Prosecution Insights
Last updated: May 29, 2026
Application No. 18/489,441

ASSAY FOR DETECTION OF SARS-COV-2

Non-Final OA §103§112§DOUBLEPATENT§DP
Filed
Oct 18, 2023
Examiner
YU, TIAN NMN
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Imam Abdulrahman Bin Faisal University
OA Round
1 (Non-Final)
55%
Grant Probability
Moderate
1-2
OA Rounds
1y 3m
Est. Remaining
69%
With Interview

Examiner Intelligence

Grants 55% of resolved cases
55%
Career Allowance Rate
43 granted / 78 resolved
-4.9% vs TC avg
Moderate +14% lift
Without
With
+13.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
49 currently pending
Career history
134
Total Applications
across all art units

Statute-Specific Performance

§101
1.5%
-38.5% vs TC avg
§103
53.3%
+13.3% vs TC avg
§102
11.7%
-28.3% vs TC avg
§112
11.1%
-28.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 78 resolved cases

Office Action

§103 §112 §DOUBLEPATENT §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Information Disclosure Statement The information disclosure statements (IDS) submitted on 10/18/2023 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Status of Claims This office action is in response to Applicant's Response to Election / Restriction filed on April 02, 2026. No claims amendment are made in the response filed on 04/02/2026. Claims 1-20 are currently pending, with claims 2, 4, 10 and 20 withdrawn. Claims 1, 3, 5-9 and 11-19 are under consideration. This is the first action on the merits. Election/Restrictions Applicant’s election with traverse of Group I (Claims 1-19) 1, in the reply filed on April 02, 2026 is acknowledged. The traversal is on the Applicant's assertion that "no reasons and/or examples have been provided to support the Office's conclusion that the groups are unrelated" (Remarks, page 3) and there is no serious search burden (Remarks, page 4). Applicant's arguments have been fully considered but are not found persuasive. In this instant case, the restriction requirement is properly made. As stated in the restriction requirement (mail date 03/12/2026), and reiterated here: " Restriction to one of the following inventions is required under 35 U.S.C. 121: I. Claims 1-19, drawn to methods of detecting SARS-CoV in a sample, classified in C12Q 1/6844. II. Claim 20, drawn to a kit comprising a reverse transcriptase, a polymerase, and a primer set, classified in C12Q 2521/10. The inventions are independent or distinct, each from the other because: Inventions I and II are directed to an unrelated product and process. Product and process inventions are unrelated if it can be shown that the product cannot be used in, or made by, the process. See MPEP § 802.01 and § 806.06. In the instant case, the inventions as claimed are independent or distinct because the methods of Group I and the kit of Group II are unrelated. The method of Group I does not require the kit of Group II. In fact, the inventions have different designs, modes of operation, and effects because Group I specifically requires RT-PCR reagents and a defined primer set with specific sequences, as disclosed in Table 1 in the specification. In contrast, the kit of Group II comprises LAMP reagents and broadly recites a universal primer set without any defined structural features. Therefore, Inventions I and II are not usable together because the kit of Group II is not sufficient to carry out the methods of Group I. Restriction for examination purposes as indicated is proper because all the inventions listed in this action are independent or distinct for the reasons given above and there would be a serious search and/or examination burden if restriction were not required because one or more of the following reasons apply: Group I would require a search in at least C12Q 1/6844 along with a unique text and sequence search. Group II would not be searched as above and would require a search in at least C12Q 2521/10 along with a unique text search." (Requirement for Restriction/Election - 03/12/2026, page 2-3) As evidenced above, the prior Office Action clearly outlines the reasons why invention Groups I and II are independent or distinct, going beyond a mere conclusory statement. The prior Office Action also provided reasons for the existence of a search burden. For further clarification, the kit in Group II and the method in Group I are not related as a product and its process of use. This is because the kit is not recited to comprise reagent components required by the method in Group I, such as RT-PCR reagent and the specific primer sets claimed. As such, the kit in Group II is insufficient to carry out the method in Group I. The requirement is still deemed proper and is therefore made FINAL. Applicant's election with traverse of the following species in the reply filed April 02, 2026 is acknowledged: Species of primer set: E-ID1 (set 7)2; Species of amplification Reaction: A) Colorimetric RT-LAMP (see in specification, page 31-32; claim 9) 3. The traversal is on the ground that "[t]he Office has not provided any reasons or examples to support a conclusion that the species are indeed patentably distinct." (Remarks, page 2) This argument is not persuasive. As stated in the restriction requirement (mail date 03/12/2026), and reiterated here: "The species are independent or distinct because the different species recite separate characteristics of such species, and there is no disclosure of relationship between species (see MPEP § 806.04(b)). In addition, these species are not obvious variants of each other based on the current record. The species necessitate separate searches, leading to serious search and/or examination burden (see MPEP § 808.01(a)) because the Species of primer set reflect different structures and functions, resulting in separate searches; the Species of amplification Reaction result in search requirements for different assaying steps and compositions with different mechanisms, materials, and detection means. " (Requirement for Restriction/Election - 03/12/2026, page 4) "There is a serious search and/or examination burden for the patentably distinct species as set forth above because at least the following reason(s) apply: The species require a different field of search (e.g., searching different classes/subclasses or electronic resources, or employing different search queries); and/or the prior art applicable to one species would not likely be applicable to another species; and/or the species are likely to raise different non-prior art issues under 35 U.S.C. 101 and/or 35 U.S.C. 112, first paragraph." (Requirement for Restriction/Election - 03/12/2026, page 5) Therefore, these species in the species groups are directed to independent and patentably distinct inventions, and there would be a serious search and/or examination burden if species election is not required. The requirement is still deemed proper and is therefore made FINAL. Claims 2, 4, 10 and 20 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention. Examination on the merits commences on claims 1, 3, 5-9 and 11-19. Priority The priority date of the instant claims 1, 3, 5-9 and 11-19 is October 18, 2023, filling date of the present application. No domestic or foreign priority claim has been made by the Applicant according to the latest filling receipt (11/01/2023). Claim Interpretation In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111. For the purpose of applying prior art, claim 1 recites the term "SARS assay," which is not expressly defined in the claims or in the specification with any structural or compositional features, that could distinguish "SARS assay" from any assay composition known in the prior art. Therefore, under BRI, the term "SARS assay" is interpreted to encompass any assay composition, as the descriptive language "SARS" merely states the intended purpose of the composition, rather than defining a structural limitation. See In re Gardiner 171 F.2d 313 (C.C.P.A. 1948) (CCPA 12/07/48) (in a claim reciting “A valve comprising an annular seat, a ball adapted to close the seat, and a central jet passage ahead of the seat …,” “the word ‘jet’ is not a definition of the structure, but merely indicates the purpose for which the passage is used,” and thus did not impart patentability over prior art lacking a “jet” passage). Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claims 1, 3, 5-9 and 11-19 are rejected under 35 U.S.C. 112(b), as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. A) Regarding claim 1, it recites: A method of detecting SARS-CoV in a sample, comprising: contacting the sample with a primer set and one or more reverse transcription polymerase chain reaction (RT-PCR) reagents to form a reaction mixture; reverse transcribing a target sequence of a SARS-CoV nucleic acid sequence in the sample into complementary DNA (cDNA); amplifying the cDNA by incubating the reaction mixture at a temperature and for a time sufficient to amplify the target sequence of the SARS-CoV nucleic acid sequence in the sample; assaying the sample with a SARS assay to detect the amplified target sequence of the SARS-CoV nucleic acid sequence; and detecting a presence of the amplified target sequence of the SARS-CoV nucleic acid sequence, thereby detecting SARS-CoV in the sample, wherein the primer set is selected from the group consisting of:N-ID5 (Set-1),N-ID15 (Set-2), N-ID15nlL (Set-3), S-ID17 (Set-4), S-ID24 (Set-5),E-ID1 (Set-7), and RdRp-ID37 (Set-8). According to Table 1 in the specification, the primer sets recited: "N-ID5 (Set-1),N-ID15 (Set-2), N-ID15nlL (Set-3), S-ID17 (Set-4), S-ID24 (Set-5),E-ID1 (Set-7), and RdRp-ID37 (Set-8)" are primer sets specifically for RT-LAMP. Thus, claim 1 recites a method comprising contacting a sample with a RT-LAMP primer set and RT-PCR reagents to form an amplification reaction mixture. This limitation is indefinite because RT-PCR and RT-LAMP are different assays with different requirements for reaction conditions (see Loop-mediated isothermal amplification - Wikipedia; Archived July 16, 2021 on WaybackMachine); it is unclear why RT-PCR reagents are combined with LAMP primers, and whether the claim requires an RT-LAMP assay, an RT-PCR assay, or somehow a combination of both. The specification does not resolve this ambiguity. It does not clearly define the term "reverse transcription polymerase chain reaction (RT-PCR) reagents," nor does it describe performing RT-LAMP and RT-PCR simultaneously in the same reaction. Additionally, the specification does not indicate that the RT-LAMP primers disclosed (e.g., in Table 1) are suitable for use in RT-PCR. To the contrary, it is well understood in the art that LAMP and RT-PCR assays require different primer designs and reaction conditions, thus primers designed for LAMP are not directly applicable to RT-PCR for the same target 4. Accordingly, the scope of the claimed amplifying step with the reaction mixture comprising a RT-LAMP primer set and reverse transcription polymerase chain reaction (RT-PCR) reagents, is unclear. For the purpose of compact prosecution and applying prior art under 35 USC§ 102 and 103, the term "reverse transcription polymerase chain reaction (RT-PCR) reagents" is interpreted as encompassing any amplification reagents. B) Regarding claim 1, it recites "wherein the primer set is selected from the group consisting of:N-ID5 (Set-1),N-ID15 (Set-2), N-ID15nlL (Set-3), S-ID17 (Set-4), S-ID24 (Set-5),E-ID1 (Set-7), and RdRp-ID37 (Set-8)," which is indefinite because the claim omits the structural and compositional features of these primers sets as defined in the specification. The specification in Table 1 discloses these recited primer sets as comprising specific combinations of RT-LAMP primers with defined sequence structures. Accordingly, the structural features of each primer set, including the sequences of the individual primers and their combinations, are expressly provided and defined in the specification. MPEP 2173.05(s) states: “Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience." Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993).” Therefore, according to MPEP, claims should be self-contained and clearly define the invention without relying on external references. This approach ensures clarity and avoids potential ambiguity in interpreting the scope of the claims. In this instant case, claim 1 is indefinite because it refers to primer sets listed in Table 1 of the specification, without clearly reciting their structural features in the claim. The primers and their sequences defined by SEQ ID NOs for each primer set can be readily incorporated into the claim, therefore merely referring to the names of the primer set without reciting their structural characteristics constitutes an improper incorporation by reference. Applicant is advised to amend the claim to explicitly recite the structural features of each primer set. For example: "wherein the primer set E-ID1 (Set-7) consist of five primers: F3: TCATTCGTTTCGGAAGAGA (SEQ ID NO: 37); B3:AGGAACTCTAGAAGAATTCAGAT (SEQ ID NO: 38); FIP:TGTAACTAGCAAGAATACCACGAAACAGGTACGTTAATAGTTAATAGCG (SEQ ID NO: 39); BIP: GCTTCGATTGTGTGCGTACTCGAGAGTAAACGTAAAAAGAAGG (SEQ ID NO: 40); LB:GCTGCAATATTGTTAACGTGAGTC (SEQ ID NO: 41) " Claims 3, 5-9 and 11-19 are rejected for depending from claim 1 and not remedying the indefiniteness. C) Regarding claim 8, it recites "wherein the SARS assay is a colorimetric RT-LAMP assay and a fluorometric RT-LAMP assay," which is indefinite because it is unclear whether the claim requires a single RT-LAMP assay that is both colorimetric and fluorometric, or alternatively either a colorimetric RT-LAMP assay or a fluorometric RT-LAMP assay. The specification describes colorimetric RT-LAMP assay and fluorometric RT-LAMP assay as separate assays performed under different reaction conditions (page 31-32), and does not describe an assay that is both at the same time. Further, dependent claim 9 recites "wherein the SARS assay is the colorimetric RT-LAMP assay" which indicates that the intended scope in claim 8 may be alternative embodiments. However, the use of "and" in claim 8 renders the scope under. For the purpose of compact prosecution and applying prior art under 35 USC§ 102 and 103, claim 8 is interpreted, in light of the specification, as requiring the RT-LAMP assays as alternatives. Claims 9 and 11 are rejected for depending from claim 8 and not remedying the indefiniteness. D) Regarding claim 15, it recites "the colorimetric RT-LAMP assay and the fluorometric RT-LAMP assay," which lack antecedent basis. The claim and its base claim 1 does not previously recite "colorimetric RT-LAMP assay" or "fluorometric RT-LAMP assay." E) Regarding claim 17, it recites "the colorimetric RT-LAMP assay and the fluorometric RT-LAMP assay," which lack antecedent basis. The claim and its base claim 1 does not previously recite "colorimetric RT-LAMP assay" or "fluorometric RT-LAMP assay." F) Regarding claim 18, it recites "the target sequence in the sample was amplified within 20 minutes and up to 120 minutes," which is indefinite. This claim language is unclear because it does not clearly specify a definite time range for amplification. It is ambiguous whether the claim requires amplification to occur within 20 minutes, within a range of 20 to 120 minutes, or at any time up to 120 minutes. The phrase "within 20 minutes and up to 120 minutes" is internally inconsistent and fails to set clear metes and bounds. Additionally, the use of past tense (" was amplified") in the claimed method renders the scope of the claim further indefinite, as it is not clear whether this limitation is intended to describe a required step of the claimed method, or merely to describe a result. Method claims are limited by their active steps rather than intended results or outcomes. Claim 18 further recites "the colorimetric RT-LAMP assay and the fluorometric RT-LAMP assay," which lacks antecedent basis. The claim and its base claim 1 does not previously recite "a colorimetric RT-LAMP assay" or "a fluorometric RT-LAMP assay." Accordingly, one of ordinary skill in the art would not be able to determine the scope of claim 18 without applying considerable speculation and assumption. Consequently, claim 18 is excluded from prior art search in this examination, as any rejection based on prior art cannot be based on speculations and assumptions, see In re Steele, 305 F.2d 859, 862 (CCPA 1962). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1, 3, 6-9 and 12-17 are rejected under 35 U.S.C. 103 as being unpatentable over Alhamid (Alhamid et al. Colorimetric and fluorometric reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay for diagnosis of SARS-COV-2; medRxiv 2022.08.30.22279408; doi: doi.org/10.1101/2022.08.30.22279408; Published September 01, 2022.) , in view of Jamwal (Jamwal et al. Optimization and validation of RT-LAMP assay for diagnosis of SARS-CoV2 including the globally dominant Delta variant. Virol. J. 18, 178 (2021).), as evidenced by Wikipedia (Reverse Transcription Loop-mediated Isothermal Amplification - Wikipedia; Archived July 11, 2022 on WaybackMachine). A) Alhamid teaches methods for detecting SARS-COV-2 using Colorimetric and fluorometric RT-LAMP assays (Abstract). Regarding claim 1, Alhamid teaches a method of detecting SARS-CoV in a sample, comprising: contacting the sample with a primer set and one or more amplification reagents to form a reaction mixture (page 9, “RT-LAMP assay”); reverse transcribing a target sequence of a SARS-CoV nucleic acid sequence in the sample into complementary DNA (cDNA) (page 9, “RT-LAMP assay”; page 6, reverse transcription and amplification take place simultaneously in RT-LAMP); amplifying the cDNA by incubating the reaction mixture at a temperature and for a time sufficient to amplify the target sequence of the SARS-CoV nucleic acid sequence in the sample (page 9, “RT-LAMP assay” “Colorimetric RT-LAMP mixtures were incubated in a thermal block at 70 ºC for 45 minutes.” ; RT-LAMP assay comprises generating cDNA via reverse transcription and amplifying cDNA, as evidenced by Wikipedia); assaying the sample with a SARS assay to detect the amplified target sequence of the SARS-CoV nucleic acid sequence (Fig. 2-4; SARS-CoV-2 S-gene-specific RT-LAMP assays); and detecting a presence of the amplified target sequence of the SARS-CoV nucleic acid sequence, thereby detecting SARS-CoV in the sample (Fig. 2-4). Alhamid teaches using the same primer sets for Colorimetric and fluorometric RT-LAMP assay (page 9, “RT-LAMP assay”). Alhamid also teaches Colorimetric RT-LAMP has additional benefits such as potential for point of care testing, shorter reaction time, simpler implementation, lower cost, not requiring specialized equipment and trained personnel, and results can be interpreted by a simple color visualization (page 22, conclusions). While Alhamid teaches performing both colorimetric and fluorometric RT-LAMP assays by targeting E genes of SARS-CoV-2 genomes, it does not specifically teach the LAMP E gene primer set as elected and claimed ꟷ E-ID1 (Set-7), which comprises five primers with sequences as defined in SEQ ID Nos: 37-41. Jamwal similarly teaches fluorometric RT-LAMP assay for SARS-COV-2 detection (Abstract). Jamwal teaches a LAMP primer set targeting E genes of SARS-CoV-2, comprising the identical primers as primer set E-ID1 (Set-7) in the present disclosure (Table 1, primer set E1). Jamwal teaches that its primers sets are carefully designed with primer binding sites well conserved in all the variants of concern (VOC) and variants of interest (VOI) (Abstract; Table 2) It would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to apply Jamwal’s primer sets for detecting SARS-COV 2 to Alhamid’s Colorimetric RT-LAMP assay. Both references teach performing RT-LAMP assay for detecting SARS-COV2 and its variants. Alhamid teaches performing and comparing Colorimetric and fluorometric RT-LAMP assays, while Jamwal focuses on performing fluorometric RT-LAMP assay. These teachings are in the same field of molecular diagnostics using RT-LAMP assays, sharing the common objective of detecting the SARS-COV2 virus. Alhamid describes designing and testing many different primer sets, including those previously used by others (page 7-page 8, "Primers designed for the S gene have also been used by others (Yan et al. 2020)…. Many different primer sets were designed and tested. "). Thus, a skilled artisan would readily appreciate that the RT-LAMP primer sets taught in Jamwal's fluorometric RT-LAMP assay could also be used in the Colorimetric RT-LAMP described in Alhamid, with a reasonable expectation of success. As Alhamid’s disclosure suggests that its colorimetric assay employs the same primer set as fluorescent assay and indicates compatibility with primer sets disclosed in other references. A skilled artisan, driven by the need to improve assay for SARS-COV2 detection (Alhamid, Abstract, lines 1-4), would have been motivated to apply Jamwal’s primer sets for detecting SARS-COV2 to Alhamid’s Colorimetric RT-LAMP assay, in order to leverage the benefit of Colorimetric RT-LAMP, as taught by Alhamid, and benefit of the primer sets with highly conserved primer binding sites suitable for detection across variants, as taught by Jamwal. B) Regarding claim 3, Jamwal teaches a LAMP primer set targeting E genes of SARS-CoV-2, comprising the identical primers as primer set E-ID1 (Set-7) in the present disclosure, comprises five primers, the primers having at least sequences of forward outer (F3), forward inner (FIP), backward outer (B3), backward inner (BIP), and loop backward (LB) (Table 1, primer set E1). Regarding claim 6, Alhamid teaches the amplifying is a reverse-transcription loop- mediated isothermal amplification (RT-LAMP) process (page 9, “RT-LAMP assay”). Regarding claim 7, Alhamid teaches extracting nucleic acid from the sample (page 8, “Samples and RNA extraction”). Regarding claim 8, Alhamid teaches a colorimetric RT-LAMP assay (page 9, “RT-LAMP assay,” lines 1-5). Regarding claim 9, Alhamid teaches mixing a master mix, a primer mix, the sample, and dH2O to form a colorimetric RT-LAMP mixture (page 9, “RT-LAMP assay,” lines 1-5); and incubating the colorimetric RT-LAMP mixture in at a constant temperature for at least 30 minutes (page 9, “RT-LAMP assay,” lines 6-7, “Colorimetric RT-LAMP mixtures were incubated in a thermal block at 70 ºC for 45 minutes”). Although Alhamid teaches performing the LAMP assay incubation using a thermal block, a skilled artisan would understand that a water bath is another obvious choice for achieving the same incubating function, as evidenced by Wikipedia (page 3, “The required temperature can be achieved using a simple hot water bath.”). Regarding claim 12, Alhamid teaches SARS-CoV-2 (Abstract). Regarding claim 13, Alhamid teaches Omicron (B.1.1.529) (page 7, line 6). Regarding claim 14, Alhamid teaches wherein the target sequence of the SARS-CoV nucleic acid sequence is located within at least one gene selected from the group consisting of nucleocapsid (N), spike (S), RNA-dependent RNA polymerase (RdRp), and envelope (E) of a SARS-CoV genome (page 7, lines 2-4, “The current study demonstrates both colorimetric and fluorometric LAMP assays by targeting N, RdRp, S and E genes of SARS-CoV-2 genomes”). Regarding claim 15, Alhamid teaches detecting a presence of the amplified target sequence of the SARS-CoV nucleic acid sequence (Fig. 2-4). The rest of recited limitations regarding "an accuracy of at least 94 % for the colorimetric RT-LAMP assay and the fluorometric RT-LAMP assay, wherein accuracy is based on colorimetric RT-LAMP assay results and fluorometric RT-LAMP assay results compared to reverse transcription real-time polymerase chain reaction (RT-qPCR) assay results" is interpreted as descriptive languages that do not further limit the claimed method. MPEP§ 2111.04 states: "Claim scope is not limited by claim language that suggests or makes optional but does not require steps to be performed, or by claim language that does not limit a claim to a particular structure." Also per MPEP 2111.04, a wherein clause can limit a method claim if it contributes meaning and purpose to the manipulative steps. In this instant case, the recitations regarding "an accuracy of at least 94 %" does not introduce any additional steps or modify any existing step, particularly when the claim does not recite any steps of performing any of the colorimetric RT-LAMP assay, fluorometric RT-LAMP assay or RT-qPCR assay. Therefore, this recitation does not clearly make a manipulative difference to the claim scope. Therefore, the recited accuracy limitation does not distinguish the claimed method from prior art methods that disclose the claimed steps. Regarding claim 16, it recites "wherein the primer set is E-ID1 and has a limit of detection of 20 copies/µL. " Jamwal teaches a LAMP primer comprising the identical primers as primer set E-ID1 (Set-7) in the present disclosure (Table 1, primer set E1). This limitation regarding “a limit of detection of 20 copies/µL” is obvious in view of the combined teachings of Alhamid and Jamwal because it does not further limit the claimed method. MPEP§ 2111.04 states: "Claim scope is not limited by claim language that suggests or makes optional but does not require steps to be performed, or by claim language that does not limit a claim to a particular structure." In this instant case, the recitation regarding a “limit of detection of 20 copies/µL” does not introduce any additional steps or modify any existing step. It merely states a desired capability of the method and does not make a manipulative difference to the claim scope. Therefore, this claim language is interpreted as descriptive statement without any associated active steps and do not distinguish the claims from the prior art. Regarding claim 17, Jamwal teaches a LAMP primer comprising the identical primers as primer set E-ID1 (Set-7) in the present disclosure (Table 1, primer set E1). The recitations describing that the primer set "amplifies a conserved region in the SARS-CoV-2 E gene as early as 20 minutes with no cross-reactivity with other respiratory viruses, including other SARS, wherein the SARS assay has a specificity of at least 96 % for the colorimetric RT-LAMP assay and the fluorometric RT-LAMP assay, wherein specificity is based on colorimetric RT-LAMP assay results and fluorometric RT-LAMP assay results compared to RT-qPCR assay results, " are interpreted as descriptive languages that do not further limit the claimed method. MPEP§ 2111.04 states: "Claim scope is not limited by claim language that suggests or makes optional but does not require steps to be performed, or by claim language that does not limit a claim to a particular structure." Also per MPEP 2111.04, a wherein clause can limit a method claim if it contributes meaning and purpose to the manipulative steps. In this instant case, the recitations regarding the functional capabilities of the primer set, such as "amplifies a conserved region in the SARS-CoV-2 E gene as early as 20 minutes with no cross-reactivity… " is interpreted as intended result that do not further limit the claimed method as it merely states a desired capability of the primer set and does not make a manipulative difference to the claim scope. Therefore, it does not distinguish the claimed method from prior art methods that disclose the claimed steps using the claimed primer set. The "wherein" clauses do not introduce any additional steps or modify any existing step, particularly when the claim does not recite any steps of performing any of the colorimetric RT-LAMP assay, fluorometric RT-LAMP assay or RT-qPCR assay. Therefore, this recitation does not clearly make a manipulative difference to the claim scope. Claims 5 and 11 are rejected under 35 U.S.C. 103 as being unpatentable over Alhamid, in view of Jamwal, as applied to claims 1 and 8 above and further in view of Moore (Moore et al. Loop-Mediated Isothermal Amplification Detection of SARS-CoV-2 and Myriad Other Applications. J Biomol Tech. 2021 Sep;32(3):228-275. doi: 10.7171/jbt.21-3203-017. PMID: 35136384; PMCID: PMC8802757), as evidenced by Lucigen (LavaLAMP™ RNA Component Kit; Archived May 03, 2019 on WaybackMachine ). The teachings of Alhamid and Jamwal are recited above and applied as for claim base claims 1 and 8. Regarding claim 5, Alhamid teaches amplification reagents comprise at least one reverse transcriptase, at least one deoxyribose nucleic acid (DNA) polymerase (Page 9, line 7, Lava lamp RNA enzyme acts as both reverse transcriptase and DNA polymerase for amplification, see Lucigen, page 15 ), deoxyribonucleotide triphosphates (dNTPs) (Page 9, line 8), magnesium ions (Page 9, line 8), a buffer (page 9, lines 6-7). While the combined teachings of Alhamid and Jamwal do not explicitly disclose amplification reagents comprising betaine, this feature would have been obvious in light of prior art knowledge within the specific context of performing LAMP assays, as supported by Moore. Moore is a review article on LAMP assays for SARS-COV-2 detection and other applications (Abstract). Moore specifically emphasizes the "inherent flexibility" and adaptability of LAMP assays, suggesting that assay optimization is a routine and common practice in laboratories (Figure 1): "The series of choices (and corresponding compromises) that one makes to create a test that is fit for a specific purpose is a common theme: regardless of one’s setting, budget, or scale of testing, “there is a LAMP for that”(Fig. 1). " (page 230, left-hand col, lines 13-16) Moore teaches betaine is a known enhancer for improving LAMP assay performance: "Although most LAMP assays use a relatively standard range for the absolute and relative concentrations of each primer (0.2 μM F3/B3, 0.4 μM Loop F/B, 1.6 μM BIP/FIP), this practice is common but not absolute (e.g., Allgower et al. 2020). For example, reducing the F3/B3 concentration relative to the other 4 primers can sometimes improve efficiency (Sridar Chittur, June 2021, personal communication). Alternatively, doubling the concentration of loop primers can increase sensitivity, whereas, in other cases, somewhat counterintuitively, complete omission of 1 of the loop primers can also enhance assay specificity and/or amplification efficiency (S. Chittur, personal communication). Similar to PCRs, modifications to primer concentrations and altering reaction conditions ([Mg2+]; dNTP; buffer type; and addition of “enhancing” additives, such as betaine, dimethylsulfoxide [DMSO], and notably, GnHCl; Zhang et al. 2020b) can lead to improved assays. " (page 243, left-hand col, para 1) Therefore, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to include betaine as a reagent in the LAMP reaction mixture in the combined teachings of Alhamid and Jamwal, to enhance assay performance, as suggested by Moore. The reasonable expectation of success is apparent here, as Moore explicitly teaches that betaine is a known enhancer for improving LAMP assay performance. Regarding claim 11, Moore teaches addition of “enhancing” additives, including guanidine hydrochloride in LAMP reaction (page 243, left-hand col, para 1, lines 14-16, GnHCl is guanidine hydrochloride) Claim 19 is rejected under 35 U.S.C. 103 as being unpatentable over Alhamid, in view of Jamwal , as applied to claim 1 above and further in view of FDA (Coronavirus (COVID-19) Update: FDA Authorizes First Oral Antiviral for Treatment of COVID-19; December 22, 2021). The teachings of Alhamid and Jamwal are recited above and applied as for claim base claim 1. Regarding claim 19, the combined teachings of Alhamid and Jamwal disclose a colorimetric RT-LAMP assay for the detection of SARS-COV-2 in a sample from a subject. While Alhamid and Jamwal do not explicitly teach treating the subject, this feature is an obvious step in view of the context in the combined teaching ꟷ the purpose of detecting SARS-COV-2 for diagnosis is to enable medical practitioners to make informed treatment decisions for the patient. Effective COVID-19 treatment depends on a positive and timely diagnosis, as demonstrated by the FDA's authorization of Pfizer’s Paxlovid, which is available by prescription only and should be initiated as soon as possible after diagnosis of COVID-19, and within five days of symptom onset (see FDA, page 1, para 1). Therefore, treating a subject is an obvious and logical next step following a positive diagnosis of COVID-19 based on detection of SARS-COV-2 in a sample from the subject. Double Patenting- Obvious Type The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 3, 6-9, 11-15 and 19 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3-6, 8, 10-11, 14 and 19 of copending Application No. 18/415,814 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are anticipated by the claims (filed on 01/18/2024) of the '814 application. Instant claim 1 recites: A method of detecting SARS-CoV in a sample, comprising: contacting the sample with a primer set and one or more reverse transcription polymerase chain reaction (RT-PCR) reagents to form a reaction mixture (‘814 Application, claim 1); reverse transcribing a target sequence of a SARS-CoV nucleic acid sequence in the sample into complementary DNA (cDNA) (‘814 Application, claim 1); amplifying the cDNA by incubating the reaction mixture at a temperature and for a time sufficient to amplify the target sequence of the SARS-CoV nucleic acid sequence in the sample(‘814 Application, claim 1); assaying the sample with a SARS assay to detect the amplified target sequence of the SARS-CoV nucleic acid sequence (‘814 Application, claim 1); and detecting a presence of the amplified target sequence of the SARS-CoV nucleic acid sequence, thereby detecting SARS-CoV in the sample (‘814 Application, claim 1), wherein the primer set is selected from the group consisting of:N-ID5 (Set-1),N-ID15 (Set-2), N-ID15nlL (Set-3), S-ID17 (Set-4), S-ID24 (Set-5),E-ID1 (Set-7) (‘814 Application, claim 1), and RdRp-ID37 (Set-8). Therefore, instant claims 1, 3 and 12 and are anticipated by claim 1 of the '814 application. Instant claims 6; 7; 8; 9; 11; 13; 14; 15; 19 are anticipated by claims 4; 5; 6; 8; 3; 10; 11; 14; 19 of the '814 application, respectively. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Prior Art Below are relevant prior art not used in rejection but pertinent to the claims or disclosure. Alhamid2 6(Alhamid et al. ; Development of Loop-mediated Isothermal Amplification (LAMP) Assays Using Five Primers Reduces the False-positive Rate in COVID-19 Diagnosis; medRxiv 2022.10.18.22281181; doi.org/10.1101/2022.10.18.22281181; Published Posted October 22, 2022) also teaches performing colorimetric RT-LAMP assays for SARS-COV-2 detection. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TIAN NMN YU/Examiner , Art Unit 1681 /AARON A PRIEST/Primary Examiner, Art Unit 1681 1 Claim 20 is withdrawn as being drawn to non-elected group II. 2 Claim 2, 4 are withdrawn as being drawn to non-elected species N-ID5 (Set-1),N-ID15 (Set-2), N-ID15nlL (Set-3), S-ID17 (Set-4), S-ID24 (Set-5), S-setl 1 (Set-6), and RdRp-ID37 (Set-8). 3 Claim 10 is withdrawn as being drawn to non-elected species B. 4For example, see Foo et al. Loop-mediated isothermal amplification (LAMP) reaction as viable PCR substitute for diagnostic applications: a comparative analysis study of LAMP, conventional PCR, nested PCR (nPCR) and real-time PCR (qPCR) based on Entamoeba histolytica DNA derived from faecal sample. BMC Biotechnol. 2020 Jun 22;20(1):34. doi: 10.1186/s12896-020-00629-8. PMID: 32571286; PMCID: PMC7310076., see Table 1, PCR and LAMP assay for the same target gene require different primer sets. 6 Alhamid2 qualifies as prior art, because its publication date on October 22, 2022 precedes the currently effective filling date on October 18, 2023. Additionally, Alhamid2 includes additional authors other than the inventors in this present application.
Read full office action

Prosecution Timeline

Oct 18, 2023
Application Filed
Apr 29, 2026
Non-Final Rejection mailed — §103, §112, §DOUBLEPATENT (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12630884
METHOD OF SELECTING RUMINATING ANIMALS FOR A DESIRABLE HEREDITABLE TRAIT
6y 3m to grant Granted May 19, 2026
Patent 12630870
Partition-free digital PCR (dPCR) system
6y 3m to grant Granted May 19, 2026
Patent 12618101
SHERLOCK ASSAYS FOR TICK-BORNE DISEASES
4y 7m to grant Granted May 05, 2026
Patent 12612664
DETECTION AND ANALYSIS OF METHYLATED DNA
4y 11m to grant Granted Apr 28, 2026
Patent 12606859
CELL CAPTURE USING DU-CONTAINING OLIGONUCLEOTIDES
5y 3m to grant Granted Apr 21, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
55%
Grant Probability
69%
With Interview (+13.6%)
3y 10m (~1y 3m remaining)
Median Time to Grant
Low
PTA Risk
Based on 78 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month