DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
The Office acknowledges the receipt of Applicant’s restriction election filed August 6, 2025. Applicants herby elect, with traverse. Applicant elects Group I, claims 1-13, 28 and 29. Because an election of Group V or VI is not made, no election of species is made. Groups 2-16 are pending. Groups 2-16 (Claims 14-27, and 30-46) are withdrawn from examination. Group I. Claims 1-13, 28 and 29, drawn to a lettuce plant comprising a modified LsKO2 gene are examined in the instant application.
Applicants additionally request withdrawal of the restriction requirement and assert that the inventions are not distinct and that search and examination of all groups would not constitute a serious burden.
The traversal has been considered but is not persuasive. The restriction requirement is maintained because the inventions as set forth in Groups1-16 are independent or distinct as required by MPEP § 803, and because examination of the non-elected groups would impose a serious burden on the Office. In particular, the groups are directed to different genetic loci and/or different types of subject matter. As previously set forth, these groups are directed to structurally and functionally distinct genes. LsKO2 encodes a Cytochrome P450 monooxygenase, whereas Ls20ox1-B encodes a GA 20-oxidase. These enzymes belong to different protein families and operate at different points within the gibberellin biosynthetic pathway. A search and examination of both groups would pose a serious burden on the Office because: (1) Divergent Prior Art: The prior art applicable to a P450 enzyme (CYP701 family) would not likely be applicable to a 20-oxidase (DIOX family); (2)Different Fields of Search: Searching these distinct gene families requires different search strings, different database queries, and the review of non-overlapping sets of scientific literature.
Consequently, the requirement for restriction and species election is proper and is hereby made FINAL
Claim Status
Claims 1-46 are pending.
Claims 14-27, and 30-46 are withdrawn as a result of Restriction Requirement.
Claims 1-13, 28 and 29 are currently amended.
Claims 1-13, 28 and 29 are examined on the merits.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 1-13 and 28-29 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 is rejected as indefinite for the recitation “the wild-type LsKO2 … having at least 70% sequence identity to SEQ ID NO: 9”. The recitation “The wild-type LsKO2” is not defined with reasonable certainty. The claim does not identify a specific wild-type reference sequence e.g., a particular allele/cultivar/accession or SEQ ID NO) and instead relies on “at least 70% sequence identity “ to characterize “wild-type”. Because “wild-type “ can vary among lettuce varieties/accessions, and because a 70% identity threshold encompasses a wide range of divergent sequences that may not correspond to a wild-type LsKO2 allele, a person of ordinary skill in the art cannot determine with reasonable certainty which sequences are encompassed by the term “wild-type LsKO2”.
Also, there is internal inconsistency for dependent “position-based” limitations when identity allows indels. For example, claim 10-11 further recite a specific nucleotide substitution “at position 1102 of SEQ ID NO:9”. However, when claim 1 allows sequence only required to be ≥70% identical, the presence of insertions/deletions and alignment differences can make correspondence to “position 1102” ambiguous unless the claim (or specification) defines how positions are mapped (e.g., position umbering strictly on SEQ ID NO:9 and indemnity measured over the full-length alignment with specified parameters). As written, the interplay of “≥70% identity” and position-specific recitations contributes to uncertainty as to claim scope.
Dependent claims 2-9, 12-13 and 28-29 are rejected as indefinite for failing to correct the indefiniteness in claim 1.
Claim 10 recites the limitation " of claim 1, wherein the stop codon is the result of…" in page 2. There is insufficient antecedent basis for this limitation in the claim.
Claim 11 recites the limitation " of claim 2, wherein the stop codon is the result of…" in page 2. There is insufficient antecedent basis for this limitation in the claim.
Claim 10 is interpreted as dependents on claim 4. Claim 11 is interpreted as dependents on claim 5. It should be noted that such treatment does not relieve applicants of the responsibility of responding to this rejection. Moreover, if the intended meaning of the claim is different than that posited by the Examiner, additional 35 U.S.C. § 112 and prior art rejections may be readily applied in a subsequent office action.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Written Descriptions
Claims 1-13 and 28-29 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The Federal Circuit has clarified the application of the written description requirement. The court stated that a written description of an invention "requires a precise definition, such as by structure, formula, [or] chemical name, of the claimed subject matter sufficient to distinguish it from other materials". University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568; 43 USPQ2d 1398, 1406 (Fed. Cir. 1997). The court also concluded that "naming a type of material generally known to exist, in the absence of knowledge as to what that material consists of, is not description of that material". Id. Further, the court held that to adequately describe a claimed genus, Patent Owner must describe a representative number of the species of the claimed genus, and that one of skill in the art should be able to "visualize or recognize the identity of the members of the genus". Id.
Claim 1 and the dependent claims 2-13 and 28-29 regard the “the wild-type LsKO2 gene…having at least 70% sequence identity to SEQ ID NO.: 9 ”.
The specification describes (1) a particular lettuce KO2 sequence (SEQ ID NO:9) and/or a limited number of KO2 alleles, (2) specific EMS events (e. g., substitution of a cytosine by a thymine at position 1102 of SEQ ID NO:9) that disrupt the KO2 coding regions, and (3) experimental data for a limited set of mutated lettuce lines demonstrating the reported phenotype under the described screening conditions.
The claims, as broadly as require possession of a genus of “wild-type LsKO2” genes defined by 70% or more sequence identity to SEQ ID NO: 9, with “modifications” that result in an absence of functional KO2 protein, and further require that homozygous presence of such modified genes results in a shade tolerance phenotype.
The specification does not reasonably convey to one of ordinary skill that the investors are in possession of the full claimed genus. The specification does not provide representative species spanning the full breadth of LsKO2 sequences encompassed by the ≥70% identity boundary, not does it identify structural features common to the full claimed genes that would allow a skilled artisan to distinguish which sequences within the ≥70% identity genus are in fact “LsKO2” genes whose loss of function results in a shade tolerance phenotype. Applicant only provides “a representative number of species” to support a genus. Explicitly state that the specification provides only one wild-type sequence (SEQ ID NO: 9) and a single type of mutation (C-to-T at 1102). Argue that a single species cannot support a genus that encompasses thousands of potential sequences at the 70% identity level. Furthermore, the claim requires that the modification results in "shade tolerance", the specification doesn't prove that every gene with 70% identity to LsKO2 is even involved in the shade-avoidance pathway.
LsKO2 is best read as a lettuce kaurene oxidase 2 gene, i. g., a cytochrome P450 (CYP701A-type) enzyme involved in early gibberellin (GA) biosynthesis, classically catalyzing the multi-step oxidation of ent-kaurene to form ent-kaurenoic acid (a key GA precursor, refers to KO in Arabidopsis), (Chris A Helliwell et. al., Plant Physiology, 119(2):507–510, 1999). Under BRI, claim 1 encompasses a lettuce plant comprising a “modified LsKO2 gene”, where the wild-type LsKO2 is defined by ≥70% coding-sequence identity to SEQ ID NO:9.
“LsKO2” by itself, usually refers to a particular, specific gene; “the wild-type LsKO2 gene ….having at least 70% sequence identity to SEQ ID NO.: 9”, as we discussed before, is not the same gene, it expands the scope to any sequence that is ≥ 70% identical to the reference LsKO2 sequence, it potentially including: other paralogs; different family members (still P450/related enzymes); allelic variants; and partial sequence/fragments. Even at 70% identity, enzymes can differ in substrate specificity and biological function, and plant cytochrome P450 families in particular show substantial functional diversification among related paralogs. (Serkan Erdin et. al., Current Opinion in Structure Biology. 21(2):180–188, 2011). The core P450 signatures (e.g., EXXR and the heme-binding cysteine motif FXXGXCXG/CxG) are widely conserved across many cytochrome P450 proteins, so a sequence can look “P450-like” yet still be a different gene . In practice, identifying LsKO2 specifically among multiple ≥70% identity candidate generally requires full-length, properly aligned sequence comparison and phylogenetic placement (P450 families/subfamilies are assigned by sequence identity/phylogeny, and plants often have many closely related paralogs)
Even then, discrimination depends heavily on variation across the substrate recognition sites (SRS1-SRS6) rather than the conserved motifs.
Functional homology cannot be assumed solely on subfamily-level conservation. Substantial divergence in the 30% non-identical residues-particularly withing the hypervariable Substrate Recognition Sites (SRSs), may result in altered substrate specificity or loss of ent-kaurene oxidase activity, as seen in other specialized plant P450 lineages.(p7)( Jun Yan et. al., PLoS ONE, Volume 5, Issue 12, 2010). The specification fails to identify which residues in the 30% variance (about 150-200 animo acids that can change) are essential. Accordingly, the specification does not provide any “rules” or “structural” directions to predict which 70%-identical sequences will retain KO2 function and which will not.
Consistent with this, within the KO/CYP701 family, plants may contain multiple closed related CYP701A members, and at least some CYP701A paralogs catalyze reactions different from the prototypical KO conversion associated with GA biosynthesis. The example in rice, as Wang (Qiang Wang et. al., Plant Physiology, Volume 158, Issue 3, 2012) (Pages 1418–1425) discovers, OsKOL4 plays a role in the more specialized diterpenoid metabolism of rice, and provide evidence for divergence of a KO/CYP701 family member from GA biosynthesis (abstract).
The specification does not further demonstrate possession that KO2 loss-of -function across the entire≥70% identity genus will predictably produce the claimed shade tolerant phenotype, particularly given that GA-pathway genes and their paralogs can show specialized/nonredundant roles and divers biological effects depending on the gene copy, tissue expression, and genetic background. For example, Zhang (Hui Zhang, et. al., PLoS Genetics, 10;16(1), 2020) conducts alignment analysis with the sequences from the five OsKO proteins and KO proteins involving in GA biosynthesis from Arabidopsis, wheat and Nelumbo nucifera (page 6) . The result showed that sequences of these eight KO proteins are highly conserved with more than 70% similarity (S2 Fig). According to Zhang, the rice ent-kaurene oxidase gene, OsKO1, has a specialized functional profile, primarily regulating seed germination and early seedling growth. Further analyses proves that OsKO1 could catalyze the reaction from ent-kaurene into ent-kaurenoic acid in GA biosynthesis mainly at seed germination and seedling stages, and the mutations decrease its activity to catalyze the step from ent-kaurenol to ent-kaurenoic acid in this reaction (abstract). This research suggests that even closely related paralogs within the same subfamily of the KO gene can have significant differences in expression patterns and developmental functions. If a 71%-identical paralog is expressed only in roots (as P450s often are), knocking it out would not result in the claimed "shade tolerance" phenotype in the whole plant.
Accordingly, absent disclosure of representative KO2 sequences across the claimed identity range and/or disclosure of structural/functional markers that correlated sequence to the claimed KO2 function and phenotype, the specification does not demonstrate possession of the entire scope of the claims.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-13 and 28-29 are rejected under 35 U.S.C. §103 as being unpatentable over Sawada (Sawada, Yoshiaki et. al., Journal of experimental botany, Vol.59 (12), p.3383-3393, 2008), in view Waycott(William Waycott et. al., Phen Plant Physiol.95, 1162-1168, 1991) and Calori ( A.H. Calori et. al., Acta Horticulture. 1249. 2 . p5-10, 2019 ), and further in view of Bertier (Lien D. Bertier et. al., G3 (Bethesda). 4;8(5):1513-1521, 2018).
Claim 1 is drawn to a lettuce plant comprising a modified LsKO2 gene, leads to a shade tolerant phenotype, wherein the wild-type LsKO2 gene having at least 70% sequence identity to SEQ ID NO.: 9, wherein the modification resulting in an absence of functional/wild type KO2 protein, and wherein the homozygous presence of the modified LsKO2 in the plant or the homozygous absence the wild-type LsKO2 genes from the plant confers shade tolerance to the plant.
Under BRI, claim 1 is directed to a lettuce plant comprising at least a modified LsKO2 gene. The claimed plant is further characterized in that: (1) the “wild-type”LsKO2 gene comprised a coding sequence having at least 70% sequence identity to SEQ ID NO:9, (2) the “modification” of LsKO2 includes replacement, deletion, and/or insertion of nucleotides that results in an absence of functional KO2 protein, or results in the absence of the wild-type LsKO2 gene from the plant, and (3) the homozygous presence of the modified LsKO2 gene in the plant, confers shade tolerance to the plant as compared to a plant comprising the wild-type LsKO2 gene that does not show shade tolerance.
Sawada isolates and functionally characterizes lettuce GA-metabolism genes, including LsKO2, and show that LsKO1 and LsKO2 encode ent-kaurene oxidase (KO enzymes) in the gibberellin biosynthesis pathway (p3383, abstract). LsKO2(AB370236) (p3386) sequence alignment shows LsKO2 has 100% identity with SEQ ID NO:9 (bellow for alignment results).
Sawada does not teach a lettuce plant comprising a homozygous loss-of-function modification of ent-kaurene oxidase that confers a shade-tolerance phenotype (such as elongated stem internodes, reduced leaf lamina area, slightly pale color of the leaves, elongated petioles and reduced root development(paragraph 0171, instant application).
Waycott teaches mutating lettuce with EMS, and lettuce dwarf mutants (dwarf1-4) display shorter stems, shorter petioles (inhibited petioles/stem elongation), relatively longer roots, darker leaf color than wild-type plants (page 1162, 1164, 1165, abstract, fig 2-3). Waycott further teaches both dwarf and normal seedling elongated in response to exogenous GA, with repeated GA sprays, dwarfs could be made to resemble the normal phenotype, Waycott points out biochemical block in dwf2 occurs at a very early step in the GA-biosynthetic pathway (abstract).
Calori in baby-leaf lettuce production study teaches that increasing lettuce planting density substantially increase yield per unit ground area (page 9). “For baby leaf (leafy vegetables), the best crop spacing between plants and lines should be smaller due to the reduced size of the plant that is harvested before the maximum development” (page 6).
Bertier teaches that CRISPR/Cas9 genome editing in lettuce can generate heritable mutations and provides “high-resolution” evidence regarding the efficiency and heritability of edits, including recovery of stable homozygous mutants through subsequent generations /selection (p1513 abstract, p1158 discussion).
Claims 2 and 3 are drawn to the plant of claim 1 for the plant is shade tolerant as a result of the homozygous absence of the wild-type LsKO2 gene (claim 2), for homozygous absence of the wild-type LsKO2 gene (claim 3).
Claim 4 is drawn to a plant from claim1, and claim 5 is drawn to a plant from claim 2, for the modified LsKO2 gene comprises a premature stop codon.
Introducing mutations that create premature stop codons (including predictable outcomes of genome editing such as indels causing frameshifts that yield early termination) is an obvious way to achieve absence of functional KO2 protein as recited in claim 1.
Claims 6 and 8 are drawn to a plant from claim 4, and claims 7 and 9 are drawn to a plant from claim 5, for the premature stop codon is located within the part encoding the cytochrome p450 domain of the KO2 protein (claims 6 and 7), and for modified LsKO2 gene encodes a truncated protein of 367 amino acids or less (claims 8 and 9).
Sawada teaches that LsKO2 is a cytochrome P450 enzyme(page 3384); Bertier teaches “Mutational events are not random but distinctive for each gRNA” (page 1517). P450-faimily enzymes whose conserved C-terminal heme-binding (P450) domain is critical for catalytic activity, such that truncations disrupting this region would be expected to eliminate function. Disrupting the catalytic core or obtaining certain length of truncated protein is a routine and reliable method with targeted gRNA to predictably abolish enzymatic function and achieve the desired shade-avoidant phenotype, with a reasonable expectation of success.
Claim 10 is drawn to a plant from claim 1, and claim 11 is drawn to a plant from claim 2, for the stop codon is the result of a substitution of a cytosine by a thymine at position 1102 of SEQ ID NO.: 9.
While the cited art does not explicitly specify the C-to-T substitution at position 1102 of SEQ ID NO: 9. Since a C-to-T transition at this position predictably creates a premature stop codon and a functional knockout, selecting this specific substitution is a matter of routine optimization among a finite number of effective target sites to achieve the motivated GA-deficient phenotype with a reasonable expectation of success.
Claim 12 is drawn to a plant from claim 1, and claim 13 is drawn to a plant from claim 2, for the modified LsKO2 gene is as comprised in the genome of seeds of which a representative sample is deposited under accession number NCIMB 43547.
Bertier teaches that once a lettuce gene is edited, routine seed development, germination and selection inherently produce seeds comprising the edited gene in their genome (page 1518-1520). Reciting a deposit accession number, by itself, is an identifying label and does not add a structural or functional distinction over the obvious plant, nor does it change the obviousness analysis.
Claim 28 is drawn to a lettuce seed that comprises the modified LsKO2 gene from claim 1, for the plant grown from the seed shows shade tolerance.
Claim 29 is drawn to propagation material derived from the lettuce plant of claim 1, for any propagation material that is (1) capable of developing into the lettuce plant of claim 1 and/or (2)derived from the lettuce plant of claim1, where the propagation material is broadly defined to include materials suitable for sexual reproduction, suitable for vegetative reproduction, and /or suitable for tissue culture regeneration.
For a person of ordinary skill in the art, obtaining and using conventional propagation materials (e. g., pollen, ovules, embryos, cuttings, and tissue culture materials) capable of developing into and/or derived from the plant would involve routine reproduction and propagation techniques for a known plant line.
A POSITA would have been motivated to generate a homozygous loss-of-function modification in lettuce LsKO2, because Swawada identifies and functionally characterizes LsKO2 as an ent-kaurene oxidase in the gibberellin (GA) biosynthesis pathway, and Waycott shows that lettuce GA-deficient dwarf mutants exhibit reduced elongation phenotypes that are GA-responsive/rescuable, indicating that reduced endogenous GA production yields compact growth. Further, GA signaling is a key component of shad-avoidance elongation responses as mentioned by Petrovic (Tanja Djakovic-Petrovic et. al., The Plant Journal, 51, 117–126, 2007): “GA signaling is a key component in shade-avoidance petiole elongation responses”(p117-119) ; therefore, reducing GA biosynthesis via KO2 loss of function would have been expected to reduce shad-avoidance elongation and thereby confer a ”shade tolerant” phenotype relative to wild type. In addition, Calori teaches that in greenhouse baby-leaf lettuce production, increased planting density substantially increases yield per unit ground area, providing a practical motivation to pursue compact/shorter lettuce phenotypes that better tolerate dense spacing (i. e., reduced crowding/overlap and reduced shade-avoidance-driven elongation) to improve productivity per area. Bertier supports that CRISPR/Cas9 in lettuce can produce heritable edits and recovery of stable homozygous mutants, supporting a reasonable expectations of success.
The claimed invention in claims 1-13, 28 and 29 as a whole is prima facie obvious over the combined teachings of the prior arts above.
CLUSTAL O(1.2.4) multiple sequence alignment with LsKO2(AB370236)
SEQIDNO:9 ------------------------------------------------------------ 0
LsKO2 ctaaattctaaatagaaacacaaacacccctacgccaccatctgcaccacccccatccct 60
SEQIDNO:9 --------------------------------atggatggcgtgatcgatatgcaaacaa 28
LsKO2 tctttctctctcttgccggcttgttgcagaaaatggatggcgtgatcgatatgcaaacaa 120
****************************
SEQIDNO:9 ttcccctgagaaccgccatagccataggcggcactgccgtcgcacttgtagttgctcttt 88
LsKO2 ttcccctgagaaccgccatagccataggcggcactgccgtcgcacttgtagttgctcttt 180
************************************************************
SEQIDNO:9 acttctggtttctcagaagctatgcctctccctctcatcacagcaaccatctccctcctg 148
LsKO2 acttctggtttctcagaagctatgcctctccctctcatcacagcaaccatctccctcctg 240
************************************************************
SEQIDNO:9 ttccagaggtgcctggggtaccagtgttggggaatttactgcagttaaaggagaagaaac 208
LsKO2 ttccagaggtgcctggggtaccagtgttggggaatttactgcagttaaaggagaagaaac 300
************************************************************
SEQIDNO:9 catacatgacttttacaaaatgggcagagatgtatgggcctatttactccattagaactg 268
LsKO2 catacatgacttttacaaaatgggcagagatgtatgggcctatttactccattagaactg 360
************************************************************
SEQIDNO:9 gagccacttccatggtggtggttagctccaatgaaatcgccaaggaggtagttgttacaa 328
LsKO2 gagccacttccatggtggtggttagctccaatgaaatcgccaaggaggtagttgttacaa 420
************************************************************
SEQIDNO:9 gatttccatcaatctcaactagaaagctatcatatgcattaaaagtcctgaccgaagata 388
LsKO2 gatttccatcaatctcaactagaaagctatcatatgcattaaaagtcctgaccgaagata 480
************************************************************
SEQIDNO:9 aatccatggttgctatgagtgattacaatgactatcacaaaaccgtaaaacgccatatac 448
LsKO2 aatccatggttgctatgagtgattaccatgactatcacaaaaccgtaaaacgccatatac 540
************************** *********************************
SEQIDNO:9 tcaccgctgtcttgggaccaaatgcccagaagaaatttcgtgctcatagagacaccatga 508
LsKO2 tcaccgctgtcttgggaccaaatgcccagaagaaatttcgtgctcatagagacaccatga 600
************************************************************
SEQIDNO:9 tggagaatgtttcaaacgaactacatgcgtttttcgaaaaaaatcctaatcaagaagtga 568
LsKO2 tggagaatgtttcaaacgaactacatgcgtttttcgaaaaaaatcctaatcaagaagtga 660
************************************************************
SEQIDNO:9 acctcaggaaaatattccaatctcaactttttggactagcaatgaaacaagcattaggga 628
LsKO2 acctcaggaaaatattccaatctcaactttttggactagcaatgaaacaagcattaggga 720
************************************************************
SEQIDNO:9 aggatgttgaaagcatatacgtgaaggatctagaaaccaccatgaaaagagaggaaatct 688
LsKO2 aggatgttgaaagcatatacgtgaaggatctagaaaccaccatgaaaagagaggaaatct 780
************************************************************
SEQIDNO:9 ttgaggtattagtggttgacccaatgatgggtgccattgaagttgactggagagatttct 748
LsKO2 ttgaggtattagtggttgacccaatgatgggtgccattgaagttgactggagagatttct 840
************************************************************
SEQIDNO:9 ttccatatctcaagtgggtcccaaataaaagctttgaaaacataatccatcgaatgtata 808
LsKO2 ttccatatctcaagtgggtcccaaataaaagctttgaaaacataatccatcgaatgtata 900
************************************************************
SEQIDNO:9 cccgaagagaagctgtaatgaaagctcttattcaggaacataaaaaacgtattgcatcag 868
LsKO2 cccgaagagaagctgtaatgaaagctcttattcaggaacataaaaaacgtattgcatcag 960
************************************************************
SEQIDNO:9 gcgagaacttgaacagctacattgattacttgctatcagaagcacaaacattaacagata 928
LsKO2 gcgagaacttgaacagctacattgattacttgctatcagaagcacaaacattaacagata 1020
************************************************************
SEQIDNO:9 aacagcttcttatgtctttatgggagccaattattgaatcatcagacactaccatggtca 988
LsKO2 aacagcttcttatgtctttatgggagccaattattgaatcatcagacactaccatggtca 1080
************************************************************
SEQIDNO:9 ccacagaatgggcaatgtatgaacttgctaaaaatccaaacatgcaggatcgtctatatg 1048
LsKO2 ccacagaatgggcaatgtatgaacttgctaaaaatccaaacatgcaggatcgtctatatg 1140
************************************************************
SEQIDNO:9 aggaaatccaaagtgtttgtggatcagagaagatcacagaagagaatttatctcagcttc 1108
LsKO2 aggaaatccaaagtgtttgtggatcagagaagatcacagaagagaatttatctcagcttc 1200
************************************************************
SEQIDNO:9 catacttatatgctgtttttcaagagaccttgagaaaacattgtcctgttccaataatgc 1168
LsKO2 catacttatatgctgtttttcaagagaccttgagaaaacattgtcctgttccaataatgc 1260
************************************************************
SEQIDNO:9 ccctgagatacgtccacgagaatacagttctaggaggctaccatgtcccagctggaaccg 1228
LsKO2 ccctgagatacgtccacgagaatacagttctaggaggctaccatgtcccagctggaaccg 1320
************************************************************
SEQIDNO:9 aggtggcgataaatatatatggatgtaacatggataagaaggtgtgggagaatcctgaag 1288
LsKO2 aggtggcgataaatatatatggatgtaacatggataagaaggtgtgggagaatcctgaag 1380
************************************************************
SEQIDNO:9 agtggaatcctgagaggtttttgagtgaaaaggagagcatggacttgtataaaacaatgg 1348
LsKO2 agtggaatcctgagaggtttttgagtgaaaaggagagcatggacttgtataaaacaatgg 1440
************************************************************
SEQIDNO:9 catttgggggaggaaaaagggtgtgtgcaggttctcttcaagccatggtgatttcttgca 1408
LsKO2 catttgggggaggaaaaagggtgtgtgcaggttctcttcaagccatggtgatttcttgca 1500
************************************************************
SEQIDNO:9 ttggaattggaagattggtgcaggattttgagtggaaactgaaagatgatgctgaagaag 1468
LsKO2 ttggaattggaagattggtgcaggattttgagtggaaactgaaagatgatgctgaagaag 1560
************************************************************
SEQIDNO:9 atgtgaatacacttgggcttacaacacaaaagcttcatccacttcttgcactcataaacc 1528
LsKO2 atgtgaatacacttgggcttacaacacaaaagcttcatccacttcttgcactcataaacc 1620
************************************************************
SEQIDNO:9 ctagaaaatga------------------------------------------------- 1539
LsKO2 ctagaaaatgaaaagtttgttttcttttcttttgttttgttagttacaaagaaatcaatg 1680
***********
SEQIDNO:9 ------------------------------------------------------------ 1539
LsKO2 tttttgcaatacttatatagattaatagataagtatgaatactttcgttgatgtcaagct 1740
SEQIDNO:9 ------------------------------------------------------------ 1539
LsKO2 ttagagtgcaaatgttggtataatataagtacaattaccaaatgtatgagagacaaatca 1800
SEQIDNO:9 --------------------------------------------- 1539
LsKO2 aattattataaaaaaaatgcctttttatgaaaaaaaaaaaaaaaa 1845
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to YANXIN SHEN whose telephone number is (571)272-7538. The examiner can normally be reached Monday-Friday.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached at (571)272-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/YANXIN SHEN/ Examiner, Art Unit 1663
/WEIHUA FAN/ Primary Examiner, Art Unit 1663