCCTTCGGGAACTC-3’
This sequence shows a homology to instant SEQ ID NO: 7
5’– CCGAAGGCACTCCCGCAT – 3’
||||||||||||||||||
3’ – CTCAAGGGCTTCCGTGAGGGCGTAG – 5’
As seen, Cho et al. evidence that the region of the Cronobacter sakazakii being targeted is the same as that of instant SEQ ID NO: 7 as the probe of Cho et al. is targeting the complementary strand to which Applicants’ SEQ ID NO: 7 binds.
Cho et al. teach target specific primers (section [0024], PCR primers 8F, 1329R, 23F, 1429R).
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to take the teachings of Cho et al., with conventional knowledge in the molecular diagnostics, thereby arriving at the invention as claimed for the following reasons.
The rationale of obviousness is based on KSR, wherein the Supreme Court particularly emphasized “the need for caution in granting a patent based on the combination of elements found in the prior art,” Id. at 415, 82 USPQ2d at 1395, and discussed circumstances in which a patent might be determined to be obvious. Importantly, the Supreme Court reaffirmed principles based on its precedent that “[t]he combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results.” Id. at 415-16, 82 USPQ2d at 1395. The Supreme Court stated that there are “[t]hree cases decided after Graham [that] illustrate this doctrine.” Id. at 416, 82 USPQ2d at 1395. (1) “In United States v. Adams, . . . [t]he Court recognized that when a patent claims a structure already known in the prior art that is altered by the mere substitution of one element for another known in the field, the combination must do more than yield a predictable result.”
As demonstrated above, Cho et al. already teach a region on Cronobacter sequence that has been demonstrated to be useful for its detection. While the artisans do not explicitly teach SEQ ID NO: 7, the probe disclosed by Cho et al. anneals to the complementary sequence to which SEQ ID NO: 7 in its entirety. Therefore, one of ordinary skill in the art would have recognized that a probe directed to either of the complementary sequence of Cronobacter would have been useful for detection, yielding no more than a predictable outcome.
As well, designing and combining primers which amplify the flanking region to which the probe anneals would have also been an obvious step to take as such practice has been routinely performed in the art of molecular diagnostics, such as real-time PCR, PCR/hybridization, etc.
Therefore, the combination of such reagents into a single composition would have been an obvious combination to the probe taught by Cho et al., yielding no more than a predictable outcome.
Therefore, the invention as claimed is deemed prima facie obvious over the cited references.
Conclusion
Claims 38-41, 45-50, 52, and 53 are free of prior art. The prior art does not each or suggest for the claimed sequences of recited SEQ ID numbers having a ribonucleotide base at the specifically claimed position, or a sequence with fluorinated residues and phosphorothioate linkages at the claimed regions.
Claims 45-47 and 53 are allowable.
Inquiries
Any inquiry concerning this communication or earlier communications from the Examiner should be directed to Young J. Kim whose telephone number is (571) 272-0785. The Examiner can best be reached from 7:30 a.m. to 4:00 p.m (M-F). The Examiner can also be reached via e-mail to Young.Kim@uspto.gov. However, the office cannot guarantee security through the e-mail system nor should official papers be transmitted through this route.
If attempts to reach the Examiner by telephone are unsuccessful, the Examiner's supervisor, Gary Benzion, can be reached at (571) 272-0782.
Papers related to this application may be submitted to Art Unit 1681 by facsimile transmission. The faxing of such papers must conform with the notice published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 CFR 1.6(d)). NOTE: If applicant does submit a paper by FAX, the original copy should be retained by applicant or applicant’s representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED, so as to avoid the processing of duplicate papers in the Office. All official documents must be sent to the Official Tech Center Fax number: (571) 273-8300. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (571) 272-1600.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/YOUNG J KIM/Primary Examiner
Art Unit 1637 January 30, 2026
/YJK/
1 Although specification section [0141] state that “+” denotes for a locked nucleic acid sequence thereafter, the specification does not specifically define this as a rule and the limitation of specification has not been “read” into the claim.
2 See Wikipedia, Intrinsic DNA fluorescence, on-line: https://en.wikipedia.org/wiki/Intrinsic_DNA_fluorescence, attached herein.
3 16S rRNA gene from Faucicola sp. Strain Bac017.
4 See 112b rejection.