DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 14-18 and 22-25 are pending.
Status of the Application
Applicant’s response and amendment filed 14 November 2025 are acknowledged and entered.
Applicant has amended Claims 14-18 and 22-23. Applicant has cancelled claims 1-6 and 9-13.
Response to Amendment
Applicant has amended the Spec. to overcome Objections; the objections are withdrawn.
Applicant has cancelled Claims 1-6 and 11-13 to overcome the 112(b) rejections; the 112(b) rejections are withdrawn.
Applicant has amended the claims to overcome the 102 rejection; the 102 rejection is withdrawn.
The 103 rejections are maintained.
Election/Restrictions
Claims 22-23 were previously withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected species. The claims have been amended to recite elected species so Claims 22-23 are now examined.
Claims 14-18 and 22-25 are examined.
Arguments applicable to newly applied rejections to amended or newly presented claims are addressed below. Arguments that are no longer relevant are not addressed.
Rejections not reiterated here are withdrawn.
Claim Interpretation
The claims recite annealing site abbreviations including the following: Annealing site H2.SA. (+02+26) and H2A (+06+30). The claims do not explain what is H2.SA., H2A, or the numbers. The Spec. teaches (pp. 68-69 ¶3-1):
The first letter designates the species (e.g. H: human, M: murine, C: canine)."#" designates target dystrophin exon number. "A/D" and "SA/SD" each indicates acceptor or donor splice site at the beginning and end of the exon, respectively. (x y) represents the annealing coordinates where "-" or"+" indicate intronic or exonic sequences respectively. For example, A(-6+ 18) would indicate the last 6 bases of the intron preceding the target exon and the first 18 bases of the target exon. The closest splice site would be the acceptor so these coordinates would be preceded with an "A". Describing annealing coordinates at the donor splice site could be D(+2-18) where the last 2 exonic bases and the first 18 intronic bases correspond to the annealing site of the antisense molecule. Entirely exonic annealing coordinates that would be represented by A(+65+85), that is the site between the 65th and 85th nucleotide from the start of that exon.
Therefore H is interpreted as human, 2 is interpreted as exon 2, A is interpreted as an acceptor site at the beginning of an exon, and SA is interpreted as an acceptor site at the end of an exon.
The claims recite the ASOs have nucleotides that 5’ to 3’ correspond to the nucleobases in recited sequences (i.e., …each Nu from 1 to n+2) and 5’ to 3’ corresponds to…). Nucleotides that “correspon[d] to” the recited sequences is interpreted as meaning each ASO comprises a recited nucleotide sequence.
Claim Objections
Claim 14 is objected to because of the following informalities: a space appears to be missing between R200 and is a cell-penetrating peptide in L4 of the second page. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 14-18 and 22-25 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new matter rejection. This rejection is new and necessitated by the claim amendments.
The instant specification, as well as the PCT and/or provisional specifications, to which the instant application claims priority, as originally filed does not provide support for the invention as now claimed: n+2 (all claims). The specification does not provide sufficient "blazemarks", nor direction for the claimed compounds encompassing the above-mentioned limitations, as currently recited.
Specifically, the specification does not disclose an antisense oligomer (ASO) wherein each Nu from 1 to (n+2) and 5’ to 3’ corresponds to the nucleobases in the recited SEQ ID NOs.
Thus, the instant claims now recite limitations which were not disclosed in the specification as-filed, and now change the scope of the instant disclosure as-filed. Such limitations recited in the present claims, which did not appear in of the instant specification, nor in the PCT and/or provisional application(s) to which priority is claimed, introduce new concepts and violate the description requirement of the first paragraph of 35 U.S.C. § 112. Claims 14-18 and 22-23 are rejected because they recite the new matter. Claims 15-18 and 22-25 are rejected because they depend from Claim 14 and don’t remedy the issue.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 14-18 and 22-25 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This rejection is new and necessitated by the claim amendments.
A claim may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173. In the present instance, Claims 14-18 and 22-23 recite …each Nu from 1 to (n+2) and 5' to 3' corresponds to the nucleobases in one of the following … [SEQ ID NOs]. The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. Neither the Spec. nor the claim teaches what is each Nu from 1 to (n+2). The Spec. describes only nucleotides from 1 to (n+1) (see, e.g., p. 14 L1-3) so it’s not clear what is each Nu from 1 to (n+2).
Claims 14-18 and 22-23 are rejected for those reasons. Claims 15-18 and 22-25 are rejected because they depend from Claim 14 and don’t remedy the issues.
In the interest of compact prosecution the claims are interpreted as meaning the first Nu is “1”, “n” is the number of all nucleotides in the SEQ ID NO besides for the 5’- and 3’-terminal nucleotides, and “n+2” is the 3’-terminal nucleotide. The following marked up example applies this interpretation to SEQ ID NO 7:
PNG
media_image1.png
556
586
media_image1.png
Greyscale
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 14-18 and 22-25 are rejected under 35 U.S.C. 103 as being unpatentable over US Patent Application Publication No. US 2017/0218366 (published 03 August 2017, “App366”, of record), in view of US Patent No. US 9416361 (published 16 August 2016, “US361”, of record) and International Publication Number WO 2016/138534 (published 01 September 2016, “WO534”). This rejection is maintained but updated in response to the claim amendments.
App366 teaches antisense oligomers and methods for treating DMD caused by any 5’ mutation in DMD other than a DMD exon 2 duplication. The methods of App366 are (¶14) based on activating a glucocorticoid inducible IRES in exon 5, which (¶16) can be activated with oligos targeting exon 2. ¶48 teaches that “a 5’ mutation” is a mutation within or affecting exon 1, 2, 3, or 4 of the DMD gene…other than a DMD exon 2 duplication. ¶49 teaches that an oligomer of the invention targets exon 2 to induce altered splicing that results in the exclusion of exon 2 from the mature RNA causing a frameshift in the DMD gene reading frame and inducing utilization of the IRES in exon 5 for translational initiation, which is a description of exon skipping.
App366 Fig. 3B and its caption (¶26) teach a schematic representation and the sequence of exon 2. Notably, Fig. 3 indicates the portion of the exon that is the splice acceptor site, abbreviated SA in the figure below:
PNG
media_image2.png
168
789
media_image2.png
Greyscale
Fig. 3 shows SEQ ID NO 30 which comprises a region complementary to the entireties of instant SEQ ID NOs 25-26 and SEQ ID NO 28 as shown by the sequence alignments below:
NASEQ2_04042023_135022/c
Query Match 100.0%; Score 25; DB 1; Length 75; Best Local Similarity 100.0%;
Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGTTTTCTTTTGAACATCTTCTCT 25 Instant SEQ ID NO 25
|||||||||||||||||||||||||
Db 33 ATGTTTTCTTTTGAACATCTTCTCT 9 App366 SEQ ID NO 30
US-15-502-702-30/c
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 30, US/15502702
Publication No. US20170218366A1
GENERAL INFORMATION
APPLICANT: Flanigan, et al.
TITLE OF INVENTION: METHODS AND MATERIALS FOR ACTIVATING AN INTERNAL RIBOSOMAL ENTRY
TITLE OF INVENTION: SITE IN EXON 5 OF THE DMD GENE
FILE REFERENCE: 28335/48873PCT
CURRENT APPLICATION NUMBER: US/15/502,702
CURRENT FILING DATE: 2017-02-08
PRIOR APPLICATION NUMBER: 62/035,395
PRIOR FILING DATE: 2014-08-09
NUMBER OF SEQ ID NOS: 34
SEQ ID NO 30
LENGTH: 75
TYPE: DNA
ORGANISM: Homo sapiens
Query Match 100.0%; Score 25; Length 75;
Best Local Similarity 100.0%;
Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AATGTTTTCTTTTGAACATCTTCTC 25 Instant SEQ ID NO 26
|||||||||||||||||||||||||
Db 34 AATGTTTTCTTTTGAACATCTTCTC 10 App366 SEQ ID NO 30
Query Match 100.0%; Score 25; Length 75;
Best Local Similarity 100.0%;
Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTGAATGTTTTCTTTTGAACATCTT 25 Instant SEQ ID NO 28
|||||||||||||||||||||||||
Db 37 GTGAATGTTTTCTTTTGAACATCTT 13 App366 SEQ ID NO 30
App366 SEQ ID NO 30 is also 100% complementary to claimed SEQ ID NOs 7 and 11 (which bound all the claimed SEQ ID NOs that are elected species which means that App366 SEQ ID NO 30 is also 100% complementary to claimed SEQ ID NOs 8-10, 27, and 36):
NASEQ2_05122025_104825/c
Query Match 100.0%; Score 25; DB 1; Length 75;
Best Local Similarity 100.0%;
Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTTTGTGAATGTTTTCTTTTGAACA 25 Instant SEQ ID NO 11
|||||||||||||||||||||||||
Db 41 TTTTGTGAATGTTTTCTTTTGAACA 17 App366 SEQ ID NO 30
NASEQ2_05122025_104844/c
Query Match 100.0%; Score 25; DB 1; Length 75;
Best Local Similarity 100.0%;
Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTTCTTTTGAACATCTTCTCTTTCA 25 Instant SEQ ID NO 7
|||||||||||||||||||||||||
Db 29 TTTCTTTTGAACATCTTCTCTTTCA 5 App366 SEQ ID NO 30
App366 teaches (¶49) an embodiment wherein the splice modulating oligo targets a portion of exon 2 encoded by SEQ ID NO 3, which is -3 from the splice acceptor site and extends to +28. App366 teaches (¶26) ASOs that target that region were efficient in skipping exon 2. An antisense oligo targeting a portion of exon 2 having the sequence of App366 SEQ ID NO 3 is complementary to SEQ ID NO 3. SEQ ID NO 3 is 92% complementary to instant SEQ ID NO 25, 88% complementary to instant SEQ ID NO 26, and 100% complementary to instant SEQ ID NO 7, as shown by the following sequence alignments:
NASEQ2_04042023_145543/c
Query Match 92.0%; Score 23; DB 1; Length 31; Best Local Similarity 100.0%;
Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 3 GTTTTCTTTTGAACATCTTCTCT 25 Instant SEQ ID NO 25
|||||||||||||||||||||||
Db 31 GTTTTCTTTTGAACATCTTCTCT 9 App366 SEQ ID NO 3
NASEQ2_01282026_133315/c
Query Match 88.0%; Score 22; DB 1; Length 31;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 4 GTTTTCTTTTGAACATCTTCTC 25 Instant SEQ ID NO 26
||||||||||||||||||||||
Db 31 GTTTTCTTTTGAACATCTTCTC 10 App366 SEQ ID NO 3
NASEQ2_05122025_110002/c
Query Match 100.0%; Score 25; DB 1; Length 31;
Best Local Similarity 100.0%;
Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTTCTTTTGAACATCTTCTCTTTCA 25 Instant SEQ ID NO 7
|||||||||||||||||||||||||
Db 29 TTTCTTTTGAACATCTTCTCTTTCA 5 App366 SEQ ID NO 3
Those alignments show the nucleotides of App366 SEQ ID NO 3 correspond to 92% of the nucleobases of instant SEQ ID NO 25, 88% of the nucleobases of instant SEQ ID NO 26,and 100% of the nucleobases of SEQ ID NO 7.
Because it contains a region extending from -3 to +28, App366 SEQ ID NO 3 covers most of what happens to be the instant annealing sites +06 to +30 (SEQ ID NO 25) and +07 to +31 (SEQ ID NO 26), so a sequence complementary to SEQ ID NO 3 would anneal to an exon 2 target region of dystrophin pre-mRNA that the instant Spec. has designated as an annealing site. Also because it contains a region extending from -3 to +28, App366 SEQ ID NO 3 covers the annealing sites of claimed SEQ ID NO 7 (+02+26). Furthermore, App366 SEQ ID NO 3 is only one possible embodiment. For example, App366 also teaches (¶50) SEQ ID NO 1 which extends from +17 to +44 in relation to the exon 2 splice acceptor site. Those teachings indicate the entire region from -3 to +44 was of interest for exon 2 skipping.
App366 teaches that (¶18) in some embodiments the exon 2-targeting antisense oligo is a phosphorodiamidate morpholino oligomer which is a morpholino ring joined by a phosphorus-containing intersubunit linkage. App366 teaches (¶18) the oligo can be conjugated to a cell penetrating peptide (CPP).
As described above, App366 teaches a modified antisense oligo capable of binding a target and inducing exon skipping in human dystrophin wherein the modified antisense oligo comprises a sequence of bases complementary to an exon 2 target region of the dystrophin pre-mRNA wherein the base sequence includes instant SEQ ID NO 25 and the annealing site includes +06 to +44 (which also includes instant SEQ ID NO 26 whose annealing site includes +07 to +31). Therefore App366 teaches a modified antisense oligo comprising sequences recited in instant Claims 14-18 and 22-25.
App366 gives (¶17) examples of antisense polynucleotides containing the base T and (¶18) examples of antisense oligos containing the base U, so the antisense oligo of App366 is understood to contain thymine or uracil. Therefore App366 teaches a modified antisense oligo with some of the limitations of Claim 24.
App366 does not teach that the phosphorous-containing intersubunit linkages join a morpholino nitrogen of one ring structure to a 5' exocyclic carbon of an adjacent ring structure, or the structures recited in instant Claims 14-18 and 22-25 (including wherein at least one of R100 and R200 is a CPP.
However, US361 and WO534 teach limitations that App366 doesn’t teach.
US361 teaches antisense compositions that affect mRNA splicing and have a morpholino ring-joining-exocyclic-carbon structure. US361 is drawn to antisense compositions that inhibit natural mRNA splice processing. The abstract of US361 describes using the invention to induce exon skipping: targeting [a region having its 5’ end from 1 to about 25 base pairs downstream of a normal splice acceptor junction in the preprocessed mRNA] is effective to inhibit natural mRNA splice processing, produce splice variant mRNAs, and inhibit normal expression of the protein. US361 teaches (Col 49-50, points 10 and 16) compounds with the following structures:
PNG
media_image3.png
702
398
media_image3.png
Greyscale
PNG
media_image4.png
632
412
media_image4.png
Greyscale
US361 teaches that (Col 50 36-37) X is an integer from 6-38. The figures above show the same structure that is recited in instant Claim 14 including the “T’ moiety” wherein R200 is H. US361 show that (Col 50 L38-39) each P can be any base, including uracil and thymine. Both uracil and thymine are acceptable alternatives and an artisan would recognize that they are interchangeable alternatives because U is the RNA version of T. That indicates that uracil and thymine can be used interchangeably. The structure also shows the morpholino ring structures are joined by phosphorus-containing intersubunit linkages joining a morpholino N of one ring to a 5’exocyclic carbon of an adjacent ring structure. US361 describes that structure (Col 4 L33-63; Fig. 3).
US361 teaches that the compounds contain (Col 2 L19) an uncharged morpholino backbone and (Col 6 L43-65) teaches that the uncharged backbone favors uptake into cells and reduces non-specific binding interactions. US333 teaches that (Col 4 L40-45) the formula above is preferred because the moieties do not interfere with target binding. The US361 compounds (Col 6 L10-20) do not activate RNase H and instead act by a steric blocking mechanism.
US361 teaches (Col 21 L30-45) the compounds are 12-25 nt long and have a base sequence complementary to a target region of a selected preprocessed mRNA coding for the target protein, where the 5' end of the target region is…preferably 2-15 bases downstream, of a normal splice acceptor site in the preprocessed mRNA. US361 clarifies that (Col 8 L10-30) a “preprocessed mRNA” is an mRNA whose introns have not been spliced out. US361 teaches that (Col 8 L 1-5) the 25-base unit length allow[s] stable effective binding combined with good specificity.US333 §III. Selection of Target Sequences (begins at Col 8 L10) teaches how to select sequences to target. Specifically US361 teaches that (Col 9 L 10-32) targeting the splice acceptor is more effective than targeting the splice donor. US361 teaches (Col 13 L 40-50) when the sequence of pre-mRNA for a desired protein is known, an antisense target can be designed to alter desired regions of the protein. As described above in discussion of App366, App366 teaches (¶26, Fig. 3A and caption) that mRNA/cDNA of DMD is known.
US361 doesn’t teach that structure wherein R100 is a CPP.
However, WO534, drawn to exon skipping antisense oligos for a different target, teaches the same formula wherein R2 can be a CPP. WO534 teaches (PDF pp. 60-61) Formula VI, shown here in a modified excerpt:
PNG
media_image5.png
637
445
media_image5.png
Greyscale
PNG
media_image6.png
247
508
media_image6.png
Greyscale
WO534 teaches (PDF p. 64 L13-14) R1 can be -N(CH3)2.
As discussed above, App366 teaches (¶18) their oligo can be conjugated to a CPP.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the instant invention to modify the sequences (SEQ ID NO 3) and target region (SEQ ID NO 30) of App366 with the ASO formula of US361 (including the 25 nt length and designing the 5’ end to be within 15 nt of the splice acceptor site) and the formula wherein R2 is a CPP of WO534, for the benefits of improving nuclease resistance, increasing uptake into cells, reducing nonspecific binding, and inducing alternative splicing/exon skipping. One would have been motivated to do so with a reasonable expectation of success because US361 teaches (Col 6 L5-11) that the invention is effective to inhibit splicing at the normal splice acceptor site and thus produce splice variant mRNA, leading to truncated or otherwise aberrant versions of the selected protein upon translation and an artisan would realize that such a strategy is relevant to DMD because a similar strategy has been used regarding exon 51. (App366 ¶6 teaches “thus far” similar compounds have been effective for only mutations where the reading frame is restored by skipping exon 51.)
An artisan would have understood that they could apply US361’s morpholino formula to any antisense oligo used for exon skipping, including skipping of DMD exon 2. One would have been further motivated to do so because US361 teaches using sequences that are either shorter (12-25 nt long) or whose 5’ end is closer to the splice acceptor site (preferably 2-15 bases downstream) than the exon 2-targeting sequences of App366. By those teachings of US361, the sequences of App366 are either too long (i.e., SEQ ID NO 3 is 31 nt long and another exon 2-targeting sequence, SEQ ID NO 1, is 28 nt long) and/or the 5’ end is too far from the splice acceptor site (i.e., the 5’ end of App366 SEQ ID NO 1 is at +17). The teachings of US361 would have motivated an artisan to shorten and otherwise alter the exon 2-targeting sequences of App366 in accordance with the teachings of US361 which would produce approx. a dozen 25 nt-long sequences (to maximize binding specificity and stability) whose 5’ end is 2-15 bases downstream of the splice acceptor. Among that limited number of sequences would be instantly claimed SEQ ID NOs 25 and 26. It would have been obvious to try producing 25-mer sequences whose 5’end is with 2-15 bases downstream of the splice acceptor site because US361 teaches doing so for splice-altering antisense oligos. Performing such routine optimization of a known region and a known splice acceptor site would have produced compounds with each of the claimed SEQ ID NOs.
Regarding the CPP of WO534, it would have been obvious to apply a CPP to the R2 site of WO534’s Formula VI and the R3 site on US361’s formula because App366 teaches using a CPP which an artisan knows improves uptake to target cells and an artisan would have wanted to deliver the antisense oligo to target cells. Furthermore, WO534 is (PDF p. 2 L14-20) directed to exon skipping antisense oligos for treating a disease that affects muscles and a person of ordinary skill would have understood that DMD also affects muscles; therefore they would have understood that the CPP of WO534 could be used in the same target cell type to induce alternative splicing.
Therefore, the limitations of Claims 14-18 and 22-25 would have been obvious in view of App366, US361, and WO534.
Claims 14-18 and 22-25 are rejected under 35 U.S.C. 103 as being unpatentable over App366 (of record), in view of US361 (of record), and WO534 as applied to Claims 14-18 in the 103 rejection above, and further in view of Harding (et al. 2007. The Influence of Antisense Oligonucleotide Length on Dystrophin Exon Skipping. Molec. Ther. 15[1]:157-166, “Harding”, of record). This rejection is necessitated by the claim amendments.
The teachings of App366, US361, and WO534 as applicable to Claim(s) 14-18 and 22-25 have been described in the 103 rejection above.
App366, US361, and WO534 make obvious all the limitations of Claims 14-18 and 22-25 including the recited SEQ ID NOs and the formula comprising PMOs and a CPP.
Harding provides further reasons why it would have been obvious to try altering the antisense sequence of App366 (i.e., App366 SEQ ID NO 3) and why it would have been obvious to design antisense oligos that target the exon 2 target region of App366 (i.e., App366 SEQ ID NO 30)
Harding, drawn to the influence of ASO length on dystrophin exon skipping, teaches 25-mer is the ideal size to use to induce exon skipping in a DMD gene. The teachings of Harding indicate that testing sequences with a range of different sizes is common and routine in the art or exon-skipping ASO. Harding teaches (§Abstract) data from their studies shows that well-designed ASOs 25–31 nucleotides in length are generally more effective at inducing exon skipping than shorter counterparts but that there is an upper limit in optimal length. Harding teaches (§Discussion, final two ¶), simply designing 30-mer ASOs will not guarantee induction of exon skipping and in some cases can be counter-productive. Harding suggests a strategy of first screening 25-mer ASOs and then modifying the length as necessary after sites amenable to exon skipping are identified. Harding teaches the length of ASOs is a major parameter affecting compound performance and that 25-31-mers outperform shorter compounds. Harding notes a 25-mer as showing particularly good performance (§Discussion, final ¶): In one case, a 25mer was found to be far more effective than overlapping 30mers and a 20mer. Harding teaches that factors such as cost and ease of production are also relevant to choosing a sequence length.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the teachings of App366, US361, and WO534 with the teachings regarding 25-mers being a good length for exon-skipping ASOs of Harding for the benefit of finding ASOs that most effectively induce skipping of exon 2. One would have been motivated to do so with a reasonable expectation of success because Harding provides empirical data about testing ASOs that induce skipping of exons 16, 51, and 53, and those data led Harding to suggest designing 25-mer ASOs rather than those of longer lengths. One would have been further motivated because Harding teaches that shorter ASOs are cheaper and easier to produce. It would have been a routine matter for an artisan to take the known antisense sequence and known target region for inducing exon 2 skipping of App366 and modify it to produce shorter 25-mers because of Harding’s teachings about 25-mers being more effective. Doing so would have produced a limited number of 25-mer results and the claimed SEQ ID NOs would have been among them. Therefore modifying the known antisense sequence and known target region for inducing exon 2 skipping of App366 with the teachings of Harding would have produced the limitations of Claims 14-18 and 22-25.
Claims 14-17 and 24-25 are rejected under 35 U.S.C. 103 as being unpatentable over International Patent Application Publication No. WO 2011/078797 (published 30 June 2011, “WO797”, of record on IDS), in view of US Patent No. US 9416361, published 16 August 2016 (“US361”, of record) and International Publication Number WO 2016/138534 (published 01 September 2016, “WO534”).
WO797 teaches ASOs for treating DMD. WO797 teaches (¶7) DMD can be caused by a deletion, point mutation, or duplication that causes loss of reading frame due to a premature stop codon or a nonsense mutation due to premature termination. WO797 teaches (same ¶) ASO therapy for DMD involves inducing selected exon skipping to restore the mRNA reading frame (for frame shift mutations caused by deletion or duplication) or to remove the in-frame exon (which carries a nonsense mutation). WO797 teaches (same ¶) the ASO induces exon skipping by binding to a target site to block splicing factors during transcription which prevents the spliceosome from identifying the targeted region as an exon, causing the exon to be removed along with the introns. WO797 teaches (¶8) that produces a shorter but functional dystrophin protein that can reverse DMD phenotype or reduce disease severity.
WO797 teaches (Fig. 1) a Table that discloses SEQ ID NO 1, called AON2-1, which targets nt 4-29 of exon 2. That table/Fig. and its caption (¶104) shows that SEQ ID NO 1 produces “++” exon skipping, which means greater than 25%. The ASO WO797 SEQ ID NO 1 is a 26-mer comprises 100% identity to claimed SEQ ID NOs 8 and 36, as shown by the following sequence alignments:
NASEQ2_05122025_143443
Query Match 100.0%; Score 25; DB 1; Length 26;
Best Local Similarity 40.0%;
Matches 10; Conservative 15; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGTTTTCTTTTGAACATCTTCTCTT 25 SEQ ID NO 8
:|::::|::::|||||:|::|:|::
Db 1 UGUUUUCUUUUGAACAUCUUCUCUU 25 WO797 SEQ ID NO 1
NASEQ2_05122025_140405
Query Match 100.0%; Score 19; DB 1; Length 26;
Best Local Similarity 42.1%;
Matches 8; Conservative 11; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGTTTTCTTTTGAACATCT 19 SEQ ID NO 36
:|::::|::::|||||:|:
Db 1 UGUUUUCUUUUGAACAUCU 19 WO797 SEQ ID NO 1
Those alignments indicate that WO797 SEQ ID NO 1 comprises a sequence of bases complementary to an exon 2 target region that is an annealing site and wherein the sequence comprises claimed SEQ ID NOs 8 and 36. The nucleobases in SEQ ID NO 1 correspond to the nucleobases in claimed SEQ ID NOs 8 and 36. Since WO797 teaches (Fig. 1) SEQ ID NO 1 covers the target site 4-49, it necessarily covers the target sites +05+29 (i.e., claimed SEQ ID NO 8) and +11+29 (i.e., claimed SEQ ID NO 36). Therefore WO797 teaches some of the limitations of Claims 14-17 and 24-25, and encompasses SEQ ID NOs 8 and 36 that are recited in instant Claims 14-17, and 24-25.
WO797 teaches (¶316) using a carrier together with the ASO and that the carrier can be a CPP.
WO797 does not teach the modified ASO wherein T is thymine (Claims 24), wherein the nucleobases are linked to morpholino ring structures, wherein the morpholino ring structures are joined by phosphorus-containing intersubunit linkages joining a morpholino N of one ring to a 5’exocyclic carbon of an adjacent ring, wherein the ASO has formula I (Claims 14-17), or wherein T has the structure shown in Claim 25.
However, US361 teaches antisense compositions that affect mRNA splicing and have a morpholino ring-joining-exocyclic-carbon structure. US361 is drawn to antisense compositions that inhibit natural mRNA splice processing. The abstract of US361 describes using the invention to induce exon skipping: targeting [a region having its 5’ end from 1 to about 25 base pairs downstream of a normal splice acceptor junction in the preprocessed mRNA] is effective to inhibit natural mRNA splice processing, produce splice variant mRNAs, and inhibit normal expression of the protein. US361 teaches (Col 49-50, points 10 and 16) compounds with the following structures:
PNG
media_image3.png
702
398
media_image3.png
Greyscale
PNG
media_image4.png
632
412
media_image4.png
Greyscale
US361 teaches that (Col 50 36-37) X is an integer from 6-38. The figures above show the same structure that is recited in instant Claim 14 including the “T’ moiety” wherein R200 is H. US361 show that (Col 50 L38-39) each P can be any base, including uracil and thymine. Both uracil and thymine are acceptable alternatives and an artisan would recognize that they are interchangeable alternatives because U is the RNA version of T. That indicates that uracil and thymine can be used interchangeably. The structure also shows the morpholino ring structures are joined by phosphorus-containing intersubunit linkages joining a morpholino N of one ring to a 5’exocyclic carbon of an adjacent ring structure. US361 describes that structure (Col 4 L33-63; Fig. 3).
US361 teaches that the compounds contain (Col 2 L19) an uncharged morpholino backbone and (Col 6 L43-65) teaches that the uncharged backbone favors uptake into cells and reduces non-specific binding interactions. US333 teaches that (Col 4 L40-45) the formula above is preferred because the moieties do not interfere with target binding. The US361 compounds (Col 6 L10-20) do not activate RNase H and instead act by a steric blocking mechanism.
US361 teaches (Col 21 L30-45) the compounds are 12-25 nt long and have a base sequence complementary to a target region of a selected preprocessed mRNA coding for the target protein, where the 5' end of the target region is…preferably 2-15 bases downstream, of a normal splice acceptor site in the preprocessed mRNA. US361 clarifies that (Col 8 L10-30) a “preprocessed mRNA” is an mRNA whose introns have not been spliced out. US361 teaches that (Col 8 L 1-5) the 25-base unit length allow[s] stable effective binding combined with good specificity.US333 §III. Selection of Target Sequences (begins at Col 8 L10) teaches how to select sequences to target. Specifically US361 teaches that (Col 9 L 10-32) targeting the splice acceptor is more effective than targeting the splice donor. US361 teaches (Col 13 L 40-50) when the sequence of pre-mRNA for a desired protein is known, an antisense target can be designed to alter desired regions of the protein. As described above in discussion of App366, App366 teaches (¶26, Fig. 3A and caption) that mRNA/cDNA of DMD is known.
US361 doesn’t teach that structure wherein R100 is a CPP.
However, WO534, drawn to exon skipping antisense oligos for a different target, teaches the same formula wherein R2 can be a CPP. WO534 teaches (PDF pp. 60-61) Formula VI, shown here in a modified excerpt:
PNG
media_image5.png
637
445
media_image5.png
Greyscale
PNG
media_image6.png
247
508
media_image6.png
Greyscale
WO534 teaches (PDF p. 64 L13-14) R1 can be -N(CH3)2.
As discussed above, WO797 teaches (¶316) their oligo can be delivered with a CPP. As described above in discussion of WO797, the teachings of WO797 indicate that (¶104, Fig. 1) splice sites around exon 2 to target for exon skipping are known.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the 26-mer ASO comprising SEQ ID NO 1 of WO797 with the ASO formula of US361, including the 25 nt length, and the formula wherein R2 is a CPP of WO534 for the benefit of improving nuclease resistance, increasing uptake into cells, reducing nonspecific binding, and inducing alternative splicing/exon skipping. One would have been motivated to do so with a reasonable expectation of success because US361 teaches (Col 6 L5-11) that the invention is effective to inhibit splicing at the normal splice acceptor site and thus produce splice variant mRNA, leading to truncated or otherwise aberrant versions of the selected protein upon translation and because WO797 teaches (¶104, Fig. 1) their ASO provided greater than 25% efficiency for skipping of exon 2. The teachings of US361 would have motivated an artisan to apply formula of US361 for the stated benefits of (Col 6 L43-55) high binding, reduced nonspecific binding, improved activity and selectivity.
An artisan would have understood that they could apply US361’s morpholino formula to any antisense oligo used for exon skipping, including skipping of DMD exon 2. One would have been further motivated to do so because US361 teaches using sequences that are shorter (12-25 nt long) than theWO797 sequences.
Regarding the CPP of WO534, it would have been obvious to apply a CPP to the R2 site of WO534’s Formula VI and the R3 site on US361’s formula because WO797 teaches using a CPP which an artisan knows improves uptake to target cells and an artisan would have wanted to deliver the antisense oligo to target cells. Furthermore, WO534 is (PDF p. 2 L14-20) directed to exon skipping antisense oligos for treating a disease that affects muscles and a person of ordinary skill would have understood that DMD also affects muscles; therefore they would have understood that the CPP of WO534 could be used in the same target cell type to induce alternative splicing.
Therefore, the limitations of Claims 14-17 and 24-25 would have been obvious in view of WO797, US361, and WO534.
Response to Arguments
Applicant's arguments filed 14 November 2025 have been fully considered but they are not persuasive. Arguments that are no longer relevant are not addressed.
112(a)
A new matter rejection has been applied because the claims now recite each Nu from 1 to (n+2) and 5’ to 3’ corresponds to the nucleobases in [the recited SEQ ID NOs] but that isn’t disclosed in the Spec., claims, or any priority documents. Therefore n+2 is considered new matter.
112(b)
The claims are rejected because as amended, Claims 14-18 and 22-23 recite …each Nu from 1 to (n+2) and 5' to 3' corresponds to the nucleobases in one of the following … [SEQ ID NOs] and neither the Spec. nor the claim teaches what is each Nu from 1 to (n+2). The Spec. describes only nucleotides from 1 to (n+1) (see, e.g., p. 14 L1-3) so it’s not clear what is each Nu from 1 to (n+2).
103
The 103 rejections are maintained and updated in response to the claim amendments.
Applicant argues (pp. 11-13) the rejection over App366 and US361 is inappropriate because US361 does not teach Formula (I) wherein R100 and R200 are each H or a CPP wherein at least one of R100 and R200 is a CPP. Applicant argues that US361 is silent on CPPs. Applicant argues that there are too many possible modifications for an artisan to have arrived at the claimed compounds with any reasonable expectation of success. Applicant argues an artisan of ordinary skill wouldn’t have produced ASOs having the structure of Formula (I) because App366 doesn’t teach ASOs having that structure and they wouldn’t have any reasonable expectation of success to arrive at the claimed modifications.
Those arguments are not found persuasive.
First, regarding Applicant’s arguments that the cited references don’t teach Formula (I) wherein R100 and R200 are each H or a CPP wherein at least one of R100 and R200 is a CPP, WO534 has been added because it teaches exon skipping ASOs comprising a formula wherein the group at the R100 position is a CPP.
Although Applicant asserts that US361 is silent on CPPs, App366 teaches (¶18) using CPP-conjugated PMOs. CPPs were well-known in the art and WO534 teaches the same formula as instantly claimed wherein R2/G/R100 (all short hand for a group at the same position) is a CPP.
Furthermore, Applicant’s arguments amount to piecemeal analysis of the references. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). In this case, an artisan would have been motivated to apply the formula of US361 to the sequences that would have been obvious in view of App366 and US361 because both documents are directed to ASOs that induce alternative splicing/exon skipping and US361 teaches benefits of using uncharged RNase-inactive oligos. US361 discloses only a limited number of formulas and also teaches—as does Harding—a preference for 25-mer ASOs. WO534 is also directed to ASOs that induce alternative splicing and teaches applying the same PMO formula. Therefore an artisan would have only had to synthesize what was known or obvious in view of the prior art to produce the claimed compounds.
In response to applicant’s argument that there is no teaching, suggestion, or motivation to combine the references, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). The motivation to combine falls under an “obvious to try” rationale; see MPEP 2143(I)(E):
To reject a claim based on this rationale, Office personnel must resolve the Graham factual inquiries. Then, Office personnel must articulate the following:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem;
(2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem;
(3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success; and
(4) whatever additional findings based on the Graham factual inquiries may be necessary, in view of the facts of the case under consideration, to explain a conclusion of obviousness.
The rationale to support a conclusion that the claim would have been obvious is that "a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely that product [was] not of innovation but of ordinary skill and common sense.
In this case, regarding (1): App366 demonstrates that there was an art-recognized need for exon 2 skipping ASOs and that the target sequence was known. Harding discussed that cost and ease of production were known factors relevant to choosing an ASO sequence length.
Regarding (2): US361 teaches a preferred length of up to 25-mer ASOs and ASOs whose 5’end is preferably 2-15 bases downstream of the splice acceptor site. US361 also teaches benefits of PMOs (the uncharged backbone favors uptake into cells and reduces non-specific binding interactions; the formula provides moieties that do not interfere with target binding) and formulas of structures that can be applied to the ASOs that would result in those benefits. WO534 discloses ASOs for exon skipping that comprise the same formula as US361. An artisan would have readily recognized that two references (US361 and WO534) disclosing the same general PMO formula to apply to ASOs for exon skipping indicates it was routine and conventional to apply that formula to ASOs for exon skipping. Then including a CPP at position R100—as taught in WO534—would have provided the obvious benefit of improving uptake to cells. Furthermore, Harding teaches testing sequences with a range of different sizes is common and routine in the art of exon-skipping ASO. Together, those findings demonstrate that there were only a finite number of identified, predictable potential solutions to the recognized need or problem.
Regarding (3): the teachings in the references indicate that a person of ordinary skill cold have pursued the known potential solutions with a reasonable expectation of success. As noted in the rejection, Harding teaches a strategy of first screening 25-mer ASOs and then modifying the length as necessary after sites amenable to exon skipping are identified. Harding teaches the length of ASOs is a major parameter affecting compound performance and that 25-31-mers—and notes a 25-mer as showing particularly good performance—outperform shorter compounds. US361 teaches preferred lengths and region to target.
Notably, none of Applicant’s arguments assert that the sequences would not have been obvious in view of the prior art.
All those findings indicate that the rejection meets the criteria for the “obvious to try” rationale and the claimed invention is reasonably deemed obvious in view of the applied prior art.
The arguments over App333 are no longer relevant because that art is no longer applied.
The arguments over WO797 are not persuasive because the arguments over the other references are not persuasive.
Therefore the 103 rejection is maintained. To potentially overcome this rejection Applicant should consider submitting evidence that their ASOs produce unexpectedly superior results (e.g., on increased efficacy, cell uptake, reduced toxicity in an organism, or other benefits to the organism) compared with the closest prior art. Note that some improvements would be expected from applying PMOs to any exon skipping ASO, and any submitted evidence should show unexpectedly superior results (i.e., beyond what would have been expected based on the prior art that teaches PMOs improve cell uptake, target-binding affinity, reduced nonspecific interactions, improved activity and selectivity).
Conclusion
Claims 14-18 and 22-25 are rejected.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
RUTHIE S ARIETI
Examiner (Ruth.Arieti@uspto.gov)
Art Unit 1635
/RUTH SOPHIA ARIETI/Examiner, Art Unit 1635
/NANCY J LEITH/Primary Examiner, Art Unit 1636