DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election of Group 1, claims 1-19, in the reply filed on 17 March 2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claim 20 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 17 March 2026.
Information Disclosure Statement
The information disclosure statements (IDS) filed 29 September 2023 and 29 January 2026 are considered, initialed, and attached hereto.
The listing of references in the specification ([0003]) is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Claim Status
Claims 1-20 are pending.
Claims 1-19 are under examination.
Claim 20 is withdrawn.
Nucleotide and/or Amino Acid Sequence Disclosures
Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures
37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted:
1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying:
a. the name of the XML file
b. the date of creation; and
c. the size of the XML file in bytes; or
2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying:
a. the name of the XML file;
b. the date of creation; and
c. the size of the XML file in bytes.
SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS:
Specific deficiency - This application fails to comply with the requirements of 37 CFR 1.831-1.834 because it does not contain a “Sequence Listing XML” as a separate part of the disclosure. A “Sequence Listing XML” is required because specifically defined and enumerated sequences requiring sequence listing are present on pages 20-21 of instant specification, labeled ‘Sequence Number #’.
Required response - Applicant must provide:
• A “Sequence Listing XML” part of the disclosure, as described above in item 1. or 2.; together with
o A statement that indicates the basis for the amendment, with specific references to particular parts of the application as originally filed, as required by 37 CFR 1.835(a)(3);
o A statement that the “Sequence Listing XML” includes no new matter as required by 37 CFR 1.835(a)(4)
AND
• A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation by reference paragraph as required by 37 CFR 1.835(a)(2), consisting of:
o A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
o A copy of the amended specification without markings (clean version); and
o A statement that the substitute specification contains no new matter.
Specification
The use of the term IDT, DNaseAlert, New England Biolabs, NEB, Fujifilm, Qubit, AnaSpec, HiLyte, MBL, Violamo, Toyobo, Thermo Fisher Scientific, NEBuffer, Synergy, BioTek, Merck, JSR, Eppendorf, and Quanterix, which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 112(b) - Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 2-4, 12, 15, and 17 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 2 recites the limitation "the complex to which a target nucleic acid is bound" in lines 4-5. There is insufficient antecedent basis for this limitation in the claim, as the complex recited in claim 1 line 3 and line 5 is not recited as having a target nucleic acid bound to it. For the purpose of examination, this is interpreted as referring to the complex recited in claim 1 in a case where it is bound to a target nucleic acid. Claims 3-4 and 17 are also rejected based on their dependency on claim 2.
Claim 12 recites the limitation "a complex of nitrilotriacetic acid or iminodiacetic acid and a divalent nickel ion" in lines 2-3. This phrase is unclear because it could require (a) a complex of nitrilotriacetic acid or a complex of iminodiacetic acid and a divalent nickel ion, or (b) a complex of nitrilotriacetic acid and a divalent nickel ion or a complex of iminodiacetic acid and a divalent nickel ion. For the purpose of examination, the claim is interpreted as encompassing all possibilities encompassed by (a) or (b).
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1, 5-9, 11-15, and 18 are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Sasaki et al. (U.S. Patent 10,933,027, published 2 March 2021, effectively filed date 25 September 2017), herein Sasaki.
Regarding claim 1, Sasaki teaches a reagent comprising: complex particles, each including a particle and a complex bound to the particle; and an aqueous liquid in which the complex particles are dispersed, wherein the complex includes a Cas protein and a guide RNA bound to the Cas protein (“a first linking group attached to the nanoparticle […], a second linker group for attachment to the cargo […] The tested cargo included an RNP (e.g., a 6XHis-tagged Cas9 protein complexed with guide RNA” col 62 line 61 - col 63 line 2; “The composition can be formulated in any useful manner with a plurality of particles. Such formulations can be included with […] aqueous solution” col 57 lines 37-41; FIG. 9A; Example 6). Sasaki also teaches this reagent broadly (FIG. 10; col 24 lines 53-63, describing a cargo bound to a particle by a spacer having two reactive groups interacting with each other; “In any embodiment herein, the cargo can include a CRISPR component. Exemplary CRISPR components can include a guide RNA, a Cas enzyme” col 42 lines 58-60; “The composition can be formulated in any useful manner with a plurality of particles. Such formulations can be included with […] aqueous solution” col 57 lines 37-41).
Regarding claim 5, Sasaki teaches the reagent according to claim 1, wherein the complex particles each contain a carboxy group (“A spacer can include a coordination bond. In some instances, the coordination bond includes one or more functional groups that form a bond to a metal (e.g., a divalent metal). Exemplary functional groups include […] a carboxyl” col 32 lines 29-33; “In one instance, the reactive group is a cross-linker group. In another non-limiting instance, the reactive pair is a cross-linker reaction pair, which includes a first cross-linker group and a second cross-linker group that reacts with that first cross-linker group. Exemplary cross-linker groups and cross-linker reaction pairs include those for forming a covalent bond between a carboxyl group (e.g., —CO2H)” col 35 lines 11-17; “C-terminus of a protein” col 63 line 9, provides evidence that cargo proteins such as the Cas of claim 1 have a C-terminus, which is a carboxy group).
Regarding claim 6, Sasaki teaches the reagent according to claim 1, wherein the particles are bound to the complex at the amino terminus of the Cas protein (“As seen in FIG. 9A, MSNP cores were functionalized with a spacer (PEG-Ni-NTA disulfide linker) in order to attach a cargo (e.g., an RNP). The spacer included a reactive NTA group to bind to a nickel cation, which in turn couples to one or more polyhistidine tags (e.g., a polyhistidine tag having at least six histidine residues (6XHis) at the N- or C-terminus of a protein” col 63 lines 3-9, note MSNP is an abbreviation for mesoporous silica nanoparticles and Cas9 is the RNP that is cargo; FIG. 9A; Example 6).
Regarding claim 7, Sasaki teaches the reagent according to claim 1, wherein each of the particles and the complex are bound by an amide linkage (“In one instance, the reactive group is a cross-linker group. In another non-limiting instance, the reactive pair is a cross-linker reaction pair, which includes a first cross-linker group and a second cross-linker group that reacts with that first cross-linker group. Exemplary cross-linker groups and cross-linker reaction pairs include those for forming a covalent bond between a carboxyl group (e.g., —CO2H) and an amino group (e.g., —NH2)” col 35 lines 11-18, the bond between a carboxyl group and an amino group is an amide linkage).
Regarding claim 8, Sasaki teaches the reagent according to claim 1, wherein each of the particles and the complex are bound via a linker (FIGS. 9 and 10; col 24 lines 35-63; col 62 line 61 - col 63 line 2; Example 6).
Regarding claims 9 and 11-13, Sasaki teaches the reagent according to claim 8, wherein the linker includes a peptide formed by consecutive 6 to 11 histidine residues, the linker includes a metal complex that binds to the peptide, the metal complex is a complex of nitrilotriacetic acid (NTA) and a divalent nickel ion, and the linker includes polyethylene glycol (“The tested spacer included a first linking group attached to the nanoparticle (e.g., a poly(ethylene glycol) group, such as —(OCH2CH2)7— or PEG7), a second linker group for attachment to the cargo (e.g., a poly(ethylene glycol) group with a reactive group (NTA) and a nickel cation, such as —(OCH2CH2)7—NTA-Ni—), and a cleavable moiety disposed between the first and second linking groups (e.g., a —S—S— group). The tested cargo included an RNP (e.g., a 6XHis-tagged Cas9 protein complexed with guide RNA). As seen in FIG. 9A, MSNP cores were functionalized with a spacer (PEG-Ni-NTA disulfide linker) in order to attach a cargo (e.g., an RNP). The spacer included a reactive NTA group to bind to a nickel cation, which in turn couples to one or more polyhistidine tags (e.g., a polyhistidine tag having at least six histidine residues (6XHis)” col 62 line 61 - col 63 line 8; FIG. 9A; Example 6).
Regarding claim 14, Sasaki teaches the reagent according to claim 8, wherein the linker includes a complex of biotin and avidin (“In another instance, the reactive group is a binding group. […] Exemplary binding groups and binding reaction pairs include those for forming a bond between biotin and avidin” col 35 lines 57-62).
Regarding claim 15, Sasaki teaches the reagent according to claim 1, wherein the particles have a particle size of 1 µm to 10 µm (“In certain embodiments, nanoparticulates have an effective average particle size of less than about 2,000 nm” col 4 lines 56-57). Because there is no allegation of criticality of the claimed range, the range taught by Sasaki that overlaps the claimed range is considered to be disclosed with sufficient specificity to constitute anticipation (see MPEP §2131.03).
Regarding claim 18, Sasaki teaches the reagent according to claim 1, further comprising a blocking agent (“the particle can include one or more CRISPR components (e.g., associated with or within a pore of the core (e.g., by way of a spacer), associated with a surface of the core, and/or within the outer layer)” col 43 lines 5-8; “an outer layer can be provided on the external surface of the core. The outer layer can have any useful composition, e.g., a lipid, a polymer, or both. In one instance, the method includes providing 130 an outer layer 130, thereby forming an exemplary construct. The outer layer can be formed in any useful manner, e.g., by exposing the loaded core to a lipid formulation to form an outer lipid layer” col 29 lines 8-15; “In some instances, a reactive group can include a protecting group” col 33 lines 2-3; “Protecting groups can be employed to protect a reactive group and/or to provide reduced reactivity” col 37 lines 59-60). The outer layer taught by Sasaki is considered a blocking agent because it restricts the availability of the core, linkers, and cargo within it. The protecting group taught by Sasaki is considered a blocking agent because it reduces the reactivity of reactive groups of a particle that are not bound to a complex.
Therefore, claims 1, 5-9, 11-15, and 18 are anticipated by Sasaki.
Claims 1-4, 6, 8, 13-14, 17, and 19 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Watanabe et al. (US 2024/0094199, effectively filed date 28 December 2020), herein Watanabe.
Regarding claims 1 and 19, Watanabe teaches a reagent comprising: complex particles, each including a particle and a complex bound to the particle; and an aqueous liquid in which the complex particles are dispersed, wherein the complex includes a Cas protein and a guide RNA bound to the Cas protein (“A Cas13a protein immobilized on the surface of the particles was used to detect a target nucleic acid fragment. FIG. 24 is a schematic diagram showing a detection method of the present experimental example. As the particles, streptavidin-coated magnetic beads (product name “Dynabeads MyOne Streptavidin T1”, Veritas) were used. […] the biotinylated Cas13a protein and the gRNA (SEQ ID NO: 8) were mixed in a buffer F (20 mM HEPES-KOH (pH 6.8), 60 mM NaCl, 6 mM MgCl2, 50 μM Triton X-100) […], thereby forming a two-part complex. Subsequently, the two-part complex was diluted with the buffer F containing the substrate nucleic acid fragment and Alexa647-maleimide to obtain a mixture solution. […] Subsequently, 20 μL of the above mixture solution was mixed with 100 μL of a buffer E (20 mM HEPES-KOH (pH 7.5), 100 mM KCl, 10 mM MgCl2, 50 μM Triton X-100) containing the target nucleic acid fragment […] Subsequently, 20 μL of 0.5 mg/mL magnetic beads were further added and mixed” [0301-0304], note that the solutions containing a combination of HEPES-KOH, NaCl, MgCl2, Triton X-100, and KCl are aqueous solutions; Experimental Example 9; FIG. 21 and [0107]; FIG. 24).
Regarding claims 2-4 and 17, Watanabe teaches the reagent according to claim 1, further comprising a reporter molecule containing a nucleic acid having a specific nucleotide sequence, the reporter molecule emits luminescence that changes when the complex binds a target nucleic acid and cleaves the nucleic acid having a specific nucleotide sequence, wherein the reagent acts as a reagent for detecting the target nucleic acid (“a method for detecting a target nucleic acid fragment in a sample, including step (a) of contacting the sample with a gRNA complementary to the target nucleic acid fragment, a CRISPR/Cas family protein, and a substrate nucleic acid fragment […] the CRISPR/Cas family protein expresses nuclease activity after forming a three-part complex with the gRNA and the target nucleic acid fragment. In addition, the CRISPR/Cas family protein is immobilized on a solid phase. In addition, the substrate nucleic acid fragment is labeled with a fluorescent substance and a quencher, and in a case where the fluorescent substance cleaved by the nuclease activity of the three-part complex is separated from the quencher, fluorescent light is emitted by irradiation with excitation light” [0082-0083], the substrate nucleic acid is the reporter molecule and the emission of fluorescent light after being cleaved is an increase of intensity of the fluorescence emitted by the reporter compared to the intensity before cleavage , fluorescence is considered a type of luminescence; FIG. 1 and [0085-0090]).
Regarding claims 6, 8, and 13, Watanabe teaches the reagent according to claim 1, wherein the particles are bound to the complex at the amino terminus of the complex of the Cas protein and wherein each of the particles and the complex are bound via a linker wherein the linker includes polyethylene glycol (“FIG. 24 is a schematic diagram showing a detection method of the present experimental example. As the particles, streptavidin-coated magnetic beads (product name “Dynabeads MyOne Streptavidin T1”, Veritas) were used […] the N-terminus of the Cas13a protein was modified with NHS-PEG4-biotin and biotinylated”; FIG. 24).
Regarding claims 8 and 14, Watanabe teaches the reagent according to claim 1, wherein each of the particles and the complex are bound via a linker wherein the linker includes a complex of biotin and avidin (“the single-stranded DNA fragment 2120 binds to the surface of the particle 2110 by avidin-biotin bond. The single-stranded DNA fragment 2120 has a base sequence complementary to a part of a target nucleic acid fragment 140. Therefore, in a case where the particle 2110 to which the single-stranded DNA fragment 2120 binds, a sample containing the target nucleic acid fragment 140, the gRNA, and the CRISPR/Cas family protein are mixed in a container, the three-part complex 100′ containing the CRISPR/Cas family protein, the gRNA, and the target nucleic acid fragment 140 are immobilized on the particle” [0106-0107]; FIG. 21).
Therefore, claims 1-4, 6, 8, 13-14, 17, and 19 are anticipated by Watanabe.
Claim 15 is rejected under 35 U.S.C. 102(a)(2) as being anticipated by Watanabe et al. (US 2024/0094199, effectively filed date 28 December 2020), herein Watanabe, as applied to claims 1-4, 6, 8, 13-14, 17, and 19 above and as evidenced by ThermoFisher 1 (https://www.thermofisher.com/order/catalog/product/11206D, snapshot dated 19 October 2019 on Wayback Machine) and ThermoFisher 2 (https://www.thermofisher.com/order/catalog/product/65601, snapshot dated 15 September 2015 on Wayback Machine).
Regarding claim 15, Watanabe teaches the reagent according to claim 1 as discussed in the above rejection of claim 1 under 35 U.S.C. 102 as being anticipated by Watanabe, wherein the particles have a particle size of 1 µm to 10 µm (“a particle having a diameter of about 0.1 to 100 μm can be used” Watanabe [0101]; “streptavidin-coated magnetic beads (product name “Dynabeads M280”, Veritas)” Watanabe [0293]; “streptavidin-coated magnetic beads (product name “Dynabeads MyOne Streptavidin T1”, Veritas)” Watanabe [0301]). ThermoFisher 1 provides evidence that Dynabeads M280, as recited by Watanabe, have a diameter of 2.8 µm (“These uniform and superparamagnetic beads are 2.8 µm in diameter” ThermoFisher 1, page 1). ThermoFisher 2 provides evidence that Dynabeads MyOne Streptavidin T1, as recited by Watanabe, have a diameter of 1 µm (“These uniform and superparamagnetic beads are 1 µm in diameter” ThermoFisher 2, page 1).
Therefore, claim 15 is anticipated by Watanabe as evidenced by ThermoFisher 1 and ThermoFisher 2.
Claim 16 is rejected under 35 U.S.C. 102(a)(2) as being anticipated by Watanabe et al. (US 2024/0094199, effectively filed date 28 December 2020), herein Watanabe, as applied to claims 1-4, 6, 8, 13-14, 17, and 19 above and as evidenced by ThermoFisher 3 (https://www.thermofisher.com/us/en/home/references/ambion-tech-support/rna-tools-and-calculators/dna-and-rna-molecular-weights-and-conversions.html, snapshot dated 28 August 2015 on Wayback Machine) and Khan et al. ("CRISPR-Cas13a mediated nanosystem for attomolar detection of canine parvovirus type 2" Chin Chem Lett 30(12), page 2201-2204 (2019)), herein Khan.
Regarding claim 16, Watanabe teaches the reagent according to claim 1 as discussed in the above rejection of claim 1 under 35 U.S.C. 102 as being anticipated by Watanabe, wherein the reagent contains less than 1 mg of the complex per 1 mL thereof (“the biotinylated Cas13a protein and the gRNA (SEQ ID NO: 8) were mixed […] the concentration of the biotinylated Cas13a protein in the mixture solution was 60 nM, the concentration of the gRNA was 12 nM […]. Subsequently, 20 μL of the above mixture solution was mixed with 100 μL of a buffer E […]. Subsequently, 20 μL of 0.5 mg/mL magnetic beads were further added and mixed by pipetting for 10 seconds. Subsequently, incubation was performed for 3 minutes to use the solution as an assay solution” Watanabe [0303-0304], as this creates the assay solution this is considered to create the reagent according to claim 1, see also all of Watanabe [0301-0304] and FIG. 24). Watanabe also teaches that the gRNA has sequence ggauuuagacuaccccaaaaacgaaggggacuaaaacuuggcaauguuguuccuugaggaaguug (Watanabe SEQ ID NO: 8) and that the Cas13a may be LwCas13a (“the CRISPR/Cas family protein that can be used in the method of the present embodiment include […] Leptotrichia wadei-derived Cas13a protein (LwaCas13a” [0136]; “Leptotrichia wadei Cas13a (LwCas13a)” [0229]). ThermoFisher 3 teaches that the molecular weight of an ssRNA can be calculated with the formula M.W. = (An x 329.2) + (Un x 306.2) + (Cn x 305.2) + (Gn x 345.2) + 159 (ThermoFisher 3 page 1), thereby providing evidence that the molecular weight of the gRNA of the reagent taught by Watanabe is 21197g/mol. As Watanabe teaches that the gRNA concentration in the mixture solution is 12nM and teaches combining 20 µL of the mixture solution with 100 µL of buffer E and 20 µL of magnetic bead solution for a final volume of 140 µL, the concentration of gRNA in the reagent is 3.634×10-5 mg/mL. Khan teaches that purified LwCas13a has a molecular weight of 138.5 kDa (“Hereby we developed new LwCas13a purification method based on SUMO enzyme digestion. SDS-PAGE was used to check prokaryotic LwCas13a expression (Fig. 1). LwCas13a molecular weight along with SUMO site was 155.2 kDa while the molecular weight of digested LwCas13a by SUMO enzyme was 138.5 kDa” Khan, page 2203 left column first paragraph), thereby providing evidence of the molecular weight of the Cas13a of the reagent taught by Watanabe. As Watanabe teaches that the Cas13a concentration in the mixture solution is 60nM, the concentration of Cas13a in the reagent is 1.187×10-3 mg/mL. Since the sum of the concentrations of the gRNA and Cas13a in the reagent is less than 1 mg/mL, Watanabe teaches the reagent containing less than 1 mg of the complex per 1 mL of the reagent.
Therefore, claim 16 is anticipated by Watanabe as evidenced by ThermoFisher 3 and Khan.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 10 is rejected under 35 U.S.C. 103 as being unpatentable over Sasaki et al. (U.S. Patent 10,933,027, published 2 March 2021, effectively filed date 25 September 2017), herein Sasaki, as applied to claims 1, 5-9, 11-15, and 18 above, in view of Harkins et al. (US 2018/0252711, published 6 September 2018), herein Harkins.
Regarding claim 10, Sasaki teaches the reagent according to claim 9, wherein the linker includes an antibody that binds by an antigen-antibody reaction (“In another instance, the reactive group is a binding group. […] Exemplary binding groups and binding reaction pairs include those for forming a bond between […] an antigen and an antibody” col 35 lines 57-66). However, “the peptide” recited in line 2 of claim 10 specifically refers to “a peptide formed by consecutive 6 to 11 histidine residues” in lines 2-3 of claim 9, and Sasaki does not teach an antibody that reacts with 6 to 11 consecutive histidine residues. This deficiency is made up for in the teachings of Harkins.
Regarding claim 10, Harkins teaches binding a particle with a protein via a linker wherein the linker includes a His-tag peptide and an antibody that binds to the His-tag peptide by an antigen-antibody reaction (“beads conjugated to an anti-His antibody that can capture His-tagged proteins” [0059]).
It would have been obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention to perform the simple substitution of the anti-His antibody being used to link a bead and a His-tagged protein taught by Harkins for the general antigen-antibody reaction of the linker binding a bead and a His-tagged protein in the reagent taught by Sasaki (MPEP §2143 I. B.). One of ordinary skill in the art could have performed this substitution and would have found the results of this substitution predictable because it merely involves the substitution of using a specific antibody (anti-His) in a general antibody-antigen reaction in a reagent that includes the antigen (His-tag/6xHis) of the specific antibody in the linker and because both references use the antibody to bind a bead with a protein. Therefore, the invention as a whole of claim 10 would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention.
Conclusion
Claims 1-19 are rejected. Claim 20 is withdrawn.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jeffrey Lawrence Bellah whose telephone number is (571)272-1024. The examiner can normally be reached M-Th, 7:30-5 ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Anne Gussow can be reached at (571)272-6047. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JEFFREY BELLAH/Examiner, Art Unit 1683
/ANNE M. GUSSOW/Supervisory Patent Examiner, Art Unit 1683
Prosecution Insights