Prosecution Insights
Last updated: April 19, 2026
Application No. 18/488,422

Recombinant Ranavirus, Methods of Production, and Its Use As A Mammalian Expression System

Non-Final OA §102§103§112
Filed
Oct 17, 2023
Examiner
GILL, RACHEL B
Art Unit
1671
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Trustees of the California State University
OA Round
1 (Non-Final)
66%
Grant Probability
Favorable
1-2
OA Rounds
2y 7m
To Grant
93%
With Interview

Examiner Intelligence

Grants 66% — above average
66%
Career Allow Rate
556 granted / 848 resolved
+5.6% vs TC avg
Strong +28% interview lift
Without
With
+27.8%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
48 currently pending
Career history
896
Total Applications
across all art units

Statute-Specific Performance

§101
8.8%
-31.2% vs TC avg
§103
22.5%
-17.5% vs TC avg
§102
21.7%
-18.3% vs TC avg
§112
27.4%
-12.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 848 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Disposition of Claims Claims 1-14 are pending. Examiner’s Note Applicant is encouraged to utilize the new web-based Automated Interview Request (AIR) tool for submitting interview requests; more information can be found at https://www.uspto.gov/patent/laws-and-regulations/interview-practice. All paragraph numbers, unless otherwise noted, correspond to the USPGPub of this application, US20240050549A1, Pub. 02/15/2024. Optional Authorization to Initiate Electronic Communications The Applicant’s representative may wish to consider supplying a written authorization in response to this Office action to correspond with the Examiner via electronic mail (e-mail). This authorization is optional on the part of the Applicant’s representative, but it should be noted that the Examiner may not initiate nor respond to communications via electronic mail unless and until Applicant’s representative authorizes such communications in writing within the official record of the patent application. A sample authorization is available at MPEP § 502.03, part II. If Applicant’s representative chooses to provide this authorization, please ensure to include a valid e-mail address along with said authorization. Specification – Sequence Disclosures This application contains sequence disclosures that are encompassed by the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 through 1.825 for the reason(s) set forth below. The specification is objected to because ¶[0046] comprises sequences that does not contain a specific SEQ ID NO: (see e.g. (AF; 5′ GGTATAGGCGGAAGCGCC 3′) and (AR; 5′ GAACAGAAACTGATTAGCGAAGAAGAC 3′)). It appears as though the specification has a proper sequence listing which comprises said sequences, so it is suggested the specification be amended to include the SEQ ID NOs: for each of these sequences directly following each sequence in ¶[0046]. Applicants must comply with sequence rules in order to be considered a complete response to this Office Action. Specification - Drawings Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification: The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2). The drawings are objected to because the specification refers to elements in color in the drawings, but the submitted drawings are in black and white (See e.g. ¶[0042-0043][0053].) Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Claim Rejections - 35 USC § 112(b); Second Paragraph The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 1 and dependent claims 2-6 thereof are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 is drawn to a mammalian expression system comprising an attenuated, recombinant ranavirus strain that has at least one expression element, wherein the attenuated, recombinant ranavirus strain is Ambystoma tigrinum virus and is further comprising at least one mammalian transcriptional element and at least one translational enhancement element that are incorporated into the ranavirus strain. It is unclear from the wording of the claim if the “at least one expression element” and the “at least one mammalian transcriptional element” and the “at least one translational enhancement element” are all separate, distinct elements, or if they are all attempting to recite the same thing. The specification refers to “translation enhancement elements” and “transcription enhancement elements” as both being “TEE”, wherein some TEE examples are ATVΔ40L-CMV and ATVΔ40L-TEE (¶[0041]). As the specification fails to provide further guidance as to whether or not these are the same or are distinct elements of the mammalian expression system, the metes and bounds of the claim are unclear. Since a skilled artisan would not be reasonably apprised as to the metes and bounds of the claimed invention, instant Claim 1 is rejected on the grounds of being indefinite. Claims 2-6 are also rejected since they depend from claim 1, but do not remedy these deficiencies of claim 1. Claim 2 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 2 is drawn to the mammalian expression system of claim 1, wherein the at least one mammalian transcriptional element and the at least one translational enhancement element expresses a green fluorescent protein that is fused to a selectable marker, neomycin resistance (GNR) in non-permissive cells in vitro, in differentiated primary human cells ex vivo, and in mouse lungs and trachea in vivo without viral replication. From the wording of the first part of the claim, it is unclear if the recited element within parentheses (See e.g. "(GNR)") is a required element of the claim, especially as it is unclear if “neomycin resistance” is meant to further limit the previous limitation of “selectable marker”. Turning to the specification for guidance, it appears as though “GNR” is attempting to claim a green fluorescent protein (GFP) and neomycin resistance gene (NR) fusion construct (¶[0031]). Further, as per the indefiniteness rejection supra, it is unclear if the “at least one mammalian transcriptional element” and the “at least one translational enhancement element” are separate elements or are the same element. Finally, it is unclear how the system can “express antigens” without replication at some level. It is unclear if applicant intended that the viral vector deliver the antigen without having the viral vector go through any rounds of replication (e.g. the antigen is part of the viral vector’s virion) or if the viral vector replicates its DNA in the cells but fails to produce infectious virions. It is suggested that this functional language with respect to where the GNR expresses its construct be removed from the claim, as the expression of this construct will be clear in whatever system as it should be detectable through the resistance to neomycin and/or the expression of GFP. For at least the part of the claim that refers to the fusion construct and the associated functional language, it is suggested the wording of the claim be amended along the lines of the following: “2. The mammalian expression system of claim 1, wherein the at least one mammalian transcriptional element and the at least one translational enhancement element expresses a fusion construct (GNR), wherein said fusion construct comprises a green fluorescent protein (GFP) and a neomycin resistance gene (NR).” For at least these reasons, claim 2 is rejected on the grounds of being indefinite. Claims 6, 7, and 14, and dependent claims 8-13 thereof are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 6 is drawn to “The mammalian expression system of claim 1, wherein the system delivers antigens in mammalian cells without replication while generating antiviral immunity for mammalian respiratory diseases.” while claims 7 and 14 provide methods of delivering “antigens” to a mammal without providing an expression construct, namely an attenuated ranavirus, that actually appears to comprise any claimed antigen. It is unclear as to what “antigens” are delivered (e.g. it is unclear if the expression construct itself is antigenic or is considered “the antigen” as it is heterologous to the host, or if the “antigen” is from a known mammalian pathogen, such as a bacterium (e.g. E. coli lipopolysaccharide (LPS) antigen), a virus (e.g. influenza A HA antigen), a parasite (Plasmodium falciparum HRP2 antigen), or the like. From the construction of the claim, it is unclear if the antigens which are delivered are part of the ranavirus virion itself, or if said antigens are encoded from the recombinant ranavirus genome, or both. Further, from the claim construction in claims 6 and 14, it is unclear if the antigen is the same as those which cause the mammalian respiratory diseases. The wording of the claims does not make it clear that the mammalian respiratory disease is caused by a pathogen (e.g. “mammalian respiratory disease” can be reasonably caused by non-pathogens, such as chronic obstructive pulmonary disease (COPD) caused by chronic cigarette use), so it is unclear how said disease is treated by said antigen, if said antigen must be heterologous or homologous to any pathogen that may be causing the disease, and how ultimately said antigen is incorporated into the attenuated, recombinant ranavirus. In claim 6, it is further unclear if this antigen can only work against viruses, as the claim is drawn to only “antiviral” immunity, and not immunity against other mammalian respiratory pathogens, such as Streptococcus pneumoniae. As it is unclear as to the nature of the “antigen”, how the “antigen” is incorporated into the “mammalian expression system”, and how said system would generate homologous or heterologous “antiviral immunity” to any “mammalian respiratory disease”, it is unclear as to the metes and bounds of what is being claimed in claims 6, 7, and 14. Since a skilled artisan would not be reasonably apprised as to the metes and bounds of the claimed invention, instant claims 6, 7, and 14 are rejected on the grounds of being indefinite. Claims 8-13 are also rejected since they depend from claim 7, but do not remedy these deficiencies of claim 7. Claims 9-11 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 9 is drawn to the “method of claim 7, further comprising at least one mammalian transcriptional element and at least one translational enhancement element that are incorporated into the ranavirus strain.” From the wording of claim 9, it appears as though the “translational enhancement element” and “mammalian transcriptional element” are separate entities. Transcription is the act of generating RNA from a DNA template, while translation is the act of generating proteins from an RNA template. Both processes require different regulatory elements that do not commonly function in the other process. Claims 10 and 11 then appear to claim that these two separate regulatory elements are both doing and are the same thing, wherein the elements are both delivering GNR and the elements are “ATVΔ40L-SEL-GNR, ATV∆40L-GFP or a combination thereof.” Finally, while a virus can deliver components, such as proteins, RNA, DNA, etc., as a part of the virion without the requirement that said virus goes through a round of replication, it is unclear how transcriptional/translational elements “deliver” a protein as in claim 10, especially without going through a round of viral replication in order to transcribe DNA to RNA and translate RNA to protein. For at least these reasons, the metes and bounds of claims 9-11 are unclear. Claim Rejections - 35 USC § 112(a); First Paragraph The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 3 and 6-14 are rejected under 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph, as based on a disclosure which is not enabling. The disclosure does not enable one of ordinary skill in the art to practice the invention without identification of the mammalian transcriptional and translational elements, which are critical or essential to the practice of the invention but not included in the claims. See In re Mayhew, 527 F.2d 1229, 188 USPQ 356 (CCPA 1976). First, it should be noted that it is not clear that the claimed “at least one mammalian transcriptional element and at least one translational enhancement element” are the same or separate elements per the 35 USC 112b rejections supra. The specification fails to clarify this as well, and notes the use of “unique combination of mammalian transcriptional and translational enhancement elements (TEE)” in a number of instances, but never specifically identifies these elements by name or sequence (¶[0013-0017][0031-0032][0038-0040]; Figs. 5-7). Instant claims 3 and 11 note that “wherein the at least one mammalian transcriptional element and the at least one translational enhancement element comprises ATVdel40L-SEL-GNR, ATVdel40L-GFP or a combination thereof”, but it is still unclear as to what the mammalian elements are within these designations, and the specification does not clarify. “ATV” is abbreviation for “Ambystoma tigrinum virus”, “GNR” appears to be an abbreviation for “green fluorescent protein (GFP) fused to a neomycin resistance gene (NR)”, “GFP” is for “green fluorescent protein”. “del40L” appears to be a deletion of the 40L open reading frame (ORF) of ATV, but it is unclear as to whether the deletion is a physical deletion (e.g. deletion of the entire ORF) or is a functional deletion (e.g. only a portion of the protein is deleted or there is a mutation that renders the 40L gene product non-functional.) ATV 40L encodes a protein that shares homology with a human Caspase Recruitment Domain (CARD)-like protein, which is believed to play a role in host-pathogen interactions. While 40L appears to be a non-essential gene for ATV, deletion of said gene can alter plaque morphology (Aron MM, et. al. Virus Res. 2016 Jun 2;217:107-14. Epub 2016 Mar 26.; CITED ART OF RECORD IN PARENT.) It is unclear as to what “SEL” represents. While mammalian expression elements are known in the art, the combination of elements utilized in the ATV vector system appears to be unique and essential to the ATV vector working better than with the use of native promoters or heterologous, constitutive viral promoters, such as the cytomegalovirus (CMV) promoter. The method of delivering antigens to a mammal as claimed in instant independent claims 7 and 14 also appears to require the specific use of these mammalian expression system which comprises these elements, as the specification notes the promiscuous CMV promoter did not drive expression of the heterologous genes to the same level as the unique mammalian elements (TEE)(¶[0033][0035][0043]). Further, as claim 14 is drawn to a method of delivering antigens to a mammal to reduce the occurrence of mammalian respiratory disease, wherein said method delivers the mammalian expression system comprising the claimed attenuated, recombinant ranavirus. From the construction of the claim, it is unclear if the antigens which are delivered are part of the ranavirus virion itself, or if said antigens are encoded from the recombinant ranavirus genome, or both. The wording of the claim does not make it clear that the mammalian respiratory disease is caused by a pathogen (e.g. “mammalian respiratory disease” can be reasonably caused by non-pathogens, such as chronic obstructive pulmonary disease (COPD) caused by chronic cigarette use), so it is unclear how said disease is treated by said antigen, if said antigen must be heterologous or homologous to any pathogen that may be causing the disease, and how ultimately said antigen is incorporated into the attenuated, recombinant ranavirus. Additionally, as set forth supra, the mammalian expression system comprising the attenuated ATV vector is not enabled by the disclosure, so any method of using said mammalian expression system is additionally not enabled. The mammalian transcriptional and translational enhancement elements comprised within the ATV vector are required to practice the claimed invention because said specific elements are claimed and noted in the specification as being superior to the use of known constitutive promoters, such as CMV. As a required element it must be known and readily available to the public or obtainable by a repeatable method set forth in the specification, or otherwise readily available to the public. If it is not so obtainable or available, the enablement requirements of 35 U.S.C. § 112, first paragraph, may be satisfied by a deposit of the recombinant, attenuated ATV which comprise said elements. See 37 CFR 1.802. One cannot practice the claimed invention without the recombinant, attenuated ATV which comprise said elements. Therefore, access to recombinant, attenuated ATV which comprise said elements is required to practice the invention. The specification does not provide a repeatable method for readily identifying the mammalian transcriptional and translational enhancement elements comprised within the ATV vector without access to said recombinant ATV vector described in the specification, and it does not appear to be readily available material. Deposit of the recombinant, attenuated ATV, namely those which comprise the at least one mammalian transcriptional element and the at least one translational enhancement element as noted in the vectors ATVΔ40L-SEL-GNR and ATV∆40L-GFP in a recognized deposit facility would satisfy the enablement requirements of 35 U.S.C. 112, because the strains would be readily available to the public to practice the invention claimed, see 37 CFR 1.801- 37 CFR 1.809. If a deposit is made under the terms of the Budapest Treaty, then an affidavit or declaration by applicants or someone associated with the patent owner who is in a position to make such assurances, or a statement by an attorney of record over his or her signature, stating that the deposit has been made under the terms of the Budapest Treaty and that all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon the granting of a patent, would satisfy the deposit requirements. See 37 CFR 1.808. If a deposit is not made under the terms of the Budapest Treaty, then an affidavit or declaration by applicants or someone associated with the patent owner who is in a position to make such assurances, or a statement by an attorney of record over his or her signature, stating that the deposit has been made at an acceptable depository and that the following criteria have been met: (a) during the pendency of this application, access to the invention will be afforded to one determined by the Commissioner to be entitled thereto; (b) all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon granting of the patent; (c) the deposit will be maintained for a term of at least thirty (30) years and at least five (5) years after the most recent request for the furnishing of a sample of the deposited material; (d) a viability statement in accordance with the provisions of 37 CFR 1.807; and (e) the deposit will be replaced should it become necessary due to inviability, contamination or loss of capability to function in the manner described in the specification. In addition, the identifying information set forth in 37 CFR 1.809(d) should be added to the specification. See 37 CFR 1.803 - 37 CFR 1.809 for additional explanation of these requirements. Therefore, as the guidance in the claims and specification fails to teach how to make and use the mammalian expression elements as claimed, and the ATV vectors which comprise said elements do not appear to be readily available to the public, the claims are rejected on the grounds of not being enabled. Claim Interpretation The claims in this application are given their broadest reasonable interpretation using the plain meaning of the claim language in light of the specification as it would be understood by one of ordinary skill in the art. Claim 1 is drawn to a mammalian expression system comprising an attenuated, recombinant ranavirus strain that has at least one expression element, wherein the attenuated, recombinant ranavirus strain is Ambystoma tigrinum virus and further comprising at least one mammalian transcriptional element and at least one translational enhancement element that are incorporated into the ranavirus strain. Further limitations on the mammalian expression system of claim 1 are wherein the at least one mammalian transcriptional element and the at least one translational enhancement element expresses a fusion construct (GNR), wherein said fusion construct comprises a green fluorescent protein (GFP) and a neomycin resistance gene (NR)(claim 2); wherein the at least one mammalian transcriptional element and the at least one translational enhancement element comprises ATVΔ40L-SEL-GNR, ATV∆40L-GFP or a combination thereof (claim 3); wherein the expression element expresses at least two proteins (claim 4); wherein the expression element expresses at least two proteins fused together (claim 5); and wherein the system delivers antigens to mammalian cells without replication in order to elicit an immune response against said antigen (claim 6). Claim 7 is drawn to a method of delivering antigens to a mammal, comprising: providing a mammalian expression system comprising an attenuated, recombinant ranavirus strain that has at least one expression element; and administering to the mammal a therapeutic amount of the attenuated, recombinant ranavirus strain that has at least one expression element. Further limitations on the method of claim 7 are wherein the attenuated, recombinant ranavirus strain is Ambystoma tigrinum virus (claim 8); further comprising at least one mammalian transcriptional element and at least one translational enhancement element that are incorporated into the ranavirus strain (claim 9), wherein the at least one mammalian transcriptional element and the at least one translational enhancement element encodes GNR (claim 10), wherein the at least one mammalian transcriptional element and the at least one translational enhancement element comprises ATVΔ40L-SEL-GNR, ATV∆40L-GFP or a combination thereof (claim 11); wherein the expression element expresses at least two proteins (claim 12); wherein the expression element expresses at least two proteins fused together (claim 13). Claim 14 is drawn to a method of delivering antigens to a mammal to reduce the occurrence of mammalian respiratory disease, comprising: providing a mammalian expression system comprising an attenuated, recombinant ranavirus strain that has at least one expression element; and administering to the mammal a therapeutic amount of the attenuated, recombinant ranavirus strain that has at least one expression element. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention. Claims 1 and 4 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Jancovich et. al. (Jancovich JK, et. al. J Virol. 2011 May;85(10):5061-9. Epub 2011 Mar 9; CITED ART OF RECORD IN PARENT; hereafter “Jancovich”). The Prior Art Jancovich teaches a recombinant ranavirus, namely recombinant Ambystoma tigrinum virus (ATV), that has been engineered to have a knock-out mutation of the eIF2alpha viral homolog ORF57R, wherein said ORF57R has a heterologous gene inserted into said open reading frame (ORF) and disruption of said ORF renders the resulting virus attenuated (entire document; see abstract; instant claim 1). A selectable marker replaced the entire ORF57R reading frame, and encoded the G418 resistance marker from the ICP18 promoter (Fig. 1). As the resulting attenuated virus still encoded other viral proteins, this reads on the limitation of instant claim 4. For at least these reasons, Jancovich teaches the limitations of instant claims 1 and 4, and anticipates the invention. Claims 1-6 are rejected under 35 U.S.C. 102(a1) as being anticipated by Aron et. al. (Aron MM, et. al. Virus Res. 2016 Jun 2;217:107-14. Epub 2016 Mar 26.; CITED ART OF RECORD IN PARENT; hereafter “Aron”.) The Prior Art Aron teaches generation of recombinant ranaviruses, namely recombinant Ambystoma tigrinum virus (ATV), by insertion of an expression cassette into the selected open reading frame (ORF). Said selectable marker was green fluorescent protein (GFP) fused to a neomycin resistance gene (NR) and was labeled “GNR”, and was under the control of a heterologous viral promoter from CMV (Fig. 1; Sect. 3.1; instant claims 1-2, 4-5). Aron teaches that the ORFs 40L and 54R were noted as non-essential genes, and that it is likely the virus with the 40L deletion is attenuated (Sect 4, See p. 113, rt. col., ¶2). As the instant specification teaches an attenuated virus with a deletion of the 40L ORF, and in light of the 35 USC 112a and b rejections supra, wherein at least one reasonable interpretation is that the ranavirus proteins themselves are antigens and the ATV comprises a deletion of the 40L ORF and encodes GNR, the del40L virus of Aron appears to be structurally the same as those viruses of instant claims 3 and 6. For at least these reasons, Aron teaches the limitations of instant claims 1-6, and anticipates the invention. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 7-14 are rejected under 35 U.S.C. 103 as being unpatentable over Aron as applied to claims 1-6 above and Jancovich as applied to claims 1 and 4 above, and further in view of Boyce (US6238914B1, Iss. 05/29/2001; hereafter “Boyce”.) The Prior Art The teachings of Aron and Jancovich have been set forth supra. While both teach ranavirus vector systems that are capable of delivering heterologous materials, neither explicitly teach the use of said vector in delivering heterologous genes to a mammal. However, as suggested by Boyce, viruses which are traditionally non-mammalian viruses can be used to express exogenous genes in mammalian cells, such as for use in gene therapy or to elicit a vaccine response in said mammal. Boyce teaches methods of expressing an exogenous gene in a mammalian cell, involving infecting the cell with a non-mammalian virus whose genome carries an exogenous gene, and growing the cell under conditions such that the gene is expressed (entire document; see abstract.) Boyce teaches that ranaviruses may be those non-mammalian viruses used in such a system (Table 1). Boyce teaches that the non-mammalian virus may be engineered to include elements to aid in gene expression in a mammalian host, such as promoters as transcriptional elements and RNA splicing signals or polyA tails to aid in the translation of the heterologous gene (Cols. 9-10; Figs. 1-4; instant claim 9) and can be used to elicit an immunoprotective immune response in a mammal to a heterologous antigen through vaccination (Col. 20, lines 48-55). Boyce teaches that neomycin resistance genes can be engineered into the vector, and since Boyce teaches the typically non-permissive cells are harboring the vector in vitro, this teaches the limitations of instant claim 10 (Fig. 5; instant claim 10). Boyce teaches the vector may comprise two or more heterologous proteins (Figs. 1-5; instant claim 12), Boyce teaches that fusion proteins may be expressed, such as fusions between the viral coat proteins (e.g., gp64) and a targeting molecule (e.g., VSV-G or VCAM) can be expressed on the virion (Col. 25, ¶3; instant claim 13). Boyce teaches that respiratory disease viruses can have their antigens delivered, such as influenza (Col. 25, ¶3) and the non-mammalian viral vector can be within a pharmaceutical composition for delivery through intranasal or intrabronchial administration, such as nasal drops or aerosols (Col. 27, ¶5). Given the teachings of Aron and Jancovich, one of skill in the art would be apprised as to how to generate ranavirus vectors, especially those from Ambystoma tigrinum virus (ATV). Given the teachings of Boyce, one of skill in the art would be apprised as to the use of said non-mammalian viruses, such as ranaviruses, for delivery of heterologous genes to mammalian cells. Therefore, arriving at the limitations of instant claims 7-14 would be obvious to a skilled artisan, given the combined teachings of Aron and Jancovich. It would have been obvious to one of ordinary skill in the art to modify the methods and compositions taught by Jancovich and Aron in order to generate ATV-based vectors, therefore generating a system that could deliver heterologous antigens, potentially in mammalian hosts. One would have been motivated to do so, given the suggestion by Boyce that ranaviruses could be engineered to express heterologous genes in a mammalian host. There would have been a reasonable expectation of success, given the knowledge that Boyce teaches what elements would be engineered into the non-mammalian virus to aid in gene expression in a mammalian cell. Thus, the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art at the time the invention was made. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RACHEL B GILL whose telephone number is (571)272-3129. The examiner can normally be reached on M to F 8:00 AM to 5:00 PM Eastern. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Michael Allen can be reached on (571) 270-3497. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /RACHEL B GILL/ Primary Examiner, Art Unit 1671
Read full office action

Prosecution Timeline

Oct 17, 2023
Application Filed
Feb 13, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600751
MODIFIED S2 SUBUNIT OF THE CORONAVIRUS SPIKE PROTEIN
2y 5m to grant Granted Apr 14, 2026
Patent 12584918
MULTIPLEXED LATERAL FLOW ASSAY FOR DETECTION OF HPV ASSOCIATED CANCER
2y 5m to grant Granted Mar 24, 2026
Patent 12582684
COMPOSITIONS AND METHODS FOR THE TREATMENT OF WOUNDS, DISORDERS, AND DISEASES OF THE SKIN
2y 5m to grant Granted Mar 24, 2026
Patent 12584146
SYNTHETIC MODIFIED VACCINIA ANKARA (SMVA) BASED CORONAVIRUS VACCINES
2y 5m to grant Granted Mar 24, 2026
Patent 12564628
EPSTEIN-BARR VIRUS NUCLEIC ACID CONSTRUCTS AND VACCINES MADE THEREFROM, AND METHODS OF USING SAME
2y 5m to grant Granted Mar 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
66%
Grant Probability
93%
With Interview (+27.8%)
2y 7m
Median Time to Grant
Low
PTA Risk
Based on 848 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month