DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I, drawn to claims 1-3, 11-17, 20-21, 23-24, 31, 66, 68, 72, and 93, and the species of SEQ ID NO: 31 therein, in the reply filed on 06/15/2026 is acknowledged.
Claim 102 is withdrawn from further consideration as being drawn to a non-elected invention.
Priority
The instant application is a CON of PCT/US2022/024101 filed 04/08/2022, which claims benefit of US Provisional application 63/173,280 filed 04/09/2021.
Claim Objections
Claims 24 and 72 are objected to because of the following informalities:
Regarding claim 24, the limitation “GAL 10 promoter” in line 7 should be corrected to “GAL10 promoter” for the sake of consistency.
Regarding claim 72, the limitation “any one of SEQ ID NOS” should be corrected to “any one of sequences set forth in SEQ ID NOS” because SEQ ID numbers identify sequences, but are not sequences per se.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 17, 24, and 72 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 is drawn to “A non-naturally occurring nucleic acid comprising a sequence encoding a biologic comprising an anti-angiogenic agent, said sequence comprising a modification in a coding region of the sequence” (lines 1-3). It is unclear whether the limitation “a coding region of the sequence” refers to a coding region of a biologic, or more specifically to a coding region of an anti-angiogenic agent.
Claim 17 recites the limitation “wherein the signal peptide is selected from the group consisting of… VEGF-Trap.” Signal sequences are typically 25-30 amino acid residues in length, with longer signal peptides having approximately 140 residues (Owji et al., European Journal of Cell Biology, 2018, 97(2): 422-441 at p 427, Section 5). A VEGF-Trap peptide is much longer; for example, the VEGF-Trap aflibercept has 431 residues (SEQ ID NO: 1 of US 2021/0010025 A1). Thus, it is unclear how VEGF-Trap is to function as a signal peptide, as recited in instant claim 17. In light of the teachings of the specification (e.g., para 5), the limitation is interpreted as “wherein the signal peptide is selected from the group consisting of… a signal peptide derived from VEGF-Trap.”
Claim 24 recites the limitation “a polyadenylated construct thereof” (line 9) as an item in the Markush grouping. It is unclear whether “thereof” refers only to the item immediately preceding it (a U6 promoter), or to any of the items listed in the Markush grouping in lines 2-7 (starting with “a CMV promoter” in line 2 and ending with “a U6 promoter” in line 7). The latter interpretation is used for the purpose of examination.
Claim 72 recites the limitation “at least about 60% sequence identity or similarity with any one of SEQ ID NOS” (lines 1-3), which is indefinite for the following reasons:
First, the phrase “at least about” is indefinite because the limitation “at least” sets a lower limit, and the limitation “about” removes said limit. Therefore, the metes and bounds of the numerical range encompassed by the limitation “at least about” is unclear.
Second, the phrase “identity or similarity” is indefinite. The term “similarity” is not defined in the specification. In the absence of a definition, the metes and bounds of the limitation “similarity,” and how it differs from “identity,” is unclear. The broadest reasonable interpretation of “similarity” includes “local similarity,” referring to the sequence identity of only a portion of the entire sequence. For the sake of compact prosecution, this limitation in claim 72 is interpreted as “at least about 60% sequence identity
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 21 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 21 is drawn to “The non-naturally occurring nucleic acid of claim 20, wherein the intronic sequence is selected from the group consisting of… intervening sequence intron.” Claim 20 is drawn to “The non-naturally occurring nucleic acid of claim 1, wherein the nonnaturally occurring nucleic acid further comprises an intronic sequence.”
Stoltzfus (2001, Intron and Exons, Encyclopedia of Genetics) shows that “intron” and “intervening sequence” are synonyms, both of which refer to a segment of RNA excised from a gene transcript (Abstract). Therefore, the limitation “wherein the intronic sequence is selected from the group consisting of… intervening sequence intron” as recited in claim 21 fails to specify a further limitation to claim 20.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-3, 11, 16-17, 20-21, 23-24, 31, 66, 68, 72, and 93 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
This written description rejection is on the grounds of anti-angiogenic agent as recited in claim 1, and at least about 60% sequence identity as recited in claim 72. Each of these are addressed separately below.
From M.P.E.P. § 2163, the analysis of whether the specification complies with the written description requirement calls for the examiner to compare the scope of the claim with the scope of the description to determine whether applicant has demonstrated possession of the claimed invention from the standpoint of one of skill in the art at the time the application was filed. For inventions in emerging and unpredictable technologies, or for inventions characterized by factors not reasonably predictable which are known to one of ordinary skill in the art, more evidence is required to show possession.
For claims drawn to a genus, possession may be shown (for example) through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. A “representative number of species” means that the species which are adequately described are representative of the entire genus, and is an inverse function of the skill and knowledge in the art. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly. If a representative number of adequately described species are not disclosed for a genus, the claim to that genus must be rejected as lacking adequate written description under 35 U.S.C. 112, para. 1.
Regarding claim 1: Claim 1 is drawn to a nucleic acid comprising a sequence encoding a biologic comprising an anti-angiogenic agent, said sequence comprising a modification in a coding region of the sequence as compared to an otherwise comparable sequence lacking the modification in the coding region, said modification comprising a replacement of at least four non-AGG arginine codons with AGG.
Claim 1 recites a structure: a nucleic acid. Claim 1 also recites a function: a nucleic acid comprising a sequence encoding an anti-angiogenic agent. Thus, the claim is drawn to a product comprising a very large genus of nucleic acids comprising the claimed function.
The instant specification discloses only the following, which is also recited in claim 12, as exemplary anti-angiogenic agents: a VEGF inhibitor, a multi-tyrosine kinase inhibitor, a receptor tyrosine kinase inhibitor, an inhibitor of Akt phosphorylation, a PDGF-1 inhibitor, a PDGF-2 inhibitor, a NP-1 inhibitor, a NP-2 inhibitor, a Del 1 inhibitor, and an integrin inhibitor (para 5, 18).
The prior art is unpredictable. Fallah (Biomedicine and Pharmacotherapy, 2019, 110: 775-785) teaches that angiogenesis is tightly regulated by a complex network of angiogenesis growth factors and cytokines which provoke residential endothelial cells located in the inner surface of vessels as the main site of angiogenesis (p 775, col 1; Fig 1), and that novel molecular targets which are overexpressed in diseased tissue, such as integrins and microRNAs, are being identified (p 782, col 2, para 2). Fallah further teaches that anti-angiogenesis agents are categorized into seven major groups: a) Monoclonal antibodies (mAbs), b) MicroRNAs (miRNAs) / Small interfering RNAs (siRNA), c) Aptamers, d) Gene Therapy, e) Small molecular, f) Angiostatin and endostatin, and g) Chimeric antigen receptor T cells (CAR-T) cell therapy (p 778, col 2, para 4 – p 779, col 1, para 1; Table 2). Thus, the prior art cannot be relied upon for making up for the deficit of the instant specification with regard to a sufficient representative number of species that function as an anti-angiogenic agent.
Claims 2-3, 11, 16-17, 20-21, 23-24, 31, 66, 68, 72, and 93 are included in the rejection because they depend from claim 1. Claims 12-15 are NOT included in the rejection because claim 12 enumerates the species of anti-angiogenic agent, and claims 13-15 depend from claim 12.
Regarding claim 72: Claim 72 is drawn to a nucleic acid comprising a sequence encoding a biologic comprising an anti-angiogenic agent, said sequence comprising a modification in a coding region of the sequence as compared to an otherwise comparable sequence lacking the modification in the coding region, said modification comprising a replacement of at least four non-AGG arginine codons with AGG, wherein the nucleic acid comprises at least about 60% sequence identity or similarity with SEQ ID NOs: 13-1. 9, 21-27, 31, 62, 64, 66, or 68.
Claim 72 recites a structure: a nucleic acid comprising a sequence encoding a biologic comprising an anti-angiogenic agent, said sequence comprising a modification in a coding region, said modification comprising a replacement of at least four non-AGG arginine codons with AGG, wherein the nucleic acid comprises at least about 60% sequence identity or similarity with SEQ ID NO: 31. Claim 72 also recites a function: a nucleic acid comprising a sequence encoding an anti-angiogenic agent. Thus, the claim is drawn to a product comprising a very large genus of nucleic acids comprising the claimed function.
Neither the specification nor the prior art establishes a structure-function relationship wherein a nucleic acid sequence, which is as little as 60% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 13-19, 21-27, 31, 62, 64, 66, or 68, would be capable of functioning as claimed with any degree of predictability.
The instant specification discloses the nucleic acid sequences for SEQ ID NOs: 13-19, 21-27, 31, 62, 64, 66, or 68, and codon-optimizations thereof (e.g., the replacement of non-AGG arginine codons with AGG, as recited in claim 1). However, the specification does not identify what changes, mutations, etc. could be made to the sequences set forth in SEQ ID NOs: 13-19, 21-27, 31, 62, 64, 66, or 68 and that would be encompassed by the structural limitations of claim 72, and would predictably result in the claimed function of the nucleic acid encoding a biologic comprising an anti-angiogenic agent. As such, the instant specification does not provide a sufficient representative sampling of structures that are as little as 60% identical to the sequences set forth in SEQ ID NOs: 13-19, 21-27, 31, 62, 64, 66, or 68 that are capable of providing for said function as claimed.
The prior art is unpredictable. For example, the sequence set forth in SEQ ID NO: 31 of the instant application is 88.7 % identical to the sequence set forth in SEQ ID NO: 2 of Danos (US 2021/0010025 A1). The sequence set forth in SEQ ID NO: 2 of Danos comprises a codon-optimized nucleotide sequence encoding a VEGF-Trap transgene (para 11, 14). Danos teaches that nucleic acids taught therein may be codon-optimized via any codon-optimization technique known to one of skill in the art (para 14, 167, 198), and that the transgene may encode variants of a VEGF-Trap designed to increase stability and residence in the eye (para 165, 181). However, Danos does not teach an exhaustive list of modifications that may be made to the nucleic acid sequence, such that the nucleic acid retains 60% to the sequence set forth in SEQ ID NO: 31 of the instant application, and retains its function as an anti-angiogenic agent. Thus, the prior art cannot be relied upon for making up for the deficit of the instant specification with regard to a sufficient representative number of species that are as little as 60% identical to the sequences set forth in SEQ ID NOs: 13-19, 21-27, 31, 62, 64, 66, or 68 that provide for said function as claimed.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-3, 11-13, 16, 20-21, 23, and 31 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (specifically, a natural phenomenon) without significantly more.
Step 1: This part of the eligibility analysis evaluates whether the claim falls within any statutory category. MPEP 2106.03. Here, the claim recites a non-naturally occurring nucleic acid comprising a sequence encoding a biologic comprising an anti-angiogenic agent, said sequence comprising a modification in a coding region of the sequence as compared to an otherwise comparable sequence lacking the modification in the coding region, said modification comprising a replacement of at least four non-AGG arginine codons with AGG. Because a nucleic acid is a composition of matter, the claim falls within a statutory category. (Step 1: YES)
Step 2A, Prong One: This part of the eligibility analysis evaluates whether the claim recites a judicial exception. As explained in MPEP 2106.04(II) and the October 2019 Update, a claim “recites” a judicial exception when the judicial exception is “set forth” or “described” in the claim. Because claim 9 recites a nature-based product limitation, the markedly different characteristics analysis is used to determine if the nature-based product limitation is a product of nature exception. MPEP 2106.04(c)(I). MPEP 2106.04(c)(I)(A). The markedly different characteristics analysis is performed by comparing the nature-based product limitation in the claim to its naturally occurring counterpart to determine if it has markedly different characteristics from the counterpart. MPEP 2106.04(c)(II).
Here, the closest natural counterpart to the nucleic acid of claim 1 is a nucleic acid comprising a sequence encoding an anti-angiogenic agent, comprising synonymous mutations that replace at least four AGA arginine codons with AGG (claims 1 and 31), and synonymous mutations that replace at least one CCT proline codon with CCC, at least one AGC serine codon with TCC, and/or at least one CCC proline codon with CCG (claims 2-3 and 11), further comprising a signal peptide (claim 16), an intervening intronic sequence (claims 20-21), and a promoter (claim 23), wherein the anti-angiogenic agent is a non-antibody VEGF inhibitor (claims 12-13).
The art, as exemplified in Zhang (J Mol Endocrinol, 2006, 37(1): 1–12), teaches that pigmented-epithelium derived factor (PEDF) is an anti-angiogenic agent that inhibits VEGF at the transcriptional level (Abstract). NCBI “PEDF Protein” shows that PEDF is a 418-AA protein comprising at least four arginine residues and at least one proline residue. Beccera (Nat Rev Cancer, 2013, 13(4):2 58-71) shows that PEDF (also known as SERPINF1) has a signal peptide and promoter (p 259, col 1, para 2; p 266, col 2, para 3).
The claimed nucleic acid is identical to a naturally occurring nucleic acid encoding PEDF, comprising synonymous mutations that replace at least four AGA arginine codons with AGG, and synonymous mutations that replace at least one CCT proline codon with CCC, at least one AGC serine codon with TCC, and/or at least one CCC proline codon with CCG, further comprising an intervening intronic sequence and a promoter. Thus, there is no marked difference between the claim and product of nature. Accordingly, the claim recites a judicial exception, and the analysis must therefore proceed to Step 2A, Prong Two.
Step 2A, Prong Two: This part of the eligibility analysis evaluates whether the claim as a whole integrates the recited judicial exception into a practical application of the exception. This evaluation is performed by (a) identifying whether there are any additional elements recited in the claim beyond the judicial exception, and (b) evaluating those additional elements individually and in combination to determine whether the claim as a whole integrates the exception into a practical application. 2019 PEG Section III(A)(2), 84 Fed. Reg. at 54-55. The claims do not integrate the product into a practical application because the claim is to the nucleic acid, per se, and do not recite additional elements beyond the judicial exception. (Step 2A: YES)
Step 2B: This part of the eligibility analysis evaluates whether the claim as a whole amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim. MPEP 2106.05. The claim does not recite any elements in addition to the judicial exception of a nucleic acid, so there are no additional elements that add significantly more to the judicial exception. (Step 2B: NO)
The claims are not patent eligible.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 1-3, 11-17, 20-21, 23-24, 31, 66, 68, 72, and 93 are rejected under 35 U.S.C. 103 as being unpatentable over Danos (US 2021/0010025 A1), in view of Nathwani (US 2020/0054767 A1; cited in IDS 08/12/2025), as evidenced by Tan (FEBS Letters, 2001, 494(3): 150-156).
Regarding claim 1: Danos teaches a transgene encoding a human-post-translationally modified VEGF-Trap (reads on a non-naturally occurring nucleic acid comprising a sequence encoding a biologic comprising an anti-angiogenic agent) for delivery into the eye of human subjects (para 9, 11). VEGF-Trap is an anti-angiogenic agent (para 6).
Danos teaches that nucleic acids taught therein may be codon-optimized via any codon-optimization technique known to one of skill in the art (para 14, 167, 198).
The transgene encoding VEGF-Trap taught in Danos does not comprise a modification comprising a replacement of at least four non-AGG arginine codons with AGG in the coding sequence.
Nathwani teaches a codon-optimized Factor IX, wherein at least 5 codons encoding arginine are replaced with AGG (e.g., Abstract; para 400, 497-502). Nathwani teaches that the use of a codon-optimized Factor IX nucleotide sequence improves the efficacy of a polynucleotide encoding said sequence, resulting in a sequence which is highly expressed (para 5-13).
It would have been prima facie obvious for a person of ordinary skill in the art before the effective filing date of the claimed invention to have modified the transgene encoding VEGF-Trap, as taught in Danos, by replacing at least four non-AGG arginine codons with AGG, as taught in Nathwani. One of ordinary skill in the art would have been motivated to make this modification to improve the efficacy of the polynucleotide encoding VEGF-Trap. One of ordinary skill in the art would have had a reasonable expectation of successfully making this modification because Danos teaches that nucleic acids taught therein may be codon-optimized via any codon-optimization technique.
Regarding claim 2: Following the discussion of claim 1, Danos teaches that the transgene may encode variants of a VEGF-Trap designed to increase stability and residence in the eye, yet reduce the systemic half-life of the transgene product following entry into the systemic circulation (para 165, 181).
Regarding claim 3: Danos does not teach the nucleic acid of claim 2, wherein the second modification is (a) a replacement of at least one non-CCC proline codon with CCC.
Nathwani teaches a codon-optimized Factor IX, wherein at least 1 codon encoding proline is replaced with CCC (e.g., Abstract; para 400, 436-441). Nathwani teaches that the use of a codon-optimized Factor IX nucleotide sequence improves the efficacy of a polynucleotide encoding said sequence, resulting in a sequence which is highly expressed (para 5-13).
It would have been prima facie obvious for a person of ordinary skill in the art before the effective filing date of the claimed invention to have further modified the nucleic acid of claim 2, as taught by Danos in view of Nathwani, by replacing at least 1 codon encoding proline with CCC, as taught in Nathwani. One of ordinary skill in the art would have been motivated to make this modification to improve the efficacy of the polynucleotide encoding VEGF-Trap. One of ordinary skill in the art would have had a reasonable expectation of successfully making this modification because Danos teaches that nucleic acids taught therein may be codon-optimized via any codon-optimization technique.
Regarding claim 11: Following the discussion of claim 3, Nathwani teaches that at least 1 codon encoding proline is replaced with CCC (para 436-441), including 3 occurrences of CCT to CCC codon replacements (p 14, Table 2).
Regarding claims 12-17, 20-21, and 23-24: The transgene taught in Danos encodes VEGF-Trap (claim 15), which is a VEGF-inhibitor and a recombinant fusion protein (para 6) (claims 12-13). Danos teaches that VEGF-Trap transgenes encode fusion proteins of VEGF receptors 1 and 2 (para 182) (claim 14). Danos teaches that a vector comprising the transgene may encode one or more signal peptides that are fused to the VEGF-trap fusion protein upon expression (para 227) (claim 16). Danos teaches that the signal sequence may be that of Flt-1, MVSYWDTGVLLCALLSCLLLTGSSSG (para 169, 185, 229). Tan shows that Flt-1 is an alias for VEGFR-1 (Introduction, para 2), which Danos teaches is a component of VEGF-Trap (para 182) (claim 17). Danos teaches that the nucleic acid construct encoding the VEGF-Trap transgene can further comprise introns, including a SV40 intron and β-globin intron (para 13, 194) (claims 20-21), and a promoter, including a CMV promoter and EF-1 alpha promoter (para 12, 196) (claims 23-24).
Regarding claim 31: Following the discussion of claim 1, Nathwani teaches that at least 5 codons encoding arginine are replaced with AGG (para 497-502), including 5 occurrences of AGA to AGG codon replacements (p 15, Table 2).
Regarding claims 66, 68, and 93: Danos teaches a viral vector comprising a transgene encoding VEGF-Trap and an AAV8 capsid sequence (e.g., para 10, 12, 15, 76, 88, 166-168, 193-197, 202-213).
Regarding claim 72: Following the discussion of claim 1, Danos sets forth a nucleotide sequence in SEQ ID NO: 2, which comprises a codon-optimized nucleotide sequence encoding a VEGF-Trap transgene (para 11, 14). The sequence set forth in SEQ ID NO: 2 of Danos (“Db”) is 88.7 % identical to the sequence set forth in SEQ ID NO: 31 (“Qy”) of the instant application (sequence alignment below).
Query Match 88.7%; Score 1149.2; DB 1; Length 1353;
Best Local Similarity 93.2%;
Matches 1202; Conservative 0; Mismatches 88; Indels 0; Gaps 0;
Qy 1 GACACCGGCAGGCCCTTCGTGGAGATGTACTCCGAGATCCCCGAGATCATCCACATGACC 60
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||
Db 64 GACACCGGCAGACCCTTCGTGGAGATGTACAGCGAGATCCCCGAGATCATCCACATGACC 123
Qy 61 GAGGGCAGGGAGCTGGTGATCCCCTGCAGGGTGACCTCCCCCAACATCACCGTGACCCTG 120
|||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||||
Db 124 GAGGGCAGAGAGCTGGTGATCCCCTGCAGAGTGACCAGCCCCAACATCACCGTGACCCTG 183
Qy 121 AAGAAGTTCCCCCTGGACACCCTGATCCCCGACGGCAAGAGGATCATCTGGGACTCCAGG 180
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||
Db 184 AAGAAGTTCCCCCTGGACACCCTGATCCCCGACGGCAAGAGAATCATCTGGGACAGCAGA 243
Qy 181 AAGGGCTTCATCATCTCCAACGCCACCTACAAGGAGATCGGCCTGCTGACCTGCGAGGCC 240
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Db 244 AAGGGCTTCATCATCAGCAACGCCACCTACAAGGAGATCGGCCTGCTGACCTGCGAGGCC 303
Qy 241 ACCGTGAACGGCCACCTGTACAAGACCAACTACCTGACCCACAGGCAGACCAACACCATC 300
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Db 304 ACCGTGAACGGCCACCTGTACAAGACCAACTACCTGACCCACAGACAGACCAACACCATC 363
Qy 301 ATCGACGTGGTGCTGTCCCCCTCCCACGGCATCGAGCTGTCCGTGGGCGAGAAGCTGGTG 360
||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||
Db 364 ATCGACGTGGTGCTGAGCCCCAGCCACGGCATCGAGCTGAGCGTGGGCGAGAAGCTGGTG 423
Qy 361 CTGAACTGCACCGCCAGGACCGAGCTGAACGTGGGCATCGACTTCAACTGGGAGTACCCC 420
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Db 424 CTGAACTGCACCGCCAGAACCGAGCTGAACGTGGGCATCGACTTCAACTGGGAGTACCCC 483
Qy 421 TCCTCCAAGCACCAGCACAAGAAGCTGGTGAACAGGGACCTGAAGACCCAGTCCGGCTCC 480
| |||||||||||||||||||||||||||||| ||||||||||||||| |||| |
Db 484 AGCAGCAAGCACCAGCACAAGAAGCTGGTGAACAGAGACCTGAAGACCCAGAGCGGCAGC 543
Qy 481 GAGATGAAGAAGTTCCTGTCCACCCTGACCATCGACGGCGTGACCAGGTCCGACCAGGGC 540
|||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||
Db 544 GAGATGAAGAAGTTCCTGAGCACCCTGACCATCGACGGCGTGACCAGAAGCGACCAGGGC 603
Qy 541 CTGTACACCTGCGCCGCCTCCTCCGGCCTGATGACCAAGAAGAACTCCACCTTCGTGAGG 600
|||||||||||||||||| | |||||||||||||||||||||| ||||||||||||
Db 604 CTGTACACCTGCGCCGCCAGCAGCGGCCTGATGACCAAGAAGAACAGCACCTTCGTGAGA 663
Qy 601 GTGCACGAGAAGGACAAGACCCACACCTGCCCCCCCTGCCCCGCCCCCGAGCTGCTGGGC 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 664 GTGCACGAGAAGGACAAGACCCACACCTGCCCCCCCTGCCCCGCCCCCGAGCTGCTGGGC 723
Qy 661 GGCCCCTCCGTGTTCCTGTTCCCCCCCAAGCCCAAGGACACCCTGATGATCTCCAGGACC 720
|||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||
Db 724 GGCCCCAGCGTGTTCCTGTTCCCCCCCAAGCCCAAGGACACCCTGATGATCAGCAGAACC 783
Qy 721 CCCGAGGTGACCTGCGTGGTGGTGGACGTGTCCCACGAGGACCCCGAGGTGAAGTTCAAC 780
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Db 784 CCCGAGGTGACCTGCGTGGTGGTGGACGTGAGCCACGAGGACCCCGAGGTGAAGTTCAAC 843
Qy 781 TGGTACGTGGACGGCGTGGAGGTGCACAACGCCAAGACCAAGCCCAGGGAGGAGCAGTAC 840
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Db 844 TGGTACGTGGACGGCGTGGAGGTGCACAACGCCAAGACCAAGCCCAGAGAGGAGCAGTAC 903
Qy 841 AACTCCACCTACAGGGTGGTGTCCGTGCTGACCGTGCTGCACCAGGACTGGCTGAACGGC 900
||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||||
Db 904 AACAGCACCTACAGAGTGGTGAGCGTGCTGACCGTGCTGCACCAGGACTGGCTGAACGGC 963
Qy 901 AAGGAGTACAAGTGCAAGGTGTCCAACAAGGCCCTGCCCGCCCCCATCGAGAAGACCATC 960
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Db 964 AAGGAGTACAAGTGCAAGGTGAGCAACAAGGCCCTGCCCGCCCCCATCGAGAAGACCATC 1023
Qy 961 TCCAAGGCCAAGGGCCAGCCCAGGGAGCCCCAGGTGTACACCCTGCCCCCCTCCAGGGAC 1020
||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||
Db 1024 AGCAAGGCCAAGGGCCAGCCCAGAGAGCCCCAGGTGTACACCCTGCCCCCCAGCAGAGAC 1083
Qy 1021 GAGCTGACCAAGAACCAGGTGTCCCTGACCTGCCTGGTGAAGGGCTTCTACCCCTCCGAC 1080
||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||
Db 1084 GAGCTGACCAAGAACCAGGTGAGCCTGACCTGCCTGGTGAAGGGCTTCTACCCCAGCGAC 1143
Qy 1081 ATCGCCGTGGAGTGGGAGTCCAACGGCCAGCCCGAGAACAACTACAAGACCACCCCCCCC 1140
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Db 1144 ATCGCCGTGGAGTGGGAGAGCAACGGCCAGCCCGAGAACAACTACAAGACCACCCCCCCC 1203
Qy 1141 GTGCTGGACTCCGACGGCTCCTTCTTCCTGTACTCCAAGCTGACCGTGGACAAGTCCAGG 1200
||||||||| ||||||| ||||||||||||| ||||||||||||||||||| |||
Db 1204 GTGCTGGACAGCGACGGCAGCTTCTTCCTGTACAGCAAGCTGACCGTGGACAAGAGCAGA 1263
Qy 1201 TGGCAGCAGGGCAACGTGTTCTCCTGCTCCGTGATGCACGAGGCCCTGCACAACCACTAC 1260
||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||
Db 1264 TGGCAGCAGGGCAACGTGTTCAGCTGCAGCGTGATGCACGAGGCCCTGCACAACCACTAC 1323
Qy 1261 ACCCAGAAGTCCCTGTCCCTGTCCCCCGGC 1290
||||||||| |||| |||| |||||||
Db 1324 ACCCAGAAGAGCCTGAGCCTGAGCCCCGGC 1353
Once the sequence set forth in SEQ ID NO: 2 of Danos is modified according to the teachings of Nathwani, such that four non-AGG arginine codons are replaced with AGG, the modified SEQ ID NO: 2 of Danos would still have at least 60% identity with SEQ ID NO: 31 of the instant application, thus rendering obvious instant claim 72.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Risa Takenaka whose telephone number is (571)272-0149. The examiner can normally be reached M-F, 12-7 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at (571) 272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/RISA TAKENAKA/ Examiner, Art Unit 1632
/KARA D JOHNSON/ Primary Examiner, Art Unit 1632
Prosecution Insights