DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I, encompassed by claims 1-16, in the reply filed on 6 April 2026 is acknowledged.
Claims withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 6 April 2026.
Applicant’s election without traverse for Election 1 in the Restriction Requirement mailed 6 February 2026 of enzyme StuI, first ROI-specific sequence of SEQ ID NO: 6, and the second ROI-specific sequence of SEQ ID NO: 7 or SEQ ID NO: 8 in the reply filed on 6 April 2026 is acknowledged.
Claims 4-5 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 6 April 2026.
During a telephonic interview with Tambryn VanHeyningen on 8 June 2026, Applicant clarified that the election made in the Response filed 6 April 2026 read on the adaptor-barcode primer comprising a sequence selected from SEQ ID NOs: 34 and 119-125 and the exon-specific reverse primer comprising a sequence selected from SEQ ID NOs: 36 and 182-188 for Election 2 in the Restriction Requirement mailed 6 February 2026. Based on the clarification in this interview, Applicant’s election without traverse for Election 2 in the Restriction Requirement mailed 6 February 2026 of the adaptor-barcode primer comprising a sequence selected from SEQ ID NOs: 34 and 119-125 and the exon-specific reverse primer comprising a sequence selected from SEQ ID NOs: 36 and 182-188 in the reply filed on 6 April 2026 is acknowledged.
Claims 10-11 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 6 April 2026.
Information Disclosure Statement
The listing of references in the specification (lists beginning on page 43 and 52 of the instant specification filed 9 June 2026) is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892 or in a proper information disclosure statement, they have not been considered.
The two information disclosure statements (IDS) filed 30 December 2024 are considered, initialed, and attached hereto.
Claim Status
Claims 1-19 are pending.
Claims 4-5, 10-11, and 17-19 are withdrawn.
Claims 1-3, 6-9, and 12-16 are under examination.
Response to Amendment
The supplemental amendments and replacement sequence listing filed 9 June 2026 have been entered. Applicant’s remarks and amendments have been fully and carefully considered. For clarity of the record, it is noted that the supplemental amendment was filed after the interview of 8 June 2026. Applicant’s amendments to the Specification and Drawings and replacement sequence listing brings the sequence disclosure into compliance. Therefore, the objection to the sequence disclosure in the Requirement for Restriction mailed 6 February 2026 is withdrawn.
Drawings
Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification:
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2). No petition for acceptance of color drawings has been received, therefore the color drawings filed 1 November 2023 and 9 June 2026 are objected to.
Specification
The use of terms such as Illumina, Ion Torrent, NEB, QIAquick, which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections - 35 USC § 112(b) - Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-3, 7-9, and 12-16 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites the limitation "the forward adapt" in line 12. There is insufficient antecedent basis for this limitation in the claim, because it is unclear whether this recitation refers to the sequence of the recited “a forward adaptor” in line 5 of claim 1 or “a forward adaptor sequence” recited in lines 7-8 of claim 1. It is noted that these two recitations are different, because the sequence of the forward adaptor in line 5 is added to the 3’ end of the ROI based on the forward adapter sequence of the adaptor-barcode primer in lines 7-8, so these recited sequences are reverse complements of each other. For the purpose of examination, this limitation is interpreted as referring to the sequence of the forward adaptor added to the 3’ end of the ROI because step (c) suggests that “the forward adaptor sequence” of this limitation is on the barcoded DNA. Claims 2-3, 7-9, and 12-16 are rejected based on their dependency on claim 1 (though claim 6 depends on claim 1, claim 6 cures this rejection because the claimed forward adaptor primer comprising SEQ ID NO: 2 clearly does not anneal to the forward adaptor sequence of SEQ ID NO: 1 but rather two the forward adaptor sequence added to the digested ROI).
Claim Rejections - 35 USC § 112(a) - Enablement
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-3, 6-9, and 12-16 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
Scope of the Claims/Nature of the Invention
The claims are drawn to a method of detecting a mutation in a KRAS gene in a sample from a human subject, limited by steps (a)-(e) recited in claim 1 and further limited in claims 2-3, 6-9, and 12-16 that depend upon claim 1. The nature of the invention is a method of detecting a mutation by amplifying and sequencing a region of interest.
Teachings in the Specification and Examples
Example 2 of the instant specification teaches the reduction to practice of a method, Maximum depth sequencing (MDS), of detecting a mutation in a region of interest of the KRAS gene in a sample from a human subject. However, the method of Example 2 is not the method of claim 1. In the method of Example 2:
Genomic DNA is first digested by an enzyme that cleaves at the 3’ end of a region of interest (page 49, lines 16-18; equivalent to step (a) of claim 1).
Then the digested DNA has a barcode and an adaptor added to the 3’ end of the ROI by extending the digested DNA based on the adaptor-barcode primer hybridized to it, creating a barcoded DNA (page 49, lines 22-24; equivalent to step (b) of claim 1).
Then the barcoded DNA is linearly amplified using a forward adaptor primer that anneals to the adaptor of the digested DNA (page 50, lines 3-4; note that on pages 50 and 51 the forward-adaptor primer and forward adaptor sequence of the adaptor-barcode primer have an identical 18 base stretch, so the forward-adaptor primer will be complementary to the barcoded DNA that has an adaptor from extending using the adaptor-barcode primer as a template; equivalent to step (c) of claim 1 as interpreted in the 35 U.S.C. 112(b) rejection above).
Then the exon-specific reverse primer and reverse adaptor primer were added (to the mix of the barcoded DNA, linearly amplified reverse complement of the barcoded DNA, and forward adaptor primers) and subjected to exponential amplification (page 50, lines 8-10). This is not equivalent to step (d) of claim 1. Firstly, the first ROI-specific sequence, in the adaptor-barcode primer in claim 1 is recited as “complementary to the 3’ end of the digested ROI” and the second ROI-specific sequence, in the exon-specific reverse primer, is recited as “complementary to the 5’ end of the digested ROI”. For both ROI-specific sequences to be complementary to the digested ROI, they should align to the Kras gene in the same orientation (or be a palindrome, thereby being able to bind to either strand at the same site). However, when the ROI-specific sequences of the adaptor-barcode primer and exon-specific reverse primer of Example 2 are aligned to the Kras gene with NCBI BLAST, they align in opposite orientations such that the ROI-specific sequence of the exon-specific reverse primer is complementary to the reverse complement (produced by linear amplification in step 3/(c)) of the 5’ end of the digested ROI (see Alignment 1 and Alignment 2 below this paragraph) and they are clearly not palindromic. The version of the exon-specific reverse primer in claim 1 would not appear to be functional to one of ordinary skill in the art, since by being complementary to the 5’ end of the ROI, it’s 3’ end that would be extended would point away from the ROI, barcode, and adaptor that have been added, so the reverse adaptor would not be added to a product with the ROI, barcode, and adaptor. In contrast, in Example 2 the exon-specific reverse primer will extend toward the ROI, barcode, and adaptor, producing a product that has, from 5’ to 3’, the reverse adaptor, the ROI, the barcode, and the adaptor, which is the desired product for the forward adaptor primer and reverse adaptor primer to exponentially amplify. Secondly, claim 1 recites that the reverse adaptor primer anneals to the reverse adaptor sequence (which is in the exon-specific reverse primer). Example 2 does not teach this, but rather that the reverse adaptor primer shares all 23 bases with the 5’ end of the reverse adaptor sequence and is not palindromic, so the reverse adaptor primer of Example 2 anneals only to the reverse complement of the reverse adaptor primer (sequences on page 51).
PNG
media_image1.png
203
695
media_image1.png
Greyscale
Alignment 1: NCBI BLAST alignment of the Kras exon I StuI (transcribed strand) SEQ ID NO:6 ROI-specific sequence of the adaptor barcode primer (page 51).
PNG
media_image2.png
203
681
media_image2.png
Greyscale
Alignment 2: NCBI BLAST alignment of the Kras exon I StuI (transcribed strand) SEQ ID NO: 7 ROI-specific sequence of the exon-specific reverse primer (page 51).
Therefore, in view of the closest working example in the specification not falling within the breadth of the claimed method, the specification does not enable one of ordinary skill in the art to perform the method as claimed.
State of the Art and Unpredictability of the Art
Though not eligible as prior art, the art of Li and Counter (“An ultra-sensitive method to detect mutations in human RAS templates” Small GTPases 13(1), pages 287-295 (2022), published less than a year before the effective filing date of the applications and all authors are inventors on the application) is illustrative of the understanding one of ordinary skill in the art would have of the detection of mutations by amplification and sequencing. Li and Counter teach a MDS method, wherein the exon-specific reverse primer is not complementary to the 5’ end of the digested ROI, but rather is complementary to the reverse complement (produced during linear amplification) of the 5’ end of the digested ROI, like in Example 2 of the instant specification (Figure 1, page 2). Furthermore, the reverse-adaptor primer of Li and Counter does not anneal to the reverse adaptor sequence of the exon-specific reverse primer, but rather to the reverse complement of the reverse adaptor sequence of the exon-specific reverse primer because all 23 bases of the reverse-adaptor primer are at the 5’ end of the reverse adaptor sequence (MDS assay and library purification section, page 6). Therefore, the state of the art would not teach one of ordinary skill in the art how to use an exon-specific reverse primer comprising an ROI-specific sequence that is complementary to the 5’ end of the digested ROI and a reverse adaptor primer that anneals to the reverse adaptor sequence of the exon-specific reverse primer to amplify a ROI for subsequent sequence and detection of a mutation.
Quantity of Experimentation
The quantity of experimentation necessary to enable the full scope of the claims is undue. In order to practice the breadth of the claimed invention, one of ordinary skill in the art would need to discover a method of annealing the second ROI-specific sequence that is complementary to the 5’ end of the digested ROI to the reverse complement of the 5’ end of the digested ROI in order for it to be able to extend and produce a functional product for the exponential amplification step. As this would seem to violate the basic rules of base pairing, extensive experimentation would need to be done. The specification has not done any of the above. The results of such experimentation are highly unpredictable. The amount of experimentation that would be required to practice the full scope of the claimed invention and the amount of time and cost this experimentation would take supports the position that such experimentation is undue (see MPEP §2164.06).
Conclusions
Herein, although the level of ordinary skill in the art is high, given the disclosure in the specification and in the prior art that contradicts the claimed invention and the unpredictability of the art, it would require undue experimentation for one of ordinary skill in the art to make and use the invention as claimed in claims 1-3, 6-9, and 12-16.
In the interest of compact prosecution, for the purpose of applying prior art under 35 U.S.C. 102 and 103, claim 1 is interpreted in light of Example 2 of the instant specification as replacing the recitation “a second ROI-specific sequence that is complementary to the 5’ end of the digested ROI” in lines 19-20 with “a second ROI-specific sequence that is complementary to the reverse complement of the 5’ end of the digested ROI” and the recitation “a reverse adaptor primer that anneals to the reverse adaptor sequence” in line 22 with “a reverse adaptor primer that anneals to the reverse complement of the reverse adaptor sequence” in order to search for art pertaining to an enabled version of the claims.
Claim Rejections - 35 USC § 112(d) - Dependent Form
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 3 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 3 depends upon claim 1 via its dependency on claim 2. However, the first ROI-specific sequence of SEQ ID NO: 6 aligns with the KRAS gene in the opposite orientation to the second ROI-specific sequence of SEQ ID NO: 7 or SEQ ID NO: 8 (see Alignments 3-5 below this paragraph). As claim 1 recites that the first ROI-specific sequence is complementary to the 3’ end of the digested ROI and the second ROI-specific sequence is complementary to the 5’ end of the digested ROI, the ROI-specific sequences are required to be complementary to the same strand of the ROI and should align in the same direction. Therefore, the combination of SEQ ID NOs recited in claim 3 is outside of the scope of claim 1, and claim 3 thus fails to include all the limitations of the claims upon which it depends. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
PNG
media_image1.png
203
695
media_image1.png
Greyscale
Alignment 3: NCBI BLAST alignment of SEQ ID NO: 6.
PNG
media_image2.png
203
681
media_image2.png
Greyscale
Alignment 4: NCBI BLAST alignment of SEQ ID NO: 7.
PNG
media_image3.png
197
681
media_image3.png
Greyscale
Alignment 5: NCBI BLAST alignment of SEQ ID NO: 8.
Claim 7 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 7 depends upon claim 1. However, the reverse adaptor primer of SEQ ID NO: 4 is identical to the first 13 nucleotides of the reverse adaptor sequence of SEQ ID NO: 3 and is not palindromic such that it would be its own reverse complement, so SEQ ID NOs: 3 and 4 would not be expected to be able to anneal to each other. As claim 1 recites that the reverse adaptor primer anneals to the reverse adaptor sequence, the combination of SEQ ID NOs recited in claim 7 is outside of the scope of claim 1. Therefore, claim 7 fails to include all the limitations of the claims upon which it depends. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claims 12 and 13 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claims 12 and 13 (via its dependency on 12) depend upon claim 9 and claim 8 via claim 9. However, SEQ ID NO: 34 in claim 12 and SEQ ID NO: 36 in claim 13 have no index sequence (or the index sequence can be considered to be 0 nucleotides long). This is outside of the scope of claim 9, which recites that the first and second index sequences are selected from A, GA, CGA, TCGA, ATCGA, GATCGA, and CGATCGA, none of which are 0 nucleotides long, as well as the scope of claim 8, which recites that the first and second index sequences comprise between one and seven nucleotides. Therefore, claims 12 and 13 fail to include all the limitations of the claims upon which they depend. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim 13 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 13 depends upon claims 12, 9, 8, and 1. However, the ROI-specific portion of the adaptor-barcode primer comprising a sequence selected from SEQ ID NOs: 34 and 119-125 (using SEQ ID NO: 119 as an example) as recited in claim 12 aligns with the KRAS gene in the opposite orientation to the ROI-specific portion the exon-specific reverse primer comprising a sequence selected from SEQ ID NOs: 36 and 182-188 as recited in claim 13 (using SEQ ID NO: 182 as an example; see Alignments 6-7 below this paragraph). As claim 1 recites that the first ROI-specific sequence of the adaptor-barcode primer is complementary to the 3’ end of the digested ROI and the second ROI-specific sequence of the exon-specific reverse primer is complementary to the 5’ end of the digested ROI, the ROI-specific sequences are required to be complementary to the same strand of the ROI and should align in the same direction. Therefore, the combination of SEQ ID NOs recited in claim 13 (combined with those of claim 12 on which it depends) is outside of the scope of claim 1, and claim 13 thus fails to include all the limitations of the claims upon which it depends. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
PNG
media_image1.png
203
695
media_image1.png
Greyscale
Alignment 6: NCBI BLAST alignment of the ROI-specific sequence of SEQ ID NO: 119 (the 19 nucleotides on the 3’ end).
PNG
media_image3.png
197
681
media_image3.png
Greyscale
Alignment 7: NCBI BLAST alignment of the ROI-specific sequence of SEQ ID NO: 182 (the 18 nucleotides on the 3’ end).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-2, 6-9, and 14-16 are rejected under 35 U.S.C. 103 as being unpatentable over Jee et al. (U.S. Patent Cite No 6 in the IDS filed 30 December 2024 with 59 references)(U.S. Patent 10,513,732, issued 24 December 2019, effectively filed 13 July 2015), herein Jee, in view of Li et al. (Non-Patent Literature Document Cite No 34 in the IDS filed 30 December 2024 with 59 references)(“Capturing the primordial Kras mutation initiating urethane carcinogenesis” Nat Commun 11(1), 1800 (2020)), herein Li Main, and as evidenced by Kedrowicz and Royal (“A Comparison of Public Perceptions of Physicians and Veterinarians in the United States” Vet Sci 7(2), 50 (2020)), herein Kedrowicz, and as evidenced by Supplementary Data 1 of Li et al. (“Capturing the primordial Kras mutation initiating urethane carcinogenesis” Nat Commun 11(1), 1800 (2020)), herein Li Supplementary Data 1.
Regarding claim 1, Jee teaches a method (Maximum-Depth Sequencing, or MDS) of detecting a mutation in a KRAS gene in a sample from a subject (“the present disclosure relates to methods for sequencing and quantifying mutations in the genome of an organism”, page 9 col 1 lines 44-46; “a method (hereinafter refers to as “Maximum-Depth Sequencing” or “MDS”) for detecting extremely rare variants in any region of interest (ROI) in a population of cells” page 11 col 5 lines 29-31; “Classical cancer genes such as TP53, KRAS, and EGFR are obvious targets for MDS” page 13 col 9 lines 55-56), the method comprising: a) digesting genomic DNA in the sample with at least one enzyme that cleaves at the 3’ end of a region of interest (ROI) (“digesting genomic DNA of the organism with an enzyme that cleaves at the 3′ end of the ROI to produce digested genomic DNA” page 9 col 2 lines 43-45); adding a forward adaptor and a barcode to the 3’ end of the ROI by mixing the digested genomic DNA with an adaptor-barcode primer and performing a single round of extension, wherein the adaptor-barcode primer comprises from 5’ to 3’: a forward adaptor sequence, a barcode sequence, and a first ROI-specific sequence that is complementary to the 3’ end of the digested ROI, wherein adding the forward adaptor and the barcode to the ROI produces a barcoded DNA (“forming a first polymerase chain reaction (PCR) mixture comprising the digested genomic DNA and a barcoded primer annealing at the 3′ end of the ROI, and performing a single round of linear amplification to produce a single round linear amplification product, wherein the barcoded primer comprises an adapter region, a barcode region and an annealing region” page 9 col 2 lines 45-51); c) performing linear amplification of the barcoded DNA produced in (b) using a forward adaptor primer that anneals to the forward adaptor sequence (“performing N cycles of linear amplification with the single round PCR product and a forward adapter amplifier primer to produce a linear amplification product, wherein the forward adapter amplifier primer shares a region of homology with the adapter region of the barcoded primer” page 9 col 2 lines 53-58); d) performing exponential amplification of the linearly amplified barcoded DNA produced in (c) using: an adaptor reverse primer comprising from 5’ to 3’: a reverse adaptor sequence, and a second ROI-specific sequence that is complementary to the reverse complement of the 5’ end of the digested ROI; the forward adaptor primer; and a reverse adaptor primer that anneals to the reverse complement of the reverse adaptor sequence (note the modified interpretation of these limitations for examination, as discussed in the conclusion section of the 35 U.S.C. 112(a) rejection above; “adding an adapter reverse primer and a reverse adapter amplifier primer to the linear amplification product and performing exponential PCR to produce an amplified product” page 9 col 2 lines 58-61, as these are added to the linear amplification product the forward adapter amplifier primer equivalent to the claimed forward adaptor primer is present, the adapter reverse primer plays the same role as the claimed exon-specific reverse primer and the reverse adapter amplifier primer is equivalent to the claimed reverse adaptor primer; see Adapter-reverse-primer and Reverse adapter amplifier in Example 2 on page 15 col 14 lines 10-17, the reverse adapter amplifier is complementary to the reverse complement of the adapter-reverse-primer; see Alignment 8 and Alignment 9 below this paragraph demonstrating that the primer/ROI-specific sequence of the Adapter-reverse-primer is complementary to the reverse complement of the 5’ end of the digested ROI because it anneals to the opposite strand of the genomic DNA as the Adapter-reverse-primer in Example 2 on page 15 col 14 lines 1-14); and e) sequencing the exponentially amplified barcoded DNA produced in (d); wherein a different nucleotide in the sequenced DNA produced in (e) compared to a wild type sequence indicates that a mutation is detected (“sequencing the amplified product; and (h) aligning the sequences obtained in step (g) to quantify mutations in the ROI” page 9 col 2 lines 61-63).
PNG
media_image4.png
202
627
media_image4.png
Greyscale
Alignment 8: NCBI BLAST alignment of the primer segment (equivalent to claimed first ROI-specific sequence) of the adapter-barcode-primer on Jee page 15 col 14 lines 1-5.
PNG
media_image5.png
197
642
media_image5.png
Greyscale
Alignment 9: NCBI BLAST alignment of the primer segment (equivalent to claimed second ROI-specific sequence) of the adapter-reverse-primer on Jee page 15 col 14 lines 10-14.
Regarding claim 1, though Jee does not explicitly teach applying the method of detecting a mutation in a KRAS gene to a sample from specifically a human subject, Jee indirectly teaches applying the method to a sample from a human subject by teaching using the method to provide physicians information about a tumor (“When MDS detects a high level of mutational heterogeneity in any of the cancer genes it is applied to, it can inform physicians as to the stage of the tumor” Jee page 13 column 9 lines 63-65). Kedrowicz provides evidence that physicians specifically treat healthcare needs in humans, so one of ordinary skill in the art would understand from Jee’s teaching of MDS providing information about a tumor to a physician that the tumor is a sample from a human subject (“Physicians, also known as “medical doctors” tend to the healthcare needs of humans” Kedrowicz page 3 paragraph 3).
However, Jee does not teach that the adapter reverse primer is exon-specific. This deficiency is made up for in the teachings of Li Main.
Regarding claim 1, Li Main teaches an adaptation of the Maximum-depth sequencing (MDS) assay to the mammalian Kras gene that has the advantage of maintaining the recovery of analyzable barcode families in a genome magnitudes larger than the bacterial genome that MDS was originally developed on (“The challenge of adapting MDS to the mammalian genome is maintaining the recovery of a sufficient number of analyzable barcode families (with at least two or three members) in a genome that is three orders of magnitude larger in size and weight. To this end, we optimized assay conditions (see Methods) for mammalian Kras” page 2 left column paragraph 4; “The MDS assay was adapted for mammalian Ras genes as follows” page 9 section titled ‘Maximum-depth sequencing (MDS)’) using an exon-specific reverse primer in the exponential amplification step (“2.5 µL of 10 µM exon-specific reverse primer (see below) and 2.5 µL of 10 µM reverse-adaptor primer (see below) were then added to each 50 µl reaction. The mixtures were then subjected to 20 cycles of exponential amplification” page 9 section titled ‘Maximum-depth sequencing (MDS)’).
Regarding claim 2, the combination of Jee and Li Main teach the method of claim 1 (see 35 U.S.C. 103 rejection of claim 1 above), and Li Main teaches a MDS method wherein the ROI is on the transcribed strand of KRAS exon 1, the non-transcribed strand of KRAS exon 1, or the non-transcribed strand of KRAS exon 2 (“StuI (NEB) for analysis of the non-transcribed strand of Kras exon 1, EcoRV (NEB) and EcoRI (NEB) for analysis of the non-transcribed strand of Kras exon 1, XmnI (NEB) for analysis of the non-transcribed strand of Kras exon 2” page 9 section titled ‘Maximum-depth sequencing (MDS)’).
Regarding claim 6, the combination of Jee and Li Main teach the method of claim 1 (see 35 U.S.C. 103 rejection of claim 1 above), and Li Main teaches a MDS method wherein the adaptor-barcode primer comprises the forward adaptor sequence of SEQ ID NO: 1; and wherein the forward adaptor primer comprises SEQ ID NO: 2 (“[Forward adaptor]” of the “Barcode primer: [Forward adaptor][Index][Barcode][Primer]” is identical to SEQ ID NO: 1, “Forward-adaptor primer” is identical to SEQ ID NO: 2, page 9 section titled ‘Primers for maximum-depth sequencing’).
Regarding claim 7, the combination of Jee and Li Main teach the method of claim 1 (see 35 U.S.C. 103 rejection of claim 1 above), and Li Main teaches a MDS method wherein the exon-specific reverse primer comprises the reverse adaptor sequence of SEQ ID NO: 3; and wherein the reverse adaptor primer comprises SEQ ID NO: 4 (the second version of the “[Reverse adaptor]” described as “(for all the other experiments)” of the “Exon-specific reverse primer: [Reverse adaptor][Index][Primer]” is identical to SEQ ID NO: 3, “Reverse-adaptor primer” is identical to SEQ ID NO: 4, pages 9-10 section titled ‘Primers for maximum-depth sequencing’).
Regarding claim 8, the combination of Jee and Li Main teach the method of claim 1 (see 35 U.S.C. 103 rejection of claim 1 above), and Li Main teaches a MDS method wherein the adaptor-barcode primer further comprises a first index sequence between the forward adaptor sequence and the barcode sequence (“Barcode primer: [Forward adaptor][Index][Barcode] [Primer]” page 9 section titled ‘Primers for maximum-depth sequencing’); wherein the exon-specific reverse primer further comprises a second index sequence between the reverse adaptor sequence and the second ROI-specific sequence (“Exon-specific reverse primer: [Reverse adaptor][Index][Primer]” page 9 section titled ‘Primers for maximum-depth sequencing’); and wherein the first index sequence and the second index sequence comprise between one and seven nucleotides (“[Index] = variable length of known sequences from 0 to 7 nucleotides” pages 9-10 section titled ‘Primers for maximum-depth sequencing’; in Li Supplementary Data 1 the column labeled Index provides evidence that Li Main contains exemplary embodiments of the index sequences of forward and reverse primers comprising 1, 2, 3, or 4 nucleotides).
Regarding claim 9, the combination of Jee and Li Main teach the method of claim 8 (see 35 U.S.C. 103 rejection of claim 8 above), and Li Main teaches a MDS method wherein the first index sequence and the second index sequence are selected from A, GA, CGA, and TCA (in Li Supplementary Data 1 the column labeled Index provides evidence that Li Main contains exemplary embodiments of the index sequences of forward and reverse primers are selected from A, GA, CGA, and TCGA).
Regarding claim 14, the combination of Jee and Li Main teach the method of claim 1 (see 35 U.S.C. 103 rejection of claim 1 above), and Li Main teaches a MDS method wherein performing exponential amplification in step (d) comprises performing at least 20 PCR cycles (“The mixtures were then subjected to 20 cycles of exponential amplification” page 9 section titled ‘Maximum-depth sequencing (MDS)’).
Regarding claim 15, the combination of Jee and Li Main teach the method of claim 1 (see 35 U.S.C. 103 rejection of claim 1 above), and Jee teaches a MDS method wherein the sample is a biopsy (“When MDS is applied to DNA from cells harvested from a tumor biopsy” page 13 column 9 lines 21-22).
Regarding claim 16, the combination of Jee and Li Main teach the method of claim 1 (see 35 U.S.C. 103 rejection of claim 1 above), and Jee teaches a MDS method wherein the subject has or is suspected of having cancer (“a deep-sequencing method such as MDS could predict cancer treatment outcomes before chemotherapy is applied […] Cancers that may be screened for by MDS include carcinoma, melanoma, lymphoma, blastoma, leukemia, myeloma, sarcoma or germ cell tumors […] When MDS detects a high level of mutational heterogeneity in any of the cancer genes it is applied to, it can inform physicians as to the stage of the tumor. This enables the physician to check for malignancies or prescribe more aggressive forms of treatment if the disease has progressed” page 13 column 9 lines 33-67).
It would have been obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention to perform the simple substitution of the exon-specific reverse primer in the method taught by Li for the adapter reverse primer in the method taught by Jee (MPEP §2143 I. B.). Additionally, one of ordinary skill in the art would be motivated to combine the teachings of Jee and Li in order to improve the method of Jee with the advantage taught by Li of being able to apply the method to mammals while maintaining the recovery of analyzable barcodes (MPEP §2143 I. G.). One of ordinary skill in the art could have performed this substitution and would have found the results of this substitution predictable because both the exon-specific reverse primer of Jee and adapter reverse primer of Li play the same role of adding an adaptor to the opposite end of the ROI from the barcode in versions of the same type of method, MDS. Therefore, the invention as a whole of claims 1-2, 6-9, and 14-16 would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention.
Claims 3 and 12-13 are rejected under 35 U.S.C. 103 as being unpatentable over Jee et al. (U.S. Patent Cite No 6 in the IDS filed 30 December 2024 with 59 references)(U.S. Patent 10,513,732, issued 24 December 2019, effectively filed 13 July 2015), herein Jee, in view of Li et al. (Non-Patent Literature Document Cite No 34 in the IDS filed 30 December 2024 with 59 references)(“Capturing the primordial Kras mutation initiating urethane carcinogenesis” Nat Commun 11(1), 1800 (2020)), herein Li Main, and as evidenced by Kedrowicz and Royal (“A Comparison of Public Perceptions of Physicians and Veterinarians in the United States” Vet Sci 7(2), 50 (2020)), herein Kedrowicz, and as evidenced by Supplementary Data 1 of Li et al. (“Capturing the primordial Kras mutation initiating urethane carcinogenesis” Nat Commun 11(1), 1800 (2020)), herein Li Supplementary Data 1, as applied to claims 1-2, 6-9, and 14-16 above, and further in view of Das et al. (US 2016/0265064, published 15 September 2016, effectively filed 11 March 2015), herein Das.
Regarding claim 3, the combination of Jee and Li Main teach the method of claim 2 (see 35 U.S.C. 103 rejection of claim 2 above), and Li Main teaches a MDS method wherein the ROI is on the transcribed strand of KRAS exon 1 and the enzyme is StuI (“genomic DNA was incubated with StuI (NEB) for analysis of the transcribed strand of Kras exon 1” page 9 section titled ‘Maximum-depth sequencing (MDS)’). However, though Li Main teaches an adaptor-barcode primer comprising a first ROI-specific sequence similar to SEQ ID NO: 6 and an exon-specific reverse primer comprising a second ROI-specific sequence similar to SEQ ID NO: 7, both of these sequences differ from the claimed SEQ ID NOs (bolded bases do not match the claimed SEQ ID NO; similar to SEQ ID NO: 6 is “Kras exon 1 StuI [Primer] = 5’-CCTGCTGAAAATGACTGAG-3’” and similar to SEQ ID NO: 7 is “Kras exon 1 StuI [Primer] = 5’-CTCTATCGTAGGGTCATACTCAT-3’” pages 9-10 section titled ‘Maximum-depth sequencing (MDS)’), so neither Jee nor Li Main teach a first ROI-specific sequence of SEQ ID NO: 6 and a second ROI-specific sequence of SEQ ID NO: 7 or SEQ ID NO: 8. This deficiency is made up for in the teachings of Das.
Regarding claim 3, Das teaches the amplification of the KRAS gene in a sample from a human subject using primer sequences comprising SEQ ID NO: 6 and SEQ ID NO: 8 (“exosomal RNA from patient serums was extracted” [0053]; “PCR primers for KRAS (80 bp PCR product): Forward primer: FPKRAS (5′-GCC-TGC-TGA-AAA-TGA-CTG-AAT-ATA-3′), Reverse primer: RPKRAS (5′-TTA-GCT-GTA-TCG-TCA-AGG-CAC-TC-3′)” [0057]). By substituting the Forward primer of Das for the [Primer] sequence of the barcode primer of Li Main and substituting the Reverse primer of Das for the [Primer] sequence of the exon-specific reverse primer of Li Main, the combination of Das with the combination of Jee and Li Main teaches the method wherein the adaptor-barcode primer comprises the first ROI-specific sequence of SEQ ID NO: 6 and the exon-specific reverse primer comprises the second ROI-specific sequence of SEQ ID NO: 8.
Regarding claim 12, the combination of Jee and Li Main teach the method of claim 9 (see 35 U.S.C. 103 rejection of claim 9 above), and Li Main, as evidenced by Li Supplementary Data 1, teaches a MDS method wherein an adaptor-barcode primer has the sequence 5’ TACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTANNNNNNNNNNNNNNCCTGCTGAAAATGACTGAG 3’, which differs from claimed SEQ ID NO: 119 only in the bolded bases (Li Supplementary Data 1, Kras exon 1 StuI F1). This is the exact same difference discussed with regard to SEQ ID NO: 6 in the 35 U.S.C. 103 rejection of claim 3 above, so the same reasoning and teachings of Das apply and the combination of Das with Jee and Li Main teaches an adaptor-barcode primer comprising the sequence of SEQ ID NO: 119.
Regarding claim 13, the combination of Jee and Li Main teach the method of claim 12 (see 35 U.S.C. 103 rejection of claim 12 above), and Li Main, as evidenced by Li Supplementary Data 1, teaches a MDS method wherein an exon-specific reverse primer has the sequence 5’ CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCACTCTATCGTAGGGTCATACTCAT 3’, which differs from claimed SEQ ID NO: 182 in that the bolded bases making up the ROI-specific sequence differ from the ROI-specific sequence portion of SEQ ID NO: 182 that are 5’ tagctgtatcgtcaaggc 3’ (Li Supplementary Data 1, Kras exon 1 StuI R1). This is essentially the same substitution of the human KRAS Reverse primer of Das for the ROI-specific sequence of an exon-specific reverse primer of Li Main, as discussed in the 35 U.S.C. 103 rejection of claim 3 above, so the same reasoning and teachings of Das apply and the combination of Das with Jee and Li Main teaches an exon-specific reverse primer comprising the sequence of SEQ ID NO: 182.
Because Jee teaches the desirable utility of the MDS method in providing information for physicians to make prognoses and clinical determinations for their human subjects (see 35 U.S.C. 103 rejection of claim 1), but the specific adaptor-barcode primer and exon-specific reverse primers taught by Li Main are for the mouse Kras gene rather than the human KRAS gene, one of ordinary skill in the art would be motivated to combine the method taught by the combination of Jee and Li Main with primers that amplify ROI in the human KRAS gene, such as those taught by Das. One of ordinary skill in the art would have a reasonable expectation of success in this combination because the Forward primer taught by Das binds to the portion of the human KRAS gene homologous to the portion of the mouse Kras gene that the [Primer] sequence of the barcode primer taught by Li Main binds, so it would be expected to serve the same function of being able to template extension of the digested genomic DNA based to include the barcode and adaptor of the primer (note that it contains the StuI cleavage site, so the 3’ end of the digested genomic DNA would be able to bind the primer). Therefore, the invention as a whole of claims 3 and 12-13 would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention.
Conclusion
Claims 1-3, 6-9, and 12-16 are rejected. Claims 4-5, 10-11, and 17-19 are withdrawn.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jeffrey Lawrence Bellah whose telephone number is (571)272-1024. The examiner can normally be reached M-Th, 7:30-5 ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Anne Gussow can be reached at (571)272-6047. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JEFFREY BELLAH/Examiner, Art Unit 1683
/ANNE M. GUSSOW/Supervisory Patent Examiner, Art Unit 1683
Prosecution Insights