DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 10/27/2023. Claims 1-20 are currently pending.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Drawings
Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification:
The patent or application file contains at least one drawing executed in color, i.e. S21-376_STAN-2040_FIGs_as_filed.pdf, DOC CODE DRW.SUPP, submitted on 10/27/2023. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2).
The following descriptions for FIGs in the Brief Description of the Drawings recite colors in the FIGs:
Page 3, ¶[003], FIGs. 2A-2F. “Red arrow”
Page 4, ¶[005]., FIGs. 4A-4D. “(yellow triangles)”
Page 5, ¶[007], FIGs. 6A-6E. “(red)”
Page 6, ¶[0012], FIGs. 11A-11C. “Red boxes”
Claim Objections
Claim 20 is objected to because of the following informalities: The term “expectable excipient” in claim 20 is likely misspelled to mean “acceptable excipient”, see specification page 20, ¶[0058] and page 22, ¶[0067], while the accepted meaning is “an inactive ingredient in medicine that is safe, non-toxic, compatible with the drug, performs a necessary function, such as binding or stabilizing, meets quality standards, and doesn't negatively affect the drug's performance or the patient's health, ensuring the final product is effective, stable, and safe for use”, the term “expectable excipient” is not clearly defined in the specification. In fact, the search term “expectable excipient” in PE2E using all databases, i.e. US-PGPUB, USPAT, USOCR, FIT(61), FPRS, EPO, JPO, DERWENT, IBM_TDB, results in only the instant application in all searchable patent documents around the world and throughout the searchable history.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 17 and 20 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 17 recites the limitation “two or more agents". There is insufficient antecedent basis for this limitation in the claim. The phrase “two or more agents” are not clearly defined in the specification (page 18, ¶[0051]) either. Nowhere in the current disclosure is the term “agent” defined as “the agent of claim 1, which limits the “agent” with “wherein the agent modulates the splicing of an 8A or an 8 exon of CACNA1C”. The broadest reasonable interpretation (BRI) of “two or more agents” claim 17 may include any agent, including the “agent” of claim 1.
On page 18, ¶[0051] recites “In some embodiments, one of the two or more agents is an agent traditionally used to treat Timothy syndrome. Agents that are used traditionally to treat Timothy syndrome include, without limitation, a beta blocker, mexiletine, etc. When the agent is a beta blocker the beta blocker may be any beta blocker deemed useful. Beta blockers that find use in the present disclose include, without limitation, acebutolol, atenolol, labetalol, pindolol, propranolol, nadolol, timolol, sotalol, bisoprolol, nebivolol, metoprolol, etc.”. This indicates that the “two or more agents” may not have been intended by the applicant to refer to the “agent” of claim 1 “wherein the agent modulates the splicing of an 8A or an 8 exon of CACNA1C”, because beta blocker or mexiletine etc. do not modulate splicing of the 8A or the 8 exon of CACNA1C. This further confounds the scope and may extend the structures of “two or more agents” to include those not capable of modulating the splicing of exon 8A/8 of CACNA1C.
Appropriate correction is required.
Claim Rejections - 35 USC § 112 Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-8, 10-20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), the first paragraph, for failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USP USPQ2d at 1406.
Claim 1 directs to a broad genus, i.e. “an agent”, splicing modulators capable of correcting faulty RNA splicing by targeting proteins or RNA elements in the spliceosome, influencing how introns are removed and exons are joined to create mature mRNA. The specification acknowledges the broad genus in multiple sections, i.e. ¶[0045] “The agent may be any agent that modulates the splicing of an 8A or an 8 exon of CACNA1C”, also in ¶[0055], ¶[0085], and ¶[00110] that “Candidate agents of the present invention include, without limitation, a nucleic acid, a small molecule, a protein, or a compound”, and mentioned “viral vectors” as yet another broad species within the extremely broad genus. However, there is no disclosure of any core structure that is shared by members of the genus of agents that modulate splicing.
Based on a review article by Bates et al. (Pharmacology of Modulators of Alternative Splicing. Pharmacol Rev. 2017 Jan;69(1):63-79; Hereinafter, Bates), not only are the structures of these species diverse, unpredictable, and lack common mechanism to achieve splicing modulation, the instant specification never mentions any of the non-nucleic acid splicing modulator species beyond the above 3 instances of brief reference to generic species by general types only. Bates (2017) teaches diverse types of alternative splicing modulators that function through distinct mechanisms with different potency and specificity (pages 70-74, §VI Modulators of Alternative Splicing). Thus, there is insufficient discussion of representative species within the broad genus in the specification by focusing on only a few selected ASOs
Claim 2 directs to another broad genus “a nucleic acid”. Not all nucleic acids, such as synthetic double stranded DNA, can be used to directly modulate the splicing of 8A/8 exon of CACNA1C without perturbing genomic DNA. Bates (2017) does not teach that all types of nucleic acid can be, nor have been, used as splicing modulators. Again, there is insufficient discussion of representative species within the broad genus in the specification, and there is clear failure to disclose any core structure that is shared by members of the genus of agents that modulate splicing of the 8A/8 exon of CACNA1C.
Claim 3 directs to a broad genus of nucleic acid that are antisense oligonucleotide (ASO). The specification of the current application teaches that many ASOs used for screening did not successfully reduce the expression of 8A exon (page 24-25, ¶[0076] and FIG.2B), specifically, for instance, ASO20 (or A.20 in FIGs 2C and 2D; or ASO.CA20 in Table 1, page 25; Hereinafter, ASO20) was deemed not effective in splicing modulation upon further testing using different assays (FIGs. 2C and 2D). There is insufficient discussion of representative species within the broad genus in the specification, and there is clear failure to disclose any core structure that is shared by members of the genus of agents that modulate splicing of the 8A/8 exon of CACNA1C.
Claim 5 directs to another broad genus of “double-stranded silencing RNA (siRNA)”. Not every siRNA is capable of modulating the splicing of 8A or 8 exon of CACNA1C. And the structure and functional mechanisms of siRNAs differ dramatically from those of ASOs. There is insufficient discussion of representative species within the broad genus in the specification, and there is clear failure to disclose any core structure that is shared by members of the genus of agents that modulate splicing of the 8A/8 exon of CACNA1C.
Claim 17 directs to yet another broad genus by claiming “two or more agents”. Despite the attempt in the specification to expand on the claimed subject matter (page 18, ¶[0051]), the following description does not sufficiently describe the representative species within the “two or more agents” because the word “agent” or “agents” are not clearly defined in the specification:
“In some embodiments, the methods of the present disclosure include administering two or more agents. The two or more agents may be administered sequentially or simultaneously. The two or more agents may be the same type of agent or a different type of agent. In some embodiments, the two or more agents are nucleic acids. In some embodiments, the two or more nucleic acids target different parts of an 8A or 8 exon of CACNA1C. In some embodiments, one of the two or more agents is an agent traditionally used to treat Timothy syndrome. Agents that are used traditionally to treat Timothy syndrome include, without limitation, a beta blocker, mexiletine, etc. When the agent is a beta blocker the beta blocker may be any beta blocker deemed useful. Beta blockers that find use in the present disclose include, without limitation, acebutolol, atenolol, labetalol, pindolol, propranolol, nadolol, timolol, sotalol, bisoprolol, nebivolol, metoprolol, etc”. The examples of non-splicing modulators, such as beta blockers, acebutolol, etc. further confounds the definition of the term “agent”. There is insufficient discussion of representative species within the broad genus in the specification, and there is clear failure to disclose any core structure that is shared by members of the genus of agents that modulate splicing of the 8A/8 exon of CACNA1C.
The disclosure of insufficient species of a broad genus, the high degree of variation in the art, and the failure to disclose correlation between structure in the specification and the claimed function led to the determination that claims 1-3, 5, and 17 are overly broad with insufficient evidence of possession at the time of filing to one skilled in the art, particularly when some representative examples encompassed by the term “an agent” are shown as failures in the specification (e.g. ASO20 in FIG.2C, FIG.2D, page 24-25, ¶[0076]). Therefore, claims 1-3, 5, and 17 do not meet the written description requirement, and the ineffective ASO working examples presented in the specification demonstrate a clear lack of possession of the full genera as claimed.
Claims 4, 6-8, 10-16, 18-20 are also rejected for depending from the rejected claims 1-3 and failing to remedy the lack of written description therein.
Claim Rejections - 35 USC § 112 Scope of Enablement
Claims 1-8, 10-20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of using select antisense oligonucleotides (ASOs, specifically ASO14/ASO.CA14/A.14, ASO17/ASO.CA17/A.17, and ASO18/ASO.CA18/A.18, as single agent, all with uniform MOE ASO chemistry; SEQ ID NOs: 14-15; Table 1. Page 25; Hereinafter, ASO14, ASO17, ASO18) based on an ASO walk screening assay through trial-and-error-based testing and validations to modulate the alternative splicing of the CACNA1C exon 8A/8 and treat Timothy Syndrome 1 (TS1) only with definitive diagnosis based on genetic testing that confirms the presence of targetable mutations in the exon 8A of CACNA1C, the working examples using ASO only candidates (i.e. ASO14, ASO17, or ASO18) do not reasonably provide enablement for treating TS using any other ASOs, or other species of splicing modulators capable of modulating the alternative splicing of the exon 8A/8 in patients suffering from either subtypes of TS syndrome. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant Wands factors are indicated below:
Nature of the Invention
The claimed invention directs to a method of treating an individual having Timothy Syndrome (TS; type 1 or type 2, with definitive genetic testing-based diagnosis) using an effective dose of an agent capable of modulating the splicing of the CACNA1C exon 8A/8. Thus, the method requires a reliable implementation of: i) providing an effective dose of an agent; ii) evaluating the efficacy of required amount of the agent; iii) in any subject in need thereof with a genetic mutation that impact the exon 8A/8 splicing patterns in any individual suffering from TS (type 1 or type 2).
The Breadth of the Claims
The scope of the independent claim 1 limits the method to delivering a broad genus of agents that are not limited to just nucleic acids. Based on the broadest reasonable interpretation (BRI), numerous other types of molecules, including but not limited to, small molecules, proteins, viral vectors, etc. can all be included, which are acknowledged in the specification but no detail regarding the representative species is offered. Despite the brief references to these species in the specification, no working example is offered to support the breadth of the claim, nor is any core structure identified amongst the members of the broad genus in the specification to support the breadth of the claim.
Accordingly, claims 1 is unduly broad.
The scopes of the dependent claims 2, 3, 5 remain broad without any identification of common core structures respective to each claim. There are insufficient working examples in the specification to support the full breath of the claims.
Accordingly, claims 2, 3, 5 are unduly broad.
The scopes of the dependent claims 12-14, 19 relate to therapeutic targeting of predominantly extracranial (systems outside the brain) faulty splicing of the exon 8A/8 of CACNA1C, the cause of Type 2 TS. The scopes remain broad without any indication of common core structures respective to each claim by inheriting the limitations of claim 1, and no Type 2 TS-related working example are presented in the specification to provide enabling support for such broad scopes.
Accordingly, claims 12-14, 19 are unduly broad.
The scope of the dependent claim 17 introduces “two or more agents” without proper definition of the “two or more agents”. Based on the BRI, and the few examples provided in the specification (page 18, ¶[0051]), any agent could be added to the agent of claim 1 “without limitation” (page 18, ¶[0051]). No common core structure was identified in the specification for “two or more agents”, and no working example presented in the specification provides enabling support for such broad scope.
Accordingly, claim 17 is unduly broad.
Guidance of the Specification
The specification is silent as to what treatment outcomes should be reasonably expected by persons skilled in the art for splicing modulators other than ASOs, i.e. small molecules, proteins, siRNAs, viral vectors etc. given the distinct structures, lengths, chemical modification strategies, and delivery methods between ASOs and small molecules, proteins, and siRNAs. Even within the genus of ASOs, substantial trial-and-error-based screening and validations is required to identify effective splicing modulators given the high unpredictability of different ASO sequences as demonstrated by the specification. To one skilled in the art, the example in the instant application is not seen as working examples of treating TS using every ASO molecule, small molecules, siRNAs, proteins, or viral vectors.
Furthermore, splicing modulations to reduce exon 8 expression in the pre-mRNA of CACNA1C is claimed as a treatment for TS2. However, the specification is silent on whether the mutation(s) in the exon 8 of CACNA1C also demonstrates aberrations in abnormal amplification in developing interneurons and mature cortical neurons, similar to the amplification of the mutated exon 8A for TS1 patient derived iPSCs and assembloids as described in the specification (page 24, ¶[0074]). Therefore, it is unknown, in literature or in the instant specification, whether TS2 patient derived iPSCs would demonstrate a similar pattern of aberrant amplification in mutated exon 8 expression over exon 8A over time, which would justify a similar therapeutic measure using ASOs to treat TS2 patients. A further confounding factor is the fact that control iPSCs demonstrate the switching-over phenomenon from predominant exon 8A expression during development to predominant exon 8 expression in normal mature neurons. ASO treatment to decrease exon 8 expression, even if it is intended to reduce the amplification of mutated exon 8, the impact is unknown for mature neurons that normally expression exon 8 after developmental switching-over from exon 8A. The absence of working example regarding TS2 models indicate a lack of enablement. The recent publication by the inventors, Chen et al. (2024. Antisense oligonucleotide therapeutic approach for Timothy Syndrome. Nature 628, 818–825; Hereinafter, Chen) remains silent on this subject as well, despite publishing nearly 2 years after the priority date, which indicates a lack of enablement for TS2-related ASO discovery.
Lastly, Type 2 TS demonstrates significant symptoms outside the central nervous system, therefore, it is likely necessary to explore systemic delivery strategies to any potential therapeutic agents developed to target, e.g. the cardiac system. However, the instant application based on all discovery activities using iPSC-derived organoids and assembloids which only recapitulate limited organ-specific microenvironment, i.e. the brain, which is relatively insulated from the systemic circulation by the blood brain barrier. Conversely, the specification does not enable treatment for TS2 as claimed because the brain-specific assembloids do not represent adequate models for cardiac system or any extracranial systems where TS2 show greater impact.
The State of the Prior Art
With regard to the state of the art, using ASOs to treat various splicing-related disorders are on the rise. In 2016, the FDA approved two significant antisense oligonucleotide (ASO) therapies: Eteplirsen (Exondys 51) for Duchenne Muscular Dystrophy (DMD) and Nusinersen (Spinraza) for Spinal Muscular Atrophy (SMA), marking major advancements for ASO treatments, with Nusinersen being the first FDA-approved therapy for SMA. Hill & Meisler (Antisense Oligonucleotide Therapy for Neurodevelopmental Disorders. Dev Neurosci. 2021;43(3-4):247-252; Hereinafter, Hill) teaches the state of art in developing ASO based splicing modulation therapies for a variety of neurodevelopmental disorders. Hill (2021) cautions that “Several factors complicate the use of ASOs for neurodevelopmental disorders. Since currently constituted ASOs do not cross the blood-brain barrier, injection into the cerebrospinal fluid is required for efficient neuronal uptake. In addition, the limited half-lives intrathecal administration require two to four treatments per year. Since both gain-of-function and loss-of-function variants of the same gene can be pathogenic, it is necessary to determine the mode of action of each variant before designing the ASO treatment. The quantitative level of elevated or reduced expression is another important consideration. For example, treatment of gain-of-function variants of SCN8A in DEE require reduced gene expression, but haploinsufficiency is associated with another, less severe, disorder. Finally, because of the timing of development of the nervous system, it may be necessary to initiate treatment very early.”, when commenting on the challenges in the development of ASO therapies for neurodevelopmental disorders (page 5 of the NIHMS author manuscript).
In terms of treatment or symptom management, Han et al. (Dysfunctional Cav1.2 channel in Timothy syndrome, from cell to bedside. Exp Biol Med (Maywood). 2019 Sep;244(12):960-971; Hereinafter, Han) summarizes the state of prior art before the effective filing date of the instant application. Han (2019) teaches that since TS typically involve multiple organ symptoms, a major development for the cardiac functions in recent years has led to management strategies that involve beta-blockers to regulate heart rate, and implantable devices (pacemakers) for serious arrhythmias. For neurological and psychiatric symptoms, current symptom managing plan involves special education, behavioral therapies, and medications (like anti-seizure meds for epilepsy, if present). Surgery for webbed fingers/toes (syndactyly), blood sugar monitoring, and nutrition support. However, since nucleic acid-based therapeutics targeting the psychiatric symptoms of TS patients were still under development, there was no mention of potential ASO-based TS therapeutics at that time, before the effective filing date of the instant application.
The Level of Predictability in the Art
As described in the specification of the current application, a high-throughput “ASO walk” strategy was used to screen for searching for effective ASOs that are capable of modulating the alternative splicing of CACNA1C pre-mRNA (page 24, ¶[0076]), indicating the high levels of unpredictability of ASO sequences. FIG.2B also showcases the high levels of unpredictability, or lack of predictability, of ASOs for effective splice modulation for CACNA1A exon 8A/8 expression in human iPSCs due to the high variability across different ASO candidate sequences demonstrated therein. Only extremely limited ASO candidates became enabled after trial-and-error-based testing and validation, namely, ASO14, ASO17, ASO18 in the current application. This level of unpredictability is known in the art as demonstrated by Hua et al (Antisense masking of an hnRNP A1/A2 intronic splicing silencer corrects SMN2 splicing in transgenic mice. Am J Hum Genet. 2008 Apr;82(4):834-48; Hereinafter, Hua) in their efforts to perform systemic tiling or ASO walking to identify the optimal ASOs to treat mis-splicing associated with SMA. Hua teaches the systemic tiling of the splice site using overlapping ASO sequence candidates to perform screening in the effort to identify the most effective ASOs that successfully modulate splicing (Figure. 1, page 837; shown below). Numerous ASO candidates are shown in the
PNG
media_image1.png
567
584
media_image1.png
Greyscale
instant specification that do not effectively modulate the splicing of exon 8A/8 of CACNA1C, indicating the lack of enablement for most of ASOs.
Incidentally, no siRNA was demonstrated to be capable of modulating the alternative splicing of exon 8A/8 of CACNA1C pre-mRNA in the instant application. Cooke et al. (Antisense technology: A review. J Biol Chem. 2021 Jan-Jun;296:100416.; Hereinafter, Cooke) teaches that, although both are generally categorized under antisense technology, antisense oligonucleotides (ASOs) and small interfering RNAs (siRNAs) are distinct nucleic acid modalities that silence gene expression through different biological pathways and structures. Cooke (2021) teaches (page 8, Figure 1; page 25, Figure 4; page 26, Figure 5) that ASOs are single-stranded synthetic molecules that primarily operate in both the nucleus and cytoplasm, functioning through RNase H-mediated cleavage of mRNA or by sterically blocking translation and splicing. In contrast, siRNAs are double-stranded RNA duplexes that function almost exclusively in the cytoplasm by leveraging the RNA-induced silencing complex (RISC) to achieve target mRNA degradation. Cooke (2021) further teaches (page 10, Figure 2) that, while ASOs are often stable enough to be delivered via simple chemical modifications, siRNAs are more complex and typically require advanced delivery systems like lipid nanoparticles or GalNAc conjugation to reach their targets. Both technologies are widely utilized in clinical settings, with their selection depending on whether the target requires nuclear intervention, such as splicing modulation, or the highly efficient cytoplasmic characteristic of the RNAi pathway.
Liu et al. (Expanding the action of duplex RNAs into the nucleus: redirecting alternative splicing. Nucleic Acids Res. 2012 Feb;40(3):1240-50. Epub 2011 Sep 23.; Hereinafter, Liu) teaches that duplex siRNAs can be used to modulate splicing of SMN2, but depending on the target sites, tiling is still required to identify the specific siRNAs to effectively achieve splicing modulation (page 1247, Figure 6; page 1248, left column, line 1-4). This indicates the high levels of unpredictability in the art, and enablement for specific siRNA must be proven by trial-and-error-based screening, which cannot be deduced based on the enabled ASO sequences (i.e. ASO14, ASO16, ASO17). Since no prior art exist to demonstrate the feasibility of siRNA-based splicing modulation of CACNA1C, the probability of identifying effective siRNAs to modulate the splicing of exon 8A/8 of CACNA1C remains unpredictable.
Lastly, the instant specification is silent on the impact of ASOs (or siRNAs) on the exon 8A/8 alternative splicing in TS2 iPSC cell models or assembloid models, further indicating the lack of predictability and enablement in the art.
The Quantity of Experimentation necessarily Needed
In light of the high level of unpredictability in the art, and the limited amount of direction provided by the inventor for targeting CACNA1C iPSC-based TS models in vitro and in vivo, and the noticeable absence of working examples for TS2 treatments using ASO, in addition to the potential of using multiple agents with unlimited molecular types, structure, and action mechanisms as claimed in claim 17, the quantity of experimentation necessarily needed to make or use the invention as claimed is considerably high, especially with respect to treating TS2 and using diverse types of “agent(s)” to treat TS1 via alternative splicing modulation based on the disclosure.
For example, it would be necessary for one skilled in the art to identify optimal ASO or siRNA sequences through a high-throughput screening method to select optimal therapeutic agent(s), determine dosing timing and schemes, and compare a large number of combinations of unlimited agents to make or use the invention to treat various clinical indications of Timothy Syndrome subtypes. There would be an unreasonable amount of experimentation required by one skilled in the art.
Conclusion of 35 U.S.C. 112(a) Enablement Analysis
After applying the Wands factors and analysis to claims 1-3, 5, 10, 12-15, and 17, taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant and the specific examples, in view of the applicant’s entire disclosure, it is concluded that the specification is not enabled for the full scope as discussed above. Therefore, claims 1 and 8 are rejected under 35 U.S.C. §112(a) for failing to disclose sufficient information to enable a person of skill in the art to use the invention commensurate in scope with these claims.
Claims 4, 6-8, 10-16, 18-20 are also rejected for depending from claim 1 and failing to remedy the lack of enablement therein.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-4, 6-7, 9, 18, 20 are rejected under 35 U.S.C. 103 as being unpatentable over Bennett et al. (US-9717750-B2, published 08/01/2017; Hereinafter, Bennett) in view of Hua (2008) and Cooke (2021), and in further view of Luzzio et al. (WO-2019028440-A1, published 02/07/2019; Hereinafter, Luzzio).
Bennett teaches a method of treating a mutation-induced central nervous system disorder using an antisense nucleic acid-based splicing modulator administered to the intrathecal space (US-9717750-B2, published 08/01/2017; Title: Compositions and methods for modulation of SMN2 splicing in a subject). Claim 1 (page 43, columns 53-55): “A method comprising administering by a bolus injection into the intrathecal space of a human subject having … an antisense compound comprising an antisense oligonucleotide consisting …, wherein each nucleoside of the oligonucleotide is a 2′-MOE nucleoside, and wherein the administering of the antisense compound ameliorates at least one symptom of … in the human subject.”
Bennett does not teach specifically how the effective ASOs were identified.
Hua (2008) teaches a method of identifying effective ASO hybridization sites using a systemic tiling/ASO walk strategy using overlapping ASO sequences to cover the entire splice site relevant to mis-splicing of the SMN2 gene (Figure 1, page 837; shown above in 112 Scope of Enablement analysis; Page 837, left column, last ¶; right column, first ¶). The most effect candidate was identified as “ASO-10-27” (Page 843, left column, first ¶, lines 6-7), which was later named “ISIS# 396443” (Bennett, page 37, Example 8, column 41, Table, SEQ ID NO: 1). Bennett and Hua both teach that only limited ASO molecules with substantial trial-and-error-based screening and validations can ultimately be selected for further validations via clinical trials. Not all ASOs are suitable therapeutic candidates, and most will not be enabled for specific therapeutic splicing modulation outcomes.
Furthermore, Hua (2008) only taught ASO walk using 12-, 15-, 16-, and 18-mer ASOs for the systemic tiling/ASO walk, and does not teach screening using 20-mer ASOs.
Cooke (2021) teaches that “the specificity for the cognate sequence versus all other RNAs varies inversely with length to at least 18 to 20 nucleotides. Theoretical analyses and experimental results have shown that higher-affinity PS ASOs have optimal affinity and specificity between 16 and 18 nucleotides. The propensity of PS ASOs to form self-structures that inhibit binding to cognate sequences and other effects increases when ASO length exceeds 20 to 22 nucleotides, resulting in current approaches being generally limited to 16 to 20 nucleotides”, (Page 11, right column, first ¶, lines 6-14). This common knowledge in the art would lead to persons having ordinary skill in the art to search for effective ASOs with a length of 16-20nt when using ASO walk or systematic tiling-based screening strategies.
However, neither Bennett, nor Hua, nor Cooke teaches applying the same ASO-based splice modulation strategies to search for and treat a subject suffering from Timothy Syndrome.
Luzzio teaches methods using splicing modulators to treat a subject with a disease, such as Timothy Syndrome Type 1 and Type 2. By modulating the alternative splicing of a target gene, such as CACNA1C, where gain-of-function mutation, such as G406R(G>A) or G402R(G>A) on the exon 8A or exon 8, leads to Type 1 and/or Type 2 Timothy Syndrome, the alternative splicing could be shifted to the non-mutation-bearing exon to restore normal function (Luzzio, page 277 Table 2A, 6th gene in the table from the top). Please see the attached partial view of the Table 2A that includes CACNA1C target gene and related mutations for Timothy Syndrome below.
PNG
media_image2.png
661
860
media_image2.png
Greyscale
Claim 125 of Luzzio teaches: “A method of treating a subject with a disease or condition comprising administering a … splicing modulator … to a subject with a disease or condition, wherein the …binds to a pre-mRNA ….” (page 430, claim 125).
Luzzio does not teach using ASO-based splicing modulators, nor does it describe how to identify ASO molecule sequences to achieve effective splicing modulation to specifically treat Type 1 Timothy Syndrome.
It would have been obvious to persons having ordinary skill in the art (PHOSITAs) before the effective filing date of the claimed invention to have tried to use ASOs as described by Bennett in view of Hua and Cooke to treat Timothy Syndrome as described by Luzzio. There remains a well-established need in the art of treating Timothy Syndrome as a disorder with known defective alternative splicing as the root cause as described by Luzzio. The mutation and resultant mis-splicing of the exon 8A or 8 of CACNA1C was known in the prior art as demonstrated by Luzzio. It was known to make and use antisense oligos to treat mis-splicing in individuals having a disorder as a result of said mis-splicing, as described by Bennett in view of the systematic tiling or ASO walk screening methods to identify an effective ASO by Hua and modified the length of ASOs used for the screening based on teachings of Cooke. Given the known 102nt target sequence of the exon 8 of CACNA1C, there would have been a finite number of possible oligos (83 total 20nt ASOs to cover the entire length of the exon 8) that would accomplish that. Since Bennett and Hua show that ASO walk can be used to systematically test oligos to identify an antisense oligo that treats the mis-splicing, that PHOSITAs would have had a reasonable expectation of success in applying the known method of ASO walk to treat the known disease of TS1 caused by CACNA1C mis-splicing.
Regarding claims 2-4, Bennett further teaches using a nucleic acid splicing modulator, an ASO, and 2'-O-methoxyethylribose modifications to the nucleobases in the ASO (column 53-55, claim 1). Claim 1 (page 43, columns 53-55): “A method comprising administering by a bolus injection into the intrathecal space of a human subject having … an antisense compound comprising an antisense oligonucleotide consisting …, wherein each nucleoside of the oligonucleotide is a 2′-MOE nucleoside, ....”
Regarding claims 6 and 7, the rationale of “obvious to try” continues to apply in view of Bennett, Hua, and Cooke, in further view of Luzzio because it further teaches targeting the G406R mutations, which are known genetic cause of TS, specifically for Type 1 Timothy Syndrome. In the partial view of the Table 2A attached above, these details have been summarized as potential therapeutic targets of splicing modulators claimed by Luzzio.
Regarding claim 9, the claimed best performing ASOs with sequences SEQ ID NOs: 14-16, ASO14, ASO17, and ASO18 are all reverse complementary to 20nt loci within the exon 8 of human CACNA1C gene (GenBank: Z26263.1; listed on the PTO-892 form and submitted the document) and the CACNA1C transcript mRNA (NM_199460.4; listed on the PTO-892 form and submitted the document). Using the human CACNA1C isoform 1 gene of the L-type calcium channel, which includes both the alternative exon 8A and alternative exon 8 (1-700nt, GenBank: Z26263.1), for visualization, as shown below:
Intron, 1-42nt; exon, 43-145nt (alternative exon 8A); intron, 146-448nt; exon, 449-551nt (alternative exon 8); intron, 552-700nt.
[AltContent: textbox ( Exon 8A)]
[AltContent: textbox ( Exon 8A)]caattctgcttcttctttcctaactttccttcgtctttccagatgcaggacgctatgggctatgagttaccctgggtgtattttgt
cagtctggtcatctttggatcctttttcgttctaaatctggttctcggtgtgttgagcgggtaagctgaccgtttctatgtcctct
ccacaacgcagccgagcaaggtctcaggttccactccgtacatgcccggggtcctcagggatgggaccctgacaggcccagg
aaaaccacaacaaagcctctgttcaaccacagattctgacccattggccaggcaggctgtttggcctctgatttgcacctagag
[AltContent: textbox ( Exon 8)]ggtccccggatcctggcgctgcgtgggtcagtgtctcgggaccgggggaccgcgactggccgtgctcggttgctgagtgtgcct
[AltContent: textbox ( ASO14)]cactaactatcattccgttcttccaggtcaatgatgccgtaggaagggactggccctggatctattttgttacactaatcat
[AltContent: textbox ( ASO18)][AltContent: textbox ( ASO17)]
[AltContent: textbox ( Exon 8)]
catagggtcattttttgtacttaacttggttctcggtgtgcttagcgggtaagcaggaccaaggaaaaaggtcttgatttttcc
atttatttttatttattctttctgctattcctggctgtattctttttctggctctgatgaacctgggataaggggtcaccacaggagc
cttgaagtggatgtccttgtcctg
ASO14 (AAATAGATCCAGGGCCAGTC, reverse complementary to gactggccctggatctattt) binds to 470-489nt of the alternative exon 8.
ASO17 (CAGTCCCTTCCTACGGCATC, reverse complementary to gatgccgtaggaagggactg) binds to 455-474nt of the alternative exon 8
ASO18 (CCTTCCTACGGCATCATTGA, reverse complementary to tcaatgatgccgtaggaagg) binds to 450-469nt of the alternative exon 8
The accession reports for the Homo sapiens calcium voltage-gated channel subunit alpha1 C (CACNA1C), transcript variant 1, mRNA, NCBI Reference Sequence: NM_199460.4 and the CACNA1C gene isoform that includes exon 8A, exon 8 and flanking introns are both listed in the PTO-892 form and attached. These sequence reports serve as evidence that the effective top ASO candidates as claimed are within a finite number of identifiable potential solutions.
Persons with ordinary skill in the art would have reasonable expectation for success in applying the known successful ASO walk/walking/tiling strategy of Bennett and Hua in view of Cooke to identify the same ASO candidates as claimed to treat the known genetic problem of Timothy Syndrome, specifically for Type 1 TS, evidenced by Luzzio, to identify the top candidate ASO sequences as claimed in the current application.
The fact that all 3 claimed ASO sequences claimed in the current application map to complementary regions within the 102nt sequence of exon 8 of the CACNA1C gene dramatically reduces the number of 20nt ASO sequence candidates for persons of ordinary skill in the art to identify using established systemic tilling or ASO walking strategies to target and cover the 102nt exon 8, as there are only 83 20nt ASO sequences maximum to cover the 102nt exon 8 sequence with only 1nt shift in tiling, conversely, 84x19nt, 85x18nt, 86x17nt, 87x16nt, for a total of 425 ASO sequences that are 16nt to 20nt long at maximum to cover the entire 102nt exon 8 of CACNA1C based on the 16-20nt optimal ASO length taught by Cooke (Page 11, right column, first ¶, lines 6-14).
PNG
media_image3.png
312
1120
media_image3.png
Greyscale
PNG
media_image4.png
302
1107
media_image4.png
Greyscale
PNG
media_image5.png
301
1112
media_image5.png
Greyscale
The transcriptome hybridization sites of ASO14, ASO 17, ASO18 can be seen in the NCBI Nucleotide Blast result screenshot. Based on the transcript variant 1 of the CACNA1C mRNA, NM_199460.04, which only includes exon 8, not exon 8A, due to the mutual exclusivity.
Regarding claim 18, Bennett further teaches local administration of the therapeutic ASO via intrathecal route of delivery (Claim 1 [page 43, columns 53-55]: “A method comprising administering by a bolus injection into the intrathecal space of a human subject having … an antisense compound comprising an antisense oligonucleotide … in the human subject.”) in order to provide concentrated therapeutics to the spinal cord and brain via the circulating CSF. For the predominant neuropsychiatric symptoms of TS1, similar routine CNS delivery routes, such as intrathecal, intracerebroventricular, and intracranial injections are obvious choices to deliver sufficiently effective doses of the claimed inventions.
Regarding claim 20, assuming “expected excipient” is simply misspelled “accepted excipient”, Bennett further teaches effective ASO-mediated splicing modulation in the CNS using accepted excipient (page 28, column, lines 49-55:” In certain embodiments antisense compounds, can be utilized in pharmaceutical compositions by combining such oligomeric compounds with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally.”
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DELPHINUS DOU YI YU/Examiner, Art Unit 1636
/NEIL P HAMMELL/ Supervisory Patent Examiner, Art Unit 1636