DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 04/16/2026. Claims 1, 4, 7-11, 15-20 are currently pending.
Any rejection or objection not reiterated herein has been overcome by amendment.
Applicant’s amendments and arguments have been thoroughly reviewed, but are not
persuasive to place the claims in condition for allowance for the reasons that follow.
Claim 1 is amended with new limitations and necessitates new consideration that resulted in new rejections set forth below.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. This application has PRO 63/422,567 filed on 11/04/2022.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 4, 17, 18, 19 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 4, it is indefinite as being incomplete by its dependence on a cancelled claim 3. It would be remedial to amend claim 4 to depend from the independent claim 1.
Regarding claim 17, the recitation the “one or more additional agents” is indefinite because the word “agent” or “agents” are not clearly defined in the specification, therefore it is not clear what is required of an “agent”.
Regarding claims 18 and 19, both claims recite "the agent". There is insufficient antecedent basis for this limitation in the claims due to an amendment to the independent claim 1. It is further not clear regarding what is required of “the agent”.
Claim Rejections - 35 USC § 112 Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 17 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
Regarding claim 17, contingent upon whether the recited “one or more additional agents” modulate the splicing of the 8A exon of CACNA1C, claim 17 directs to a broad genus by claiming “one or more additional agents”. Despite the attempt in the specification to expand on the claimed subject matter (Page 16, ¶[0045]; Page 18, ¶[0051]; see below), the following description does not sufficiently describe the representative species within the “one or more additional agents” because the word “agent” or “agents” are not clearly defined in the specification: “The agent may be any agent that modulates the splicing of an 8A or an 8 exon of CACNA1C” (Page 16, ¶[0045]). “In some embodiments, ... agents may be the same type of agent or a different type of agent. … one of the two or more agents is an agent traditionally used to treat Timothy syndrome ... include, without limitation, a beta blocker, mexiletine, etc. …” (Page 18, ¶[0051]). The examples of non-splicing modulators, such as beta blockers, mexiletine, etc. further confound the definition of the term “agent” with high degree of variation. There is insufficient discussion of representative species within the broad genus in the specification, and there is clear failure to disclose any core structure that is shared by members of the genus of agents that modulate splicing of the 8A/8 exon of CACNA1C as defined in the specification.
The disclosure of insufficient species of a broad genus, the high degree of variation in the art, and the failure to disclose correlation between structure in the specification and the claimed function led to the determination that claim 17 is overly broad with insufficient evidence of possession at the time of filing to one skilled in the art. Thus, claim 17 does not meet the written description requirement, and the ineffective ASO examples presented in the specification demonstrate a clear lack of possession of the full genera as claimed.
Response to Arguments
Applicants argue that:
“Applicant submits that the skilled artisan would understand that the Applicant was in possession of the claimed invention at the time of filing. As shown in FIG. 2A and presented by the Office in the rejection under 35 U.S.C. § 103, ASO14, ASO17, and ASO18 target adjacent regions of exon 8A of CACNA1C which is shown in FIG. 2A, a portion of which is reproduced below for the sake of clarity.
In the above portion of FIG. 2A, the titling of the ASOs disclosed in Table 1 are shown relative to the sequence of exon 8A of CACNA1C with the ASO numbers annotated. As can be seen, the ASOs are listed in order of their appearance, counting from right to left. ASO14, ASO17, and ASO18 overlap in a 40 nt region where ASO18 and ASO14 cover two consecutive 20 nt regions. Accordingly, the inventors identified a region of exon 8A that, when targeted, modulates the splicing of exon 8A. Applicant has shown ASO14, ASO17, and ASO18 all reduce the inclusion of exon 8A, thereby modulating the splicing of said exon of CACNA1C (See FIG. 2D). Accordingly, claims 1, 4, 7-11, and 15-20 clearly comply with the written description requirement at least because the skilled artisan would understand that the inventors were in possession of the claimed invention at the time of filing. Applicant respectfully requests that this rejection be withdrawn.”
This argument has been considered but is not persuasive. See the final office action above for detailed reasons.
Claim Rejections - 35 USC § 112 Scope of Enablement
Claims 17 and 19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of using select antisense oligonucleotides (ASOs, specifically ASO14/ASO.CA14/A.14, ASO17/ASO.CA17/A.17, and ASO18/ASO.CA18/A.18, as single agent, all with uniform MOE ASO chemistry; SEQ ID NOs: 14-15; Table 1. Page 25) based on an ASO walk screening assay through trial-and-error-based testing and validations to modulate the alternative splicing of the CACNA1C exon 8A/8 and treat Timothy Syndrome 1 (TS1) only with definitive diagnosis based on genetic testing that confirms the presence of targetable mutations in the exon 8A of CACNA1C, the working examples using ASO only candidates (i.e. ASO14, ASO17, or ASO18) do not reasonably provide enablement for treating TS using any other ASOs, or other species of splicing modulators capable of modulating the alternative splicing of the exon 8A/8 in patients suffering from Type 1 TS syndrome. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant factors are indicated below:
Nature of the Invention
The claimed invention directs to a method of treating an individual having type 1 Timothy Syndrome (TS; with definitive genetic testing-based diagnosis) using an effective dose of an ASO, wherein the ASO modulates the splicing of an 8A exon of CACNA1C and the ASO targets a region encompassed by the regions targeted by AS014, ASO17, and ASO18. Thus, the method requires a reliable implementation of: i) providing an effective dose of an ASO that modulates the splicing of an 8A exon of CACNA1C and the ASO targets a region encompassed by the regions targeted by AS014, ASO17, and ASO18; ii) evaluating the efficacy of required amount of the ASO; iii) in any subject suffering from type 1 TS in need thereof with a genetic mutation that impact the exon 8A splicing patterns.
The Breadth of the Claims
The scope of the dependent claim 17 encompass another broad genus of “agents” based on the broadest reasonable interpretation (BRI), numerous types of molecules other than ASOs, including but not limited to, small molecules, proteins, viral vectors, etc. can all be included, which are acknowledged in the specification (page 18, ¶[0051]), any agent could be added to the agent of claim 1 “without limitation” (page 18, ¶[0051]). However, no representative species is offered as working examples to support the breadth of the claim, nor is any core structure identified amongst the members of the broad genus in the specification to support the breadth of the claim.
The scope of the dependent claim 19 relates to therapeutic targeting of faulty splicing of the exon 8A/8 of CACNA1C that is predominantly extracranial (systems outside the brain), the predominant source of pathophysiology typical of Type 2 TS. There is no working example presented in the specification to provide enabling support for systemic delivery of the claimed ASOs that lead to splice modulation of the exon 8A in the brains of experimental animals., i.e. models of Type 1 TS (TS1).
Guidance of the Specification
The specification is silent as to what treatment outcomes should be reasonably expected by persons skilled in the art for splicing modulators other than ASOs, i.e. small molecules, proteins, siRNAs, viral vectors etc. given the distinct structures, lengths, chemical modification strategies, and delivery methods between ASOs and small molecules, proteins, and siRNAs. Even within the genus of ASOs, substantial trial-and-error-based screening and validations is required to identify effective splicing modulators given the high unpredictability of different ASO sequences as demonstrated by the specification. To one skilled in the art, the example in the instant application is not seen as working examples of treating TS using every possible ASO molecule that “targets a region encompassed by the regions targeted by AS014, ASO17, and ASO18”, or small molecules, siRNAs, proteins, or viral vectors that are capable of modulating the splicing of exon 8A of CACNA1C.
The State of the Prior Art
With regard to the state of the art, using ASOs to treat various splicing-related disorders are on the rise. In 2016, the FDA approved two significant antisense oligonucleotide (ASO) therapies: Eteplirsen (Exondys 51) for Duchenne Muscular Dystrophy (DMD) and Nusinersen (Spinraza) for Spinal Muscular Atrophy (SMA), marking major advancements for ASO treatments, with Nusinersen being the first FDA-approved therapy for SMA. Hill (Dev Neurosci. 2021;43(3-4):247-252; See previous office action mailed on 01/26/2026) teaches the state of art in developing ASO based splicing modulation therapies for a variety of neurodevelopmental disorders. Hill (2021) cautions that “Several factors complicate the use of ASOs for neurodevelopmental disorders. Since currently constituted ASOs do not cross the blood-brain barrier, injection into the cerebrospinal fluid is required for efficient neuronal uptake. In addition ... both gain-of-function and loss-of-function variants of the same gene can be pathogenic ...” when commenting on the challenges in the development of ASO therapies for neurodevelopmental disorders (page 5 of the NIHMS author manuscript).
The Level of Predictability in the Art
The level of predictability in the art is low. As described in the specification, a “ASO walk” strategy was used to screen for effective ASOs that are effective in modulating the alternative splicing of CACNA1C pre-mRNA (page 24, ¶[0076]), indicating the high levels of unpredictability of ASO sequences. Only extremely limited ASO candidates became enabled after trial-and-error-based testing and validation, namely, ASO14, ASO17, and ASO18. This level of unpredictability is known in the art as demonstrated by Hua (Am J Hum Genet. 2008 Apr;82(4):834-48; See previous office action mailed on 01/26/2026) in their efforts to perform systematic tiling or ASO walk to identify the optimal ASOs to treat mis-splicing associated with SMA. Hua (2008) teaches a systematic tiling method using numerous ASO sequence candidates to perform screening and identify the most effective ASOs that modulate splicing of a chosen exon (Figure. 1, page 837).
The Quantity of Experimentation necessarily Needed
In light of the high level of unpredictability in the art, and the limited amount of direction provided by the inventor for targeting CACNA1C iPSC-based TS models in vitro and systemic delivery methods in vivo as claimed in claim 19, and the noticeable absence of single nucleotide-resolution microwalk or high-resolution ASO walk that evaluate all possible ASOs that target a region encompassed by the regions targeted by AS014, ASO17, and ASO18 as claimed, in addition to the potential of using multiple agents with unlimited molecular types, structure, and action mechanisms as claimed in claim 17, the quantity of experimentation necessarily needed to make and use the invention as claimed is considerably high, especially regarding using diverse types of “agents” to treat TS1 via alternative splicing modulation based on the disclosure.
For example, it would be necessary for one skilled in the art to identify optimal ASO sequences through a high-throughput screening method to select optimal therapeutic agent(s), determine compound stability, dosing, timing and delivery routes, then compare a large number of combinations of unlimited agents to use the invention to treat various clinical indications of type-1 Timothy Syndrome. There would be an unreasonable amount of experimentation required by one skilled in the art.
Conclusion of 35 U.S.C. 112(a) Enablement Analysis
After applying the Wands factors and analysis to claims 17 and 19, taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the lack of guidance provided by the applicant and the limited working examples, in view of the applicant’s entire disclosure, it is concluded that the specification is not enabled for the full scope as discussed above. Therefore, claims 17 and 19 are rejected under 35 U.S.C. §112(a) for failing to disclose sufficient information to enable one skilled in the art to make and use the invention commensurate in scope with these claims.
Response to Arguments
Applicants argue that:
“Applicant submits that the skilled artisan would be able to make and use the claimed invention without undue experimentation. The claimed invention is directed to treating an individual having Timothy Syndrome Type-I using an ASO directed to a region encompassed by the regions that ASO14, ASO17, and ASO18 target. Applicant has identified a region of exon 8A of CACNA1C that inhibits the inclusion of exon 8A when targeted. Applicant has shown 3 ASOs targeting the above region that modulate the splicing of exon 8A of CACNA1. The targeted region encompasses 40nts and the skilled artisan would easily be able to design and test further ASOs targeting this region by adopting the same strategy in the present application, i.e., ASO walking and phenotype testing. Accordingly, claims 1, 4, 7-11, and 15-20 are enabled by the specification at least because the skilled artisan would be able to make and use the claimed invention without undue experimentation.”
This argument has been considered but is not persuasive. See the final office action above for detailed reasons.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 4, 7-11, 15-18, 20 are rejected under 35 U.S.C. 103 as being unpatentable over Bennett (US-9717750-B2, published 08/01/2017; See the previous office action mailed on 01/16/2026) in view of Luzzio (WO-2019028440-A1, published 02/07/2019; see the previous office action mailed on 01/16/2026), further in view of Hua (2008; see full citation above and the previous office action mailed on 01/16/2026), Lim (2017; Drug Des Devel Ther. 2017 Feb 28;11:533-545), GenBank: Z26263.1 (CACNA1C gene sequence; 2006; Listed on PTO-892 and was provided in the previous office action mailed on 01/16/2026), and Bauer (Front Pediatr. 2021 May 17; 9:668546).
The amendment to claim 1 necessitates new rejections set forth below.
Bennett (2017) teaches a method of treating an individual having a mutation-induced central nervous system disorder, the method comprising: administering an effective dose of an antisense oligonucleotide (ASO) to the individual, wherein the ASO modulates the splicing of an exon of SMN2 (Page 43, columns 53-55, Claim 1).
Bennett does not teach “a method for treating an individual having type-1 Timothy syndrome, the method comprising: administering an effective dose of an antisense oligonucleotide (ASO) to the individual, wherein the ASO modulates the splicing of an 8A exon of CACNA1C and the ASO targets a region encompassed by the regions targeted by AS014, ASO17, and ASO18”.
PNG
media_image1.png
105
860
media_image1.png
Greyscale
However, Luzzio (2019) teaches a method for treating an individual having type-1 Timothy syndrome, the method comprising: administering an effective dose of small molecule splice modulators by modulating the alternative splicing of a target gene, CACNA1C, where gain-of-function mutation, such as G406R(G>A) on the exon 8A, leads to Type 1 Timothy Syndrome (Page 277 Table 2A, 6th gene in the table from the top; See cropped Table 2A below; Page 430, claim 125). Luzzio’s teaching above indicates that using splice modulators to inhibit exon 8a/8A expression or induce exclusion is a splice modulation strategy to pursue because the mutation G406R in exon 8a/8A is the cause of the Type-1 Timothy Syndrome.
Luzzio does not teach using ASO-based splicing modulators, nor does it describe how to identify ASO molecule sequences to achieve effective splicing modulation to treat Type 1 Timothy Syndrome.
However, Hua (2008) provides general guidance regarding how to determine which splice regulatory element to target using ASOs in order to remedy a disease-causing mutated exon, i.e. how to treat a disease by inhibiting the splicing or inducing the exclusion of a disease-causing exon. It can be achieved through inhibiting recognition of the mutated exon by the spliceosome machinery for inclusion in the mature mRNA because ASOs can mask positive cis-elements to induce exon skipping or exclusion. Hua teaches exonic splicing enhancers (ESEs) and intronic splicing enhancers (ISEs) and teaches that ”splice sites, ESEs, and ISEs are ideal ASO targets for promotion of exon skipping” (Page 835, left column, last ¶, first 4 lines). However, Hua (2008) demonstrates a practical approach by focusing on exonic regions first to test whether any effective ASOs can be identified before expanding the efforts into intronic regions to search for ASOs with improvement (Page 835, left column, last ¶ to right column, first ¶). Given the available target options, Hua (2008) further teaches a practical approach of screening different splice regulatory sequences separately, and recited a previous effort focusing on exons on as an initial choice for ASO walk screens (Page 835, 4th¶).
Hua (2008) further teaches a method of identifying effective ASO hybridization sites along the target nucleic acid using a Two-step systematic tiling/ASO walk strategy (Page 836, Table 1) tiling ASO sequences to cover the entire target sequence potentially harboring regulatory sequences that modulate the splicing of a disease-causing exon (Figure 1, page 837; Page 837, left column, last ¶; right column, first ¶). Two steps of ASO walk screens are taught: 1) A coarse ASO walk that tiles ASOs every 5th nucleotide along the target sequence (Page 836, Table 1; Page 837, Figure 1); 2) A high-resolution ASO walk, or “microwalk” (Page 835, right column, line 7), that tiles ASOs every nucleotide in an identified region with successful ASOs during the coarse ASO walk (Page 843, Figure 7). These considerations balance efficiency with accuracy for comprehensive identification of optimal ASOs.
Although Hua (2008) focuses on identifying intronic target sites using ASOs to induce SMN2 exon 7 inclusion, the general teachings are applicable to identifying ASO strategies to treat Type-1 Timothy Syndrome in that Luzzio (2019) above teaches splice modulation of CACNA1C gene. Hua’s methods led to the identification of the most effective candidate, “ASO-10-27” (Page 843, left column, first ¶, lines 6-7), which was later named “ISIS# 396443” (Bennett, page 37, Example 8, column 41, Table, SEQ ID NO: 1). Although this ASO stimulates SMN2 exon 7 inclusion, a distinct function from the exclusion of exon 8A for type 1 TS (TS1), the general strategies are broadly applicable to all splice modulation, and one with ordinary skill in the art can customize the strategy based on the desired mechanisms. This provides motivation to one skilled in the art because the success of Bennett and Hua provides reasonable expectation for success even though simple substitution is required. See below for schema of alternative coarse ASO walk screens applying the teachings of Hua (2008).
Hua (2008) does not teach screening using 30-mer ASOs.
However, Lim (2017; full citation above) teaches that Eteplirsen is a 30-nucleotide FDA approved ASO for treating Duchenne muscular dystrophy (DMD; Page 534, right column, 4th ¶, 1st line).
None of Bennett, Luzzio, Hua (2008), or Lim teaches the sequences of CACNA1C.
However, GenBank Z26263.1 (for CACNA1C gene sequence; 2006; Document in pdf is listed on the PTO-892 form and was provided in the previous office action mailed on 01/16/2026) shows the detailed locations of exons 8 and 8A and flanking introns. Furthermore, Bauer (2021) teaches that “Some confusion in the field exists because different groups published the gene structure of CACNA1C but denoted exon 8 and an alternatively spliced exon 8A in different orientations to each other (GenBank Z26263)” (Page 2, left column, last¶). GenBank Z26263.1 (2006) shows the Type-1 TS-causing exon 8A was named as exon 8, nevertheless, the sequences are correct, and ASOs designed to hybridize to the exon 8 in the GenBank Z26263.1 (2006) sequence would in fact hybridize to the commonly known exon 8A, which carries the mutation G406R and leads to TS1.
Regarding claim 1, It would have been obvious to one with ordinary skills in the art (OSITAs) before the effective filing date of the claimed invention to have modified the therapeutic approaches of Bennett (2017) by applying it to TS1, based on the splice modulation strategy suggested by Luzzio (2019), and would have replaced Luzzio’s small molecule splice modulators that only recognize certain splice sites with more versatile ASOs, capable of not only targeting splice sites, but also exonic and intronic regulatory cis elements, taught by Hua (2008), to optimize therapeutic splice modulation. OSITAs could have designed ASOs that induce exclusion of exon 8A of CACNA1C in individuals suffering from a confirmed genetic mutation that leads to TS1, which merely amounts to simple substitution by replacing one gene target with another gene target and one type of splice modulator with another type of splice modulator that is more versatile.
To identify optimal ASOs to treat TS1, it would further be obvious to OSITAs to have followed the detailed guidance from Hua (2008), Lim (2017), and would have used GenBank Z26263.1 (2006) sequences as the blue print, in view of Bauer (2021), to have ensured correct targets, and could have designed 30nt ASOs targeting the “splice sites, ESEs, and ISEs”, i.e. flanking introns and exon 8A,based on Hua (2008). However, in an initial exploratory attempt to search for effective ASOs, OSITAs could have first focused on exon 8A because of its relatively short target sequence (103nt exon 8A vs. combined 452nt flanking introns in premRNA), just like how Hua (2008) teaches separate efforts targeting exon and the flanking introns. OSITAs would have customized the Two-step ASO walk strategies taught by Hua (2008), by prioritizing coarse ASO walk (5nt spacing between the starting nucleotide of adjacent ASOs) to identify likely functional ESEs in the exon 8A, which would have led to efficient identification of optimal ASOs that induce exon 8A exclusion. It would have required 16x 30nt ASOs, see below, to cover exon 8A in a 5nt shift coarse ASO walk targeting exon 8A (449-551 nucleotides of Genbank Z26263.1).
PNG
media_image2.png
278
1702
media_image2.png
Greyscale
5’- GTCAATGATGCCGTAGGAAGGGACTGGCCCTGGATCTATTTTGTTACACTAATCATCATAGGGTCATTTTTTGTACTTAACTTGGTTCTCGGTGTGCTTAGC/A/GG -3’
GTCAATGATGCCGTAGGAAGGGACTGGCCC
TGATGCCGTAGGAAGGGACTGGCCCTGGAT
CCGTAGGAAGGGACTGGCCCTGGATCTATT
GGAAGGGACTGGCCCTGGATCTATTTTGTT
GGACTGGCCCTGGATCTATTTTGTTACACT
GGCCCTGGATCTATTTTGTTACACTAATCA
TGGATCTATTTTGTTACACTAATCATCATA
CTATTTTGTTACACTAATCATCATAGGGTC
TTGTTACACTAATCATCATAGGGTCATTTT
ACACTAATCATCATAGGGTCATTTTTTGTA
AATCATCATAGGGTCATTTTTTGTACTTAA
TCATAGGGTCATTTTTTGTACTTAACTTGG
GGGTCATTTTTTGTACTTAACTTGGTTCTC
TTTTTTGTACTTAACTTGGTTCTCGGTGT
GTACTTAACTTGGTTCTCGGTGTGCTTA
TAACTTGGTTCTCGGTGTGCTTAGC/A/GG
The boxed sequence within the exon is the 40nt narrowly interpreted “the region encompassed by the regions targeted by ASO14, ASO17, and ASO18”. And those 30nt ASO target sequences within the claimed “region” are shown in bold font. At least some embodiments of the ASOs would have hybridized within “the region encompassed by the regions targeted by ASO14, ASO17, and ASO18”.
Alternatively, a coarse ASO walk that spans the flanking introns and exon 8A, which also encompasses the flanking splice sites, could have been performed and it would have required 106x 30nt ASOs to cover the entire sequence of 555nt (146-551 nucleotides of Genbank Z26263.1) with 5nt shift. See schematic below for the section of 17x 30nt ASO target sequences covering the sequence of exon 8A, the remaining 89 ASO targets are not shown since they either do not or only partially cover exon 8A.
PNG
media_image2.png
278
1702
media_image2.png
Greyscale
5’- CAGGTCAATGATGCCGTAGGAAGGGACTGGCCCTGGATCTATTTTGTTACACTAATCATCATAGGGTCATTTTTTGTACTTAACTTGGTTCTCGGTGTGCTTAGC/A/GGT -3’
CAGGTCAATGATGCCGTAGGAAGGGACTGG
CAATGATGCCGTAGGAAGGGACTGGCCCTG
ATGCCGTAGGAAGGGACTGGCCCTGGATCT
GTAGGAAGGGACTGGCCCTGGATCTATTTT
AAGGGACTGGCCCTGGATCTATTTTGTTAC
ACTGGCCCTGGATCTATTTTGTTACACTAA
CCCTGGATCTATTTTGTTACACTAATCATC
GATCTATTTTGTTACACTAATCATCATAGG
ATTTTGTTACACTAATCATCATAGGGTCAT
GTTACACTAATCATCATAGGGTCATTTTTT
ACTAATCATCATAGGGTCATTTTTTGTACT
TCATCATAGGGTCATTTTTTGTACTTAACT
ATAGGGTCATTTTTTGTACTTAACTTGGTT
GTCATTTTTTGTACTTAACTTGGTTCTCGG
TTTTTGTACTTAACTTGGTTCTCGGTGTGC
GTACTTTAACTTGGTTCTCGGTGTGCTTAG
TTAACTTGGTTCTCGGTGTGCTTAGC/A/GGT
The boxed sequence within the exon 8A is the 40nt narrowly interpreted “the region encompassed by the regions targeted by ASO14, ASO17, and ASO18”. And those 30nt ASO target sequences within the claimed “region” are shown in bold font.
Since the claimed “the region encompassed by the regions targeted by ASO14, ASO17, and ASO18” at least encompasses a 40nt sequence out of the total 103nt sequence of exon 8A, a near 39% coverage of the entire exon, at least some embodiments of ASO candidates would have hybridized to the claimed region “encompassed by the regions targeted by ASO14, ASO17, and ASO18”, as shown in the schema above, thereby identifying ASOs targeting the claimed region, using a finite number of known solutions to solve a known problem based on predictable results with reasonable expectation of success, and would have arrived at the claimed invention. One would have reasonable expectation of success because the success of Bennett and Hua in clinical approval for use in patients. The recitation “wherein the ASO modulates the splicing of an 8A exon of CACNA1C…” is intended outcome and does not require additional active step, therefore, not patently distinct from the prior art.
Regarding claim 4, Bennett further teaches using a nucleic acid splicing modulator, an ASO, and 2'-O-methoxyethylribose modifications to the nucleobases in the ASO (column 53-55, claim 1).
Regarding claim 7, Luzzio (2019) teaches the G406R mutation in exon 8A is the cause of Type 1 Timothy Syndrome (See the partial view of Table 2A above), and Bauer (2021) further confirms that the impacted CACNA1C gene encodes the a1C subunit of the voltage-gated calcium channel Cav1.2 (Page 1, Abstract, lines 2-3), and that rare mutations other than G406R has recently been attributed to TS symptoms that are difficult to classify based on traditional definitions (Page 4, Table 1).
Regarding claim 8, the recitation “wherein the agent inhibits the splicing of the 8A exon of CACNA1C” is intended outcome with no additional active step, thereby carrying no patentability weight because it does not distinguish from the prior art.
Regarding claim 9, based on the schema above for the coarse ASO walks, both strategies targeting the entire exon 8A (103nt) and targeting the entire 555nt length that encompasses the flanking introns and exon 8A would have led to the following ASO embodiments that hybridize to the exon 8A sequences, and some embodiments would have comprised the sequences set forth in SEQ ID NOs: 14-16 corresponding to the sequences of ASO14, ASO17, ASO18, see examples below.
The corresponding 16x 30nt ASO sequences that cover exon 8A by targeting only exon 8A:
GGGCCAGTCCCTTCCTACGGCATCATTGAC
ATCCAGGGCCAGTCCCTTCCTACGGCATCA
AATAGATCCAGGGCCAGTCCCTTCCTACGG
AACAAAATAGATCCAGGGCCAGTCCCTTCC
AGTGTAACAAAATAGATCCAGGGCCAGTCC
TGATTAGTGTAACAAAATAGATCCAGGGCC
TATGATGATTAGTGTAACAAAATAGATCCA
GACCCTATGATGATTAGTGTAACAAAATAG
AAAATGACCCTATGATGATTAGTGTAACAA
TACAAAAAATGACCCTATGATGATTAGTGT
TTAAGTACAAAAAATGACCCTATGATGATT
CCAAGTTAAGTACAAAAAATGACCCTATGA
GAGAACCAAGTTAAGTACAAAAAATGACCC
ACACCGAGAACCAAGTTAAGTACAAAAAAT
TAAGCACACCGAGAACCAAGTTAAGTACAA
CCTGCTAAGCACACCGAGAACCAAGTTAAG
AAATAGATCCAGGGCCAGTC is the claimed SEQ ID NO: 14, ASO14
CAGTCCCTTCCTACGGCATC is the claimed SEQ ID NO: 15, ASO17
CCTTCCTACGGCATCATTGA is the claimed SEQ ID NO: 16, ASO18
The corresponding 17x 30nt ASO sequences that cover exon 8A out of a total of 106x ASOs that target exon 8A + flanking introns:
CCAGTCCCTTCCTACGGCATCATTGACCTG
CAGGGCCAGTCCCTTCCTACGGCATCATTG
AGATCCAGGGCCAGTCCCTTCCTACGGCAT
AAAATAGATCCAGGGCCAGTCCCTTCCTAC
GTAACAAAATAGATCCAGGGCCAGTCCCTT
TTAGTGTAACAAAATAGATCCAGGGCCAGT
GATGATTAGTGTAACAAAATAGATCCAGGG
CCTATGATGATTAGTGTAACAAAATAGATC
ATGACCCTATGATGATTAGTGTAACAAAAT
AAAAAATGACCCTATGATGATTAGTGTAAC
AGTACAAAAAATGACCCTATGATGATTAGT
AGTTAAGTACAAAAAATGACCCTATGATGA
AACCAAGTTAAGTACAAAAAATGACCCTAT
CCGAGAACCAAGTTAAGTACAAAAAATGAC
GCACACCGAGAACCAAGTTAAGTACAAAAA
GCTAAGCACACCGAGAACCAAGTTAAGTAC
ACCTGCTAAGCACACCGAGAACCAAGTTAA
AAATAGATCCAGGGCCAGTC is the claimed SEQ ID NO: 14, ASO14
CAGTCCCTTCCTACGGCATC is the claimed SEQ ID NO: 15, ASO17
CCTTCCTACGGCATCATTGA is the claimed SEQ ID NO: 16, ASO18
Regarding claim 10, the recitation “wherein the treatment results in a reduction of residual Ca2+ levels in a human neuron following neuronal depolarization” is intended outcome with no additional active step, thereby carrying no patentability weight because it does not distinguish from the prior art.
Regarding claim 11, the recitation “wherein the treatment results in decreased expression of the 8A exon of CACNA1C” is intended outcome requiring no additional active step, thereby carrying no patentability weight because it does not distinguish from the prior art.
Regarding claim 15, the recitation “wherein the treatment does not reduce total amount of a Cav1.2 protein” is intended outcome requiring no additional active step, thereby carrying no patentability weight because it does not distinguish from the prior art.
Regarding claim 16, Bennett further teaches “genotyped” when describing in vivo animal models of the working examples to confirm genetic defect prior to treatment (Page 55, line 25).
Regarding claim 18, Bennett further teaches local administration of the therapeutic ASO via intrathecal route of delivery by reciting “A method comprising administering by a bolus injection into the intrathecal space of a human subject … an antisense compound comprising an antisense oligonucleotide …” (Claim 1 [page 43, columns 53-55]).
Regarding claim 20, Bennett further teaches effective ASO-mediated splicing modulation in the CNS using accepted excipient by reciting “…antisense compounds can be utilized in pharmaceutical compositions by combining such oligomeric compounds with a suitable pharmaceutically acceptable diluent or carrier” (Page 28, column, lines 49-55).
Response to Arguments
Applicants argue that:
“Applicant submits that the skilled artisan would not have a reasonable expectation of success in combining the ASO administration methods of Bennett, the splicing modulation methods and targets of Luzzio, and the ASO walking strategy of Hua. As stated by the Office, the level of predictability in the art is low, and only a select few of many ASO tests actually result in modulating the splicing of an 8A exon of CACNA1C. Prior to the present disclosure, there was no evidence that the use of an ASO would treat Timothy Syndrome type-1.” -Remarks 04/16/2026, Page 10, last¶, lines 1-6
This argument has been considered but is not persuasive. See office action above for detailed reasoning for a simple substitution and an “obvious to try” rationales in combining the teachings, strategies, and motivations of these prior arts that provide reasonable expectation of success.
“The Office cites Luzzio for teaching a method for treating a disease or condition using a splicing modulator where the disease or condition is Timothy Syndrome-1. Luzzio is directed to the treatment of diseases using small molecule splicing modulators and specifically states that the small molecule splicing modulators are different and not related to oligonucleotide treatments (See paragraph 294 Luzzio). Claim 125 of Luzzio, cited by the Office, specifically states targeting specific splice site sequences. The summary section of Luzzio, i.e., paragraphs 48-75, states that their splice site modulators specifically target RNA bulges in RNA duplexes at splice sites. As shown in the present examples, the claimed ASOs do not target splice site sequences, and ASOs targeting splice sequences did not work. Additionally, claim 125 refers to Table 2A-2D, which contains hundreds, if not thousands, of different genes/diseases/splice site sequences. Accordingly, Luzzio provides no showing that splicing modulation of CACNA1C would be an effective treatment for Timothy Syndrome type I, and also proposes a different and distinct approach for the treatment of said diseases than that of the present application.” -Remarks 04/16/2026, Page 10, last¶, line 6-Page 11, line 4
This argument has been considered but is not persuasive. See the new rejection necessitated by amendment in the office action above.
“In making the rejection the Office asserts "The fact that all 3 claimed ASO sequences claimed in the current application map to complementary regions within the 102nt sequence of exon 8 of the CACNA1C gene dramatically reduces the number of 20nt ASO sequence candidates for persons of ordinary skill in the art to identify using established systemic tilling or ASO walking strategies to target and cover the 102nt exon 8, as there are only 83 20nt ASO sequences maximum to cover the 102nt exon 8 sequence with only 1 nt shift in tiling, conversely, 84x19nt, 85x18nt, 86x17nt, 87x16nt, for a total of 425 ASO" (OA pg. 23-24), however, the Office is using impermissible hindsight bias in reducing the amount sequence space that the skilled artisan would have to identify and test to arrive at the claimed invention.” -Remarks 04/16/2026, Page 11, 2nd ¶, lines 1-9
This argument has been considered and is not persuasive. See the new rejection necessitated by amendment in the office action above.
“Applicant submits that the skilled artisan would have to identify and screen thousands of ASOs in order to arrive at the claimed invention. Firstly, there is nothing within the cited art that teaches the targeting of exonic sequences of exon 8A of CACNA1C for the treatment of Timothy Syndrome Type-I. Hua, which was cited for teaching the ASO walking strategy, is specifically directed to target intronic sequences in order to treat spinal muscular atrophy (SMA) by targeting SMN2 splicing. Specifically, Hua states "Positive or negative signals, including ISSs residing upstream of a 3' splice site or downstream of a 5' splice site, can strongly affect exon recognition. To identify potential ISSs that inhibit SMN2 exon 7 inclusion, we systematically screened 60 nt of intronic sequences on either side of exon 7. We used 15-mer 20-O-methoxyethyl ribose (MOE)-modified phosphodiester ASOs, with 10 ASOs targeting each flanking intronic region." Accordingly, Hua specifically teaches targeting intronic regions for splicing modulation. In making the rejection, the Office also asserts that the most effective candidate of Hua "ASO-10-27" was named ISIS# 396443 in Bennet and was SEQ ID NO: 1 listed in claim 1 of Bennet. In fact, almost all of the sequences listed in the table in column 28 and Example 1 of Bennet can be found in Table 1 of Hua. Considering that Hua specifically targets intronic sequences, then Bennet also teaches the targeting of intronic sequences for splicing modulation.” -Remarks 04/16/2026, Page 11, 2nd ¶, lines 9-Page 12, line 4
This argument has been considered but is not persuasive. Hua (2008) does indeed teach targeting exonic regions for promoting exon skipping or exclusion (Page 835, left column, last ¶), and summarizes a previous effort involving ASO targeting of exonic cis regulatory elements to achieve splice modulation (Page 835, left column, last line – right column, first 3 lines). See office action above.
“Further, as stated above, Luzzio teaches targeting splice sites and not specifically targeting exonic sequences. Crooke is also silent with the specific targeting of exonic sequences. Accordingly, the skilled artisan looking to cited art would not be motivated to specifically target exonic sequences. A number of exonic and intronic elements are involved in splicing events. As stated by Hua, "These positive cis-elements, including exonic splicing enhancers (ESEs) and intronic splicing enhancers (ISEs). are generally binding sites for splicing activators, such as serine-arginine-rich (SR) proteins, or may adopt favorable secondary structures. ESEs and ISEs can counteract negative ciselements, such as exonic splicing silencers (ESSs) and intronic splicing silencers (ISSs). which generally are the binding sites for splicing repressors, such as certain hnRNP proteins, or adopt unfavorable higher-order structures." (Hua; introduction 1st paragraph; emphasis added) Accordingly, for the treatment of Timothy Syndrome Type-1 using an ASO, the skilled artisan could target exonic or intronic positive cis-elements for Exon 8A for exclusion of Exon 8A, or the skilled artisan could target exonic or intronic negative-cis elements of Exon 8 for Exon 8 inclusion. Thus, the skilled artisan wanting to treat Timothy Syndrome Type-I would target the intronic and exonic sequences of Exon 8 and Exon 8A of CACNA1C. As asserted by the Office, the GenBank accession presented on pg. 22-23 of the Office Action covers a total of 700nt. Using the Office's math, there would be about 680 possible 20nt ASO using a lnt shift in tiling. Accordingly, there are 680 20nt, 68119nt, 682 18nt, 683 17nt, and 684 16 nt ASOs totaling to 3,410 ASO sequences of ASOs between 16-20nts in length, the optimal length indicated by Crooke. The skilled artisan would then need to screen each of the 3,410 on cell lines to determine if the ASOs lead to a decrease in Exon 8A splicing and then test if each of the ASOs that passed the initial screening were able improve symptoms/phenotypes shown in both organoids and in animals containing the organoids. The above would present an extraordinary burden on the skilled artisan. Applicant submits that the large number of possible ASOs in view of the low levels of predictability in the art represents an unreasonable expectation of success.” -Remarks 04/16/2026, Page 13, 2nd ¶-3rd ¶
This argument has been considered but is not persuasive. Applicant’s acknowledgement of the teachings of Hua (2008) is noted. However, Hua (2008) teaches additional strategies. See office action above for new rejection necessitated by the amended claim scope.
Conclusion
No claims are allowable.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DELPHINUS DOU YI YU/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636