DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 03/06/2026 has been entered.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 2-3, 5-12, 14, 17, 20-21, 27, 39-40 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Zhou (US 7314750, January 2008).
Concerning claims 2-3, 5-12, 14, 17, 20-21, 27, 39-40 Zhou discloses a single-stranded oligonucleotide (see lines 35-40 in column 5) of SEQ ID NO: 543274, 25 nucleotides long (see lines 58-61 in column 1, sequence listing), comprising 14 consecutive nucleotides 8-21 identical to 14 consecutive nucleotides of instant SEQ ID NO: 212 and complementary to nucleotides 4-17 of nucleotides 108-132 of SEQ ID NO: 2:
SEQ ID NO: 212 1 TCTCTCGAAGGTCTTCTG 18
| ||||||||||||||
SEQ ID NO: 543274 1 TAAGGCCCTCGAAGGTCTTCTTTTT 25
Zhou further disclose that oligonucleotides of the invention can comprise modified sugars, modified nucleobases and/or phosphorothioate linkages or can be PNA (see lines 44-55 in column 5).
Claim(s) 2-3, 6-14, 17-18, 20-21, 25, 28, 38-41, 51 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Khvorova et al (US 2007/0031844, February 2007).
Concerning claims 2, 3, 6-11, 25 and 38-40 Khvorova disclose double-stranded siRNA (duplex) comprising two strands complementary to each other (see paragraphs [0105, 0260]), wherein one strand of such siRNA is of SEQ ID NO: 816517, 19 nucleotides long, with nucleotides 6-19 identical to nucleotides 8-21 of instant sequence of nucleotides 8827-8851 of SEQ ID NO: 1:
SEQ ID NO: 1 8827 GGCAGAAGACCTTCGAGAGAAAGGT 8851
| ||||||||||||||
SEQ ID NO: 816517 1 AGUAUGACCUUCGAGAGAA 19
It is inherent that the second strand of the siRNA fully complementary to SEQ ID NO: 816517 comprises 14 consecutive nucleotides complementary to nucleotides 8-21 of instant sequence of nucleotides 8827-8851 of SEQ ID NO: 1. Therefore such second strand satisfies structural requirements of instant claim 3. Further the same 14 consecutive nucleotides of such second strand are identical to nucleotides 3-16 of instant SEQ ID NO: 35, satisfying structural requirements of instant claims 2 and 40. Khvorova further disclose that siRNAs of the invention can comprise phosphorothioate and phosphodiester linkages (see paragraph [0120]).
Concerning claims 12-13 Khvorova disclose that siRNAs can comprise modified nucleotides such as 5-methylcytosine (see paragraph [0121]).
Concerning claims 14 and 17-18 Khvorova disclose that siRNAs can comprise modified sugar moieties such as 2’-OMe modifications (see paragraphs [0120, 0086]).
Concerning claims 20 and 21 Khvorova disclose that siRNAs can comprise peptide nucleic acids (PNA) (see paragraph [0120]).
Concerning claim 28 Khvorova disclose that siRNA can be conjugated to other molecules (see paragraph [0277]).
Concerning claims 41 and 51 Khvorova disclose that siRNAs of the invention can be used for therapeutic purposes, therefore inherently disclosing pharmaceutical compositions comprising siRNA and pharmaceutically acceptable carrier.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 2-3, 6-14, 17-18, 20-21, 25, 28, 38-41, 50-52 is/are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova, above, as applied to claims 2-3, 6-14, 17-18, 20-21, 25, 28, 38-41, 51, above, and further in view of Vargeese et al (WO 2017/015555, January 2017, of record).
Teachings of Khvorova are discussed above.
Khvorova do not teach pharmaceutical compositions comprising artificial cerebrospinal fluid as a diluent.
Vargeese teach that oligonucleotides can be used in pharmaceutical compositions comprising artificial cerebrospinal fluid as a diluent, among others (see paragraph [001047]).
It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to prepare pharmaceutical compositions comprising artificial cerebrospinal fluid as a diluent using oligonucleotides taught by Khvorova. One of the ordinary skill in the art would be motivated to do so, because Vargeese teach a variety of diluents for oligonucleotides pharmaceutical compositions including artificial cerebrospinal fluid.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 2-3, 5-18, 20-21, 23-28, 38-41, 50-52 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-36 of U.S. Patent No. 11,833,168 in view of Vargeese, above. Claims from '168 recite antisense oligonucleotides of SEQ ID NOs: 32, 33, 110, 188, 265, 266. At least one of those, of SEQ ID NO: 33 has its first 15 nucleotides complementary to nucleotides 108-122 of instant SEQ ID NO: 2. Further, first 15 nucleotides of SEQ ID NO: 33 are identical to nucleotides 4-18 of instant SEQ ID NO: 267. Therefore such oligonucleotide is within the scope of instant claims. Teachings of Vargeese et al are discussed above. It would have been obvious to create pharmaceutical compositions comprising SEQ ID NO: 33 from '168 with artificial cerebrospinal fluid as a diluent, arriving at instant invention.
Response to Arguments
Applicant's arguments filed 03/06/2026 have been fully considered but they are not persuasive.
Previous art rejections are withdrawn in view of new amendments, arguments are moot.
Double patenting rejection is maintained for the reasons of record.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EKATERINA POLIAKOVA-GEORGANTAS/ Primary Examiner, Art Unit 1637
