DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 7/17/2026. Claims 1-5, 10-11, 16-21, and 23-25 are pending. Claims 1, 10-11, and 19-20 have been amended. Claims 6-9, 12-15, 22, and 26-41 have been cancelled. Claim 25 is withdrawn from consideration because it is directed to a non-elected invention. Claims 1-5, 10-11, 16-21, and 23-24 are currently under examination.
Election/Restrictions
The Applicant’s election of Group I without traverse, to read on claims 1-5, 10-11, 16-21, and 23-24 is acknowledged. The Applicant has further elected the species of a base sequence of SEQ ID NO 2110 and SEQ ID NO 2220, with modified sense strand SEQ ID NO 1890 and modified antisense strand SEQ ID NO 2290. The Applicant elects SEQ ID NO: 570 as the FN3 domain. The election of species was made without traverse in the reply filed 7/17/2026. Claim 25 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 7/17/026.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-5, 10, and 23-24 are rejected under 35 U.S.C. 103 as being unpatentable over Min (Min et al. “RNA Interference from Biology to Clinical Applications.” Springer Sciences, 2010), in view of Schmitz (Schmitz JC et al. Silence. 2011 Jan 19;2(1):1), NCBI NM_001322421 (hereafter ‘421, NCBI BLAST Accession NM_001322421, Human CD40 mRNA transcript variant 5, published 2018), Akinc (WO 2016/179342 A2), Kenski (Kenski DM et. al. Mol Ther Nucleic Acids. 2012 Jan 24;1(1):e5), Haraszti (Haraszti RA et. al. Nucleic Acids Res. 2017 Jul 27;45(13):7581-7592).
Note that this rejection is made in light of both the Applicant’s election of nucleobase sequences SEQ ID NOs 2110 and 2220 as well as their modified versions of SEQ ID NOs 1890 and 2290.
Regarding claim 1, Min is a molecular biology textbook which focuses on interfering RNA and its uses in biological and clinical applications (Title, throughout). Min teaches a chapter specifically on using siRNAs to target CD40 in vivo (Chapter 11, pages 173-188). Min teaches siRNA specific delivery systems for targeting dendritic cells by using siRNA to target CD40 (Title, Abstract, throughout Chapter 11, pages 173-188). Specifically, Min teaches that:
“CD40 siRNA was incorporated within the interior of 86 nm liposomes, which were decorated with surface-bound mAb NLDC-145 as a targeting mechanism. The siRNA encapsulation efficiency was determined to be approximately 7%. CD40 siRNA immunoliposomes (CD40 siILs) were able to specifically bind to DCs and silence CD40 expression in vitro…Furthermore, CD40 siIL-treated mice were found to have an increased proportion of Treg cells (CD4+CD25+ FoxP3+), and DCs cells from these mice were able to inhibit T cell proliferation in an antigen-specific recall response. In summary, CD40 siILs were shown to specifically target and deliver CD40 siRNA to DCs, significantly reducing CD40 expression and resulting in DC-mediated immune modulation as well as generation of Treg cells. These findings highlight the therapeutic potential for siRNA-based and DC-mediated immunotherapy in the clinic,” (Abstract, page 173).
Thus, Min teaches that targeting CD40 using siRNA specifically designed against CD40 is a known technique and strategy which has been reduced to practice and is useful in therapeutic applications in vivo (Abstract on page 173). Furthermore, Min teaches that siRNAs can be chemically modified in order to improve pharmacokinetic delivery of siRNAs (page 190, third paragraph). Min further teaches that:
“most studies have used synthetic 21-mer dsRNAs with 19-base central double-stranded domains with 2-base overhangs at 3’, recent successes in RNAi have been reported with other designs of siRNA; for example, blunt 19-mer duplexes
with various internal 2’-O-methyl modifications, which may be efficacious and resistant to nuclease,” (page 316, first paragraph).
Min therefore teaches that siRNAs are known to comprise a core 19-mer duplex with a two base overhang, where such siRNAs can be chemically modified in order to improve nuclease resistance (page 316, first paragraph). Min further teaches that siRNA strands are 19-21 duplexes which target complementary mRNA strands (page 174, second paragraph).
Min, while teaching 19-21 siRNA duplexes which target CD40 does not specifically teach SEQ ID NOs 2110 and 2220. Min does not teach the specific chemical modification patterns of SEQ ID NOs 1890 and 2290.
As an initial matter, SEQ ID NOs 2110 and 2220 are shown below, where SEQ ID NO: 2220 is shown in 3’ to 5’ orientation:
5’ agaaacagttcaccttgaa 3’ SEQ ID NO: 2110
3’ tttctttgtcaagtggaactt 5’ SEQ ID NO: 2220
As shown above, the duplex of SEQ ID NOs 2110 and 2220 comprise a core 19-mer complementary region, where SEQ ID NO: 2220 comprises a 2 base (thymines) overhang at the 3’ end. Thus, the SEQ ID NO: 2110/2220 duplex follows a standard siRNA structure, such as that taught by Min (above).
Regarding the use of a two T overhang at the 3’ end, Schmitz is a research article that focuses on 3’ overhangs in siRNA molecules, and therefore directly overlaps with the subject matter of Min (i.e., siRNAs). Schmitz teaches that: “siRNAs contain two nucleotide overhangs on their 3’ end. While these overhangs are usually comprised of deoxythymidines (dT), it has been shown that any nucleotide can be used on the 3’ end without affecting RNAi silencing,” (Abstract). Thus, Schmitz teaches that it is widely known that siRNAs comprise two T nucleotides at the 3’ end as an overhang, where furthermore the overhang can also be basically any nucleotide without affecting siRNA activity.
With regards to the specific sequences of SEQ ID NOs 2110 and 2220, these are simply known sequences within the human CD40 mRNA transcript, as taught by ‘421 (see below for alignment of ‘421 with SEQ ID NO: 2220):
PNG
media_image1.png
410
1255
media_image1.png
Greyscale
Thus, as taught by ‘421, the instant sequence of SEQ ID NO: 2220 (and inherently the sense strand of SEQ ID NO: 2220, namely SEQ ID NO: 2110) is simply a part of the known mRNA strand of human CD40, where Min has already taught that CD40 should be targeted by siRNA as a valuable therapeutic.
Regarding the Applicant’s elected species of chemical modifications to SEQ ID NOs 2110 and 2220, the Applicant has elected chemical and linkage modifications as shown in SEQ ID NOs 1890 and 2290. SEQ ID NO: 1890 comprises the base sequence of SEQ ID NO 2110, with the following chemical modifications:
2’-O methyl modifications at positions 1-2, 4-6, 10-11, 13-16, and 18-19
2’-Fluoro modifications at positions 3, 7-9, 12, and 17
Phosphorothioate linkages at positions 1-3
SEQ ID NO 2290 comprises the base sequence of SEQ ID NO: 2220 with the following chemical and linkage modifications:
2’O methyl modifications at positions 1, 3-13, and 15-21
2’-Fluoro modifications at positions 2 and 14
Phosphorothioate linkages at positions 1-3 and 19-21
Vinyl phosphonate uridine at position 1
Regarding the phosphorothioate linkages at the 5’ and 3’ ends of the siRNAs, Akinc is a patent document which focuses on RNAi agents (i.e., siRNA) and their uses to target specific genes (Title, Abstract, and throughout). Akinc teaches that the inclusion of phosphorothioate nucleotide linkage modifications at the 5’ and 3’ ends of an siRNA molecule is a known practice in designing siRNAs in general (page 45, second paragraph). Akinc teaches that modifications prevent exonuclease degradation (page 79, first paragraph). Furthermore, Akinc teaches and reduces to practice siRNAs which comprise phosphorothioate linkage modifications at the 5’and 3’ ends, such as those recited in instant SEQ ID NOs 1890 and 2290 (e.g., Table 27 at page 216, row “AD-73598,” where “s” represents a phosphorothioate linkage per page 15, paragraph 6 of Akinc). Thus, the practice of using phosphorothioate linkages at the 3’ and 5’ ends of siRNA is a known strategy which has been taught and reduced to practice, where furthermore such strategies are know to reduce degradation from nucleases such as exonucleases, per Akinc (above).
Regarding the 2’-O methyl and 2’-Fluoro modifications in SEQ ID NOs 1890 and 2290, Kenski is a research article that focuses on modifying siRNAs for enhanced in vivo delivery and activity (Title, Abstract, and throughout). Min and Kenski therefore directly overlap in subject matter because they are drawn to the same types of molecules, siRNA, as well as how to modify such molecules for effective delivery. Kenski teaches that:
“The most widely used and commercially available modifications in siRNAs have been limited to ones discovered over 10 years ago in the antisense field and developed at the 2′ position of the ribose ring including 2′-methoxy (2′-OMe), 2′-fluoro (2′-F), and 2′-O-methoxyethyl (2′-MOE). 2′-OMe and 2′-F modifications are well tolerated at multiple positions in the siRNA guide strand due to their small size that is comparable to the natural RNA 2′-OH. They provide increased stability, increased specificity and reduced immunogenicity. The structures of other, larger, 2′-O-modifications such as 2′-O-MOE and 2′-O-allyl modifications caused attenuated silencing activity. These modifications were tolerated in only a very position-specific manner within the guide strand,” (page 1, right column, second paragraph).
Thus, Kenski not only teaches that modifications such as 2’-F and 2’-OMe are widely known and used in the industry, but also teaches that such modifications are well-tolerated throughout the molecule, and further teaches that such modifications have known benefits which would motivate a practitioner to include them in an siRNA molecule because such modifications improve stability, specificity, and reduce immunogenicity (above).
Furthermore, Haraszti is a research article that focuses on improvements of the efficacy of siRNAs, and therefore directly overlaps with Min who teaches general clinical applications of siRNA. Haraszti teaches that:
“5-Vinylphosphonate modification of siRNAs protects them from phosphatases, and improves silencing activity. Here, we show that 5-vinylphosphonate confers novel properties to siRNAs. Specifically, 5-vinylphosphonate (i) increases siRNA accumulation in tissues, (ii) extends duration of silencing in multiple organs and (iii) protects siRNAs from 5 -to-3 exonucleases,” (Abstract)
Thus, Haraszti teaches that the addition of 5’-vinyl phosphonate to siRNA is a known strategy which improves the performance of siRNAs (above).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify to siRNAs which target CD40 as taught by Min to include the sense and antisense strands of instant SEQ ID NOs 2110 and 2220m as taught by ‘421, because such a combination is the simple substitution of one known prior art element for another with predictable success. In the present case, the practitioner would simply substitute the sequences of siRNA which target CD40 taught by Min with known mRNA targets taught by ‘421. Furthermore, the results are predictable because the target sequence is already known to be part of the CD40 mRNA, where furthermore targeting CD40 using siRNA has already been reduced to practice as taught by Min. Furthermore, with regards to the specific chemical and linkage modifications, including 2’-O methyl, 2’-Fluoro, 5’ and 3’ phosphorothioate linkages, and 5’ vinyl phosphonate modifications, each of these modifications is already known in the art and further taught with highly motivational teachings to include such modifications in siRNA because such modifications are known to improve the performance of siRNAs in vivo. The combination is therefore obvious and predictable owing to the strong motivational teachings to include such modifications and also the fact that such modifications are known to render functional siRNAs, where the results are therefore predictable.
Regarding claims 2-3, Akinc teaches that siRNAs can comprise covalently bound linkers at the 3’ and 5’ ends of siRNAs (e.g., paragraph page 22, third paragraph).
Regarding claims 4-5, as discussed above, Haraszti teaches 5’-vinyl phosphonate modifications at the 5’ end of the sense or antisense strand of the siRNA (Abstract).
Regarding claim 23, Akinc teaches that such siRNAs can be formulated in pharmaceutical compositions (page 83).
Regarding claim 24, the term “kit” broadly encompasses the elements of claim 1, where such elements are provided. Given that claim 1 is rendered obvious by the combination of prior art references of record, and further that such compositions are known to be useful in therapeutics, a practitioner could immediately envision providing such elements as a kit.
Claim 11 is rejected under 35 U.S.C. 103 as being unpatentable over Min (Min et al. “RNA Interference from Biology to Clinical Applications.” Springer Sciences, 2010), in view of Schmitz (Schmitz JC et al. Silence. 2011 Jan 19;2(1):1), NCBI NM_001322421 (hereafter ‘421, NCBI BLAST Accession NM_001322421, Human CD40 mRNA transcript variant 5, published 2018), Akinc (WO 2016/179342 A2), Kenski (Kenski DM et. al. Mol Ther Nucleic Acids. 2012 Jan 24;1(1):e5), and Haraszti (Haraszti RA et. al. Nucleic Acids Res. 2017 Jul 27;45(13):7581-7592), as applied to claims 1-5 and 10 above, and further in view of Darimont (CA 3123619 A1, published 2020).
A discussion of the teachings of Min, Schmitz, ‘421, Akinc, Kenski, and Haraszti is provided above in the rejection of claims 1-5 and 10 and incorporated here.
Regarding claim 11, while the prior art reference Akinc teaches linkers to be used with siRNA, does not teach that the linker is Val-Cit-PABA as recited in claim 11.
Darimont is a patent document which focuses on the use of siRNA conjugates and their uses in therapeutics (Title, Abstract, and throughout, for instance see Example 2). Thus, Darimont is in general drawn to the use of siRNAs which can be conjugated to other ligands for therapeutics, where Darimont teaches that such conjugation strategies have beneficial therapeutic effects (e.g., see Example 2). For instance, Darimont teaches that siRNAs can be bound to an antibody via a linker (Example 2). Furthermore, Darimont also teaches that Val-Cit-PABA linkers can be used to bind siRNAs to ligands (e.g., paragraph 306).
It would have been obvious to a person of ordinary skill in the art to modify the teachings of Min, ‘421, Schmitz, Akinc, Kenski, and Haraszti to include Val-Cit-PABA linkers with the siRNA constructs as taught by Darimont because such a combination is the simple combination of known prior art elements with predictable success. In the present case, Darimont has already taught siRNA linkers which are useful to link siRNA with other functional ligands and proteins such as antibodies, where such applications have known uses in in vivo therapeutics, where furthermore Darimont teaches that the Val-Cit-PABA linker is known and is useful as a linker in their siRNA/linker compositions.
Claims 16-21 are rejected under 35 U.S.C. 103 as being unpatentable over Min (Min et al. “RNA Interference from Biology to Clinical Applications.” Springer Sciences, 2010), Schmitz (Schmitz JC et al. Silence. 2011 Jan 19;2(1):1), NCBI NM_001322421 (hereafter ‘421, NCBI BLAST Accession NM_001322421, Human CD40 mRNA transcript variant 5, published 2018), Akinc (WO 2016/179342 A2), Kenski (Kenski DM et. al. Mol Ther Nucleic Acids. 2012 Jan 24;1(1):e5), and Haraszti (Haraszti RA et. al. Nucleic Acids Res. 2017 Jul 27;45(13):7581-7592), as applied to claims 1-5, 10, and 23-24, above, and further in view of Addis (US 2021/0145976 A1, published 5/20/2021). The rejection is evidenced by Lippitsch (Lippitsch A et al. Cell Immunol. 2017 Jun;316:41-52).
A discussion of the teachings of Min, Schmitz, ‘421, Akinc, Kenski, and Haraszti is provided above in the rejection of claims 1-5 and 10 and incorporated here.
Regarding claim 16, Min, Schmitz, ‘421, Akinc, Kenski, and Haraszti do not teach that the siRNA further comprises one or more FN3 domains conjugated to the siRNA.
Addis is a patent document which teaches FN3 domains which are conjugates of siRNA molecules (e.g., see Example 6 of Addis, paragraph 259). Furthermore, Addis teaches that CD71 is a known receptor which is a useful target for drug delivery and therapeutics (paragraph 4). Addis further teaches that the FN3 is a useful scaffold for binding to CD71, and further teaches the therapeutic approach of conjugating siRNAs to FN3 binding domains (paragraphs 5-6, Example 6). Addis teaches that:
“CD71, also known as transferrin receptor 1, is transmembrane that is essential for iron transport into cells. It is highly expressed on many tumor types and at the blood brain barrier, and has thus become an important target for drug delivery. Following binding to iron loaded transferrin, CD71 is rapidly endocytosed and efficiently recycled back to the cell surface. Studies with CD71 antibody drug conjugates suggest that targeting CD71 can improve specificity and selectivity of drug delivery and widen the therapeutic index, (paragraph 4).
Addis therefore teaches that CD71 can be a useful target on cells which express CD71 owing improved specificity and selectivity of drug delivery using conjugates (above, paragraph 4).
Furthermore, as evidenced by Lippitsch, it is known that dendritic cells, such as those cells which are targeted for siRNA knockdown in the methods of Min, are known to highly express CD71 (see Abstract and throughout).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the siRNAs rendered obvious by Min, Schmitiz, ‘421, Akinc, Kenski, and Haraszti with FN3 conjugated to said siRNA as taught by Addis because such a combination is the simple combination of known prior art elements with predictable success. In the present case, the practitioner would be motivated to adopt the teachings of Addis because Addis teaches that such siRNA-FN3 conjugates have known therapeutic and drug delivery advantages in cells presenting CD71, where it was known in the art that dendritic cells such as those used in the methods of Min express CD71. Thus, the targeting strategy of conjugating FN3 domains to CD71 binding domains would apply to the same cell types as those taught by Min (dendritic cells).
Regarding claim 17, Addis teaches that the siRNA and FN3 are conjugated via a cysteine residue (paragraph 259).
Regarding claim 18, Addis teaches that the FN3 domain binds CD71 (paragraph 259, also see Abstract).
Regarding claims 19-20, Addis teaches that the FN3 domain which binds CD71 can be SEQ ID NO: 146. An alignment of Addis’ SEQ ID NO: 146 and Applicant’s elected species of SEQ ID NO: 570 is shown below in alignment:
PNG
media_image2.png
230
763
media_image2.png
Greyscale
As shown above, SEQ ID NO 146 of Addis matches 86/90 (95.5%) with instant SEQ ID NO: 570.
Regarding claim 21, as shown above, SEQ ID NO: 146 of Addis is a 95% match, where furthermore two of the substitutions are simply conservative substitutions (L and V and T and S, as shown above by the dotted line in the alignment). Thus, the overall percent identity of matching and conservative substitutions between Addis SEQ ID NO: 146 and instant SEQ ID NO: 570 is 88/90, or ~98%. Additionally, Addis teaches that SEQ ID NO: 146 can be mutated and comprise for instance 90% sequence identity with SEQ ID NO: 146, where such a mutant would read on instant SEQ ID NO: 570 (paragraph 90 of Addis). Furthermore, Addis teaches that: “It has been shown that one such lg protein, the tenth fibronectin type III (FN3) repeat from human fibronectin, can
tolerate a number of mutations in surface exposed loops while retaining the overall lg-fold structure,” (paragraph 6). Thus, Addis teaches that it is known in the art that FN3 domains are highly tolerant to mutations.
It would have been obvious to a person of ordinary skill in the art before the effective filing date to arrive at instant SEQ ID NO: 570 by modification to SEQ ID NO: 146 of Addis, where such a combination is the simple substitution of one element for another with predictable success. In the present case, the practitioner would be making only four amino acid changes, two of which are simply known conservative mutations (see alignment, above). Furthermore, with respect to the remaining two residues, the changes of such residues is recited with no effect, where furthermore Addis teaches that the FN3 domains are highly tolerant to mutations (paragraph 6). Thus, minor changes to the FN3 domain are known to be tolerated, where the two residues which are mutated with non-conservative mutations can be arrived at by simple substitution of one known amino acid for another, where the results are predictable because Addis teaches that it is known in the art that FN3 is highly tolerant to such mutation.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.C.R./Examiner, Art Unit 1635
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Prosecution Insights