Prosecution Insights
Last updated: October 04, 2026
Application No. 18/500,627

FORMULATION OF AN ANTISENSE OLIGOMER CONJUGATE

Non-Final OA §103§112§DP
Filed
Nov 02, 2023
Priority
Nov 02, 2022 — provisional 63/382,043
Examiner
VANHORN, ABIGAIL LOUISE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Sarepta Therapeutics Inc.
OA Round
1 (Non-Final)
47%
Grant Probability
Moderate
1-2
OA Rounds
9m
Est. Remaining
69%
With Interview

Examiner Intelligence

Grants 47% of resolved cases
47%
Career Allowance Rate
570 granted / 1219 resolved
-13.2% vs TC avg
Strong +22% interview lift
Without
With
+22.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 9m
Avg Prosecution
74 currently pending
Career history
1295
Total Applications
across all art units

Statute-Specific Performance

§101
1.6%
-38.4% vs TC avg
§103
41.9%
+1.9% vs TC avg
§102
8.5%
-31.5% vs TC avg
§112
24.0%
-16.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1219 resolved cases

Office Action

§103 §112 §DP
DETAILED ACTION The examiner for your application at the USPTO has changed. Examiner Abigail VanHorn can be reached at 571-270-3502. Election/Restrictions While Applicants’ response filed June 23 2026 is non-responsive as the response fails to actually include an election of species as required (see MPEP 818 which states that in reply to the restriction requirement applicant must elect) but merely randomly withdraws claims, based upon search and discovered prior art, the species election is withdrawn. Applicants are encouraged to call the examiner if they are confused or unsure of a restriction, rejection or other matter to get clarity before responding. Claims 3, 5-7, 9-11, 14-16, 21, 23, 25, 27, 29, 32, 35 and 37-40 were/stand cancelled. Claims 1-2, 4, 8, 12-13, 17-20, 22, 24, 26, 28, 30-31, 33-34, 36 and 41 are pending in the application and are being examined on the merits herein. Once a restriction requirement is withdrawn, the provisions of 35 U.S.C. 121 are no longer applicable. See In re Ziegler, 443 F.2d 1211, 1215, 170 USPQ 129, 131-32 (CCPA 1971). See also MPEP § 804.01. Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority This application claims benefit of 63/382,043 (11/02/2022) as reflected in the filing receipt issued February 12 2026. Information Disclosure Statement The information disclosure statement (IDS) submitted on February 1 2024 and February 10 2026 in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency - The Incorporation by Reference paragraph required by 37 CFR 1.821(c)(1) is missing or incomplete. See item 1) a) or 1) b) above. Specifically, the size is reported in KB not bytes. Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 41 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for treating Hutchinson-Gilford progeria syndrome with an antisense oligomer conjugate wherein the antisense sequence is of SEQ ID NO: 3 or 4, does not reasonably provide enablement for treating Hutchinson-Gilford progeria syndrome with any antisense oligomer sequence. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims. This is a scope of enablement rejection. To be enabling, the specification of the patent must teach those skilled in the art how to make and use the full scope of the claimed invention without undue experimentation. In re Wright, 999 F.2d 1557, 1561 (Fed. Cir. 1993). Explaining what is meant by “undue experimentation,” the Federal Circuit has stated: The test is not merely quantitative, since a considerable amount of experimentation is permissible, if it is merely routine, or if the specification in question provides a reasonable amount of guidance with respect to the direction in which the experimentation should proceed to enable the determination of how to practice a desired embodiment of the claimed invention. PPG v. Guardian, 75 F.3d 1558, 1564 (Fed. Cir. 1996). The factors that may be considered in determining whether a disclosure would require undue experimentation are set forth by In re Wands, 8 USPQ2d 1400 (CAFC 1988) at 1404 where the court set forth the eight factors to consider when assessing if a disclosure would have required undue experimentation. Citing Ex parte Formal, 230 USPQ 546 (BdApls 1986) at 547 the court recited eight factors: 1) the quantity of experimentation necessary, 2) the amount of direction or guidance provided, 3) the presence or absence of working examples, 4) the nature of the invention, 5) the state of the prior art, 6) the relative skill of those in the art, 7) the predictability of the art, and 8) the breadth of the claims. These factors are always applied against the background understanding that scope of enablement varies inversely with the degree of unpredictability involved. In re Fisher, 57 CCPA 1099, 1108, 427 F.2d 833, 839, 166 USPQ 18, 24 (1970). Keeping that in mind, the Wands factors are relevant to the instant fact situation for the following reasons: The breadth of the claims and Nature of the Invention The claim is very broad insofar as it recites treating Hutchinson-Gilford progeria syndrome (HGPS) with any antisense conjugate which has any sequence of nucleobases. The Relative Skill Level, the State of the Prior Art and The Level of Predictability in the Art The relative skill of those in the art is high, that of an MD or PHD someone with experience in not only treating HGPS as well as design and synthesis of antisense oligomers. Applicants’ own work, see for example US Patent No. 9326992, teaches that most HGPS cases are caused by a single-point mutation in the Lamin A (LMNA) gene, resulting in the generation of progerin, a truncated splicing mutant of Lamin A. The single-point mutation is a de novo silent substitution (1824C>T, Gly608Gly) in exon 11 of the Lamin A (LMNA) gene. The substitution activates a cryptic splice donor site, which leads to the production of a dominant negative mutant Lamin A protein with an internal deletion of 50 amino acids. The mutant protein, named progerin, accumulates on the nuclear membrane, causing characteristic nuclear blebbing (column 1, lines 32-42). It is taught that treating a progeroid disease can be achieved with a targeting sequence of at least about 12 contiguous subunits complementary to exon 10, intron 10, exon 11 or combinations thereof of a human LMNA pre-MRNA (column 2, lines 1-15). Therefore, the state of the art teaches that HGPS can be treated with antisense sequences which target the LMNA gene but does not teach how HGPS can be treated by targeting a different gene or with an antisense sequence which does not target the LMNA gene. The amount of direction or guidance provided and the presence or absence of working examples The specification provides no direction or guidance for how to treat HGPS with any nucleotide sequence. Table 3 shows 2 exemplary sequences (SEQ ID NO: 3 and 4) which are for targeting the human LMNA pre-MRA. However, the specification does not teach any other sequences which can be used to treat HGPS or how one can treat HGPS with any nucleotide sequence. The quantity of experimentation necessary Because of the known unpredictability of the art, and in the absence of experimental evidence, no one skilled in the art would accept the assertion that the instantly claimed antisense oligonucleotides with any sequence can be used to treat HGPS as inferred by the claim and contemplated by the specification. Accordingly, the instant claims do not comply with the enablement requirement of §112, since to practice the invention claimed in the patent a person of ordinary skill in the art would have to engage in undue experimentation, with no assurance of success. Claim Rejections - 35 USC § 112-Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 41 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 41 recites the limitation "the pharmaceutical composition" in lines 1-2. There is insufficient antecedent basis for this limitation in the claim. Claim 41 is an independent claim and the claim fails to provide antecedent basis for the recitation “the pharmaceutical composition”. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-2, 4, 8, 12-13, 17-20, 22, 24, 26, 28, 30-31, 33-34, 36 and 41 are rejected under 35 U.S.C. 103 as being unpatentable over Erdos et al. (WO2017190041, cited on PTO Form 1449) in view of Dibble et al. (WO2013173789, cited on PTO Form 1449). Applicant Claims The instant application claims a pharmaceutical composition comprising benzyl alcohol and an antisense oligomer conjugate of formula I. The instant application claims a method for treating Hutchinson-Gilford progeria syndrome (HGPS) in a subject in need thereof comprising administering to the subject the pharmaceutical composition comprising benzyl alcohol and an antisense oligomer conjugate of formula (I). Determination of the Scope and Content of the Prior Art (MPEP §2141.01) Erdos et al. is directed to oligonucleotide analogues targeting human LMNA. Claimed is an antisense oligomer of formula I: PNG media_image1.png 461 428 media_image1.png Greyscale T is selected from: PNG media_image2.png 233 427 media_image2.png Greyscale and G is a cell penetrating peptide and linker moiety PNG media_image3.png 289 710 media_image3.png Greyscale (claim 1). A specific compound claimed is: PNG media_image4.png 770 556 media_image4.png Greyscale PNG media_image5.png 217 716 media_image5.png Greyscale (claim 9). As claimed the Ra is C(O)CH3 (claim 14). Taught are methods for treating progeroid disease which include HGPS (Hutchinson-Gilford progeria syndrome) by administering to a subject in need there of the antisense oligonucleotides (page 45). Formulations or compositions suitable for the therapeutic delivery of antisense oligomers include those formulated together with one or more pharmaceutically acceptable carriers and/or diluents (page 46). Liquid dosage forms include solubilizing agents such as benzyl alcohol (page 53). It is taught that near-neutral pH is about 6 to 8 (page 12). HCl salts of the oligomers are taught including 0.6HCl (page 42). Examples of carriers include glycols such as propylene glycol; polyols such as glycerin and mannitol; pH buffered solutions (page 47). Ascertainment of the Difference Between Scope the Prior Art and the Claims (MPEP §2141.02) While Erdos et al. teaches antisense oligomers which are of the same scope as instantly claimed and suggests excipients such as solubilizers which include benzyl alcohol, Erdos et al. does not expressly teach this combination. However, this deficiency is cured by Dibble et al. Dibble et al. is directed to antisense oligonucleotide compositions. Taught are compositions and methods that facilitate the manufacture, storage, administering and delivery of antisense oligonucleotide solutions. Specifically, the disclosure provides a number of excipients that reduce the viscosity; reduce the rabidity or both of an antisense oligonucleotide solution (page 1). As claimed, one excipient which modulates the viscosity, rabidity or both is benzyl alcohol (claim 81); D-mannitol (claim 88). Table 5 shows 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection. Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Certain properties of effective excipients, e.g. (i) aromatic homocyclicity or heterocyclicity and (ii) the ability to act as a hydrogen bond donor and/or acceptor, may be consolidated into one excipient or compound. In certain embodiments, two or more excipients may together possess one or more properties of effective excipients. For example, in certain embodiments, a first excipient may be an aromatic homocyclic or heterocyclic compound but may not have the ability to act as a hydrogen bond donor and/or acceptor. In certain such embodiments, a second excipient may have the ability to act as a hydrogen bond donor and/or acceptor but may not be an aromatic homocyclic or heterocyclic compound. In certain such embodiments, the first excipient may act as an aromatic homocyclic or heterocyclic compound and a second excipient may act as a hydrogen bond donor and/or acceptor and the combination of the first and second excipient may produce an effective excipient for mitigating turbidity, viscosity, or both. In certain embodiments, a mixture of two or more excipients, the sum of which contain (i) aromatic homocyclicity or heterocyclicity and (ii) the ability to act as a hydrogen bond donor and/or acceptor, are effective in mitigating both turbidity and viscosity (page 65). Taught is the investigation of combining excipient which are ineffective by themselves at mitigating both rabidity and viscosity was investigate. For example, the combination of mannitol and pyridine were able to mitigate both turbidity and viscosity whereas alone neither one could (page 80; see also example 8). Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). Excipients specifically claimed are benzyl alcohol, D-mannitol, propylene glycol, histidine, etc. (claim 79). Finding of Prima Facie Obviousness Rationale and Motivation (MPEP §2142-2143) Regarding claim 1 and 41, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Erdos et al. and Dibble et al. and choose benzyl alcohol as an excipient which can be used with antisense oligonucleotides to mitigate turbidity and viscosity. One skilled in the art would have been motivated to select benzyl alcohol with a reasonable expectation of success as it is a specifically taught solubilizer in Erdos et al. and Dibble et al. teaches that it can mitigate turbidity and viscosity. Regarding claim 41, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Erdos et al. and Dibble et al. and administer a composition comprising the antisense oligonucleotides to a subject to treat HGPS (Hutchinson-Gilford progeria syndrome). One skilled in the art would have been motivated to administer the antisense oligonucleotide in this manner as it is a specific use taught by Erdos et al. Regarding the claimed antisense oligomer (claims 1, 2, 4, 8, 12-13, 17-19, 22, 36 and 41), Erdos et al. expressly teaches formula III (claim 9) which corresponds to A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23; E’ is L-J-G wherein L is glycine, J is cell-penetrating peptide of (R)6 (which corresponds to instantly claimed SEQ ID NO: 11) and G is C(O)CH3 (C1 alkyl). PNG media_image4.png 770 556 media_image4.png Greyscale Regarding R2, the same claim 9 states: the nucleobases are a) SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) wherein Z is 23; and b) SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) wherein Z is 23. These sequences have 100% identity to instantly claimed SEQ ID NO: 3 and 4. Regarding claim 20, HCl salts of the oligomers are taught including 0.6HCl (page 42). Regarding claims 24, 30 and 33, Dibble et al. teaches two or more excipients may together possess one or more properties of effective excipients. Dibble et al. teaches excipients which can be utilized include mannitol, propylene glycol and histidine. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Erdos et al. and Dibble et al. and manipulate the type and quantity of the excipients utilized in order to achieve the desired properties. One skilled in the art would have a reasonable expectation of success as Erdos et al. teaches the inclusion of excipients and Dibble et al. expressly teaches experimentation with excipients by combining two or more in order to achieve desired properties. Specific excipients taught include histidine, mannitol, propylene glycol, glycerin, etc. Regarding claim 26, Erdos et al. teaches that neutral pH is 6 to 8. Dibble et al. teaches excipients increase the pH of the solution (claim 157), decrease the pH of the solution (claim 158) and buffers the pH of the solution (claim 159). In some embodiments the excipient buffers the pH of the antisense oligonucleotide solution around a pH or 7.0 (e.g. 6.8-72) (page 60-61). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Erdos et al. and Dibble et al. and manipulate the excipients and select combination that not only modulate viscosity and turbidity but also buffer the pH to around 7.0 as taught by Dibble et al. Regarding claim 28, 31 and 34, Dibble et al. teaches concentrations of benzyl alcohol 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection (table 5). Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Erdos et al. and Dibble et al. and manipulate not only the type but the concentration of the excipients in order to achieve the desired level of solubility (e.g. turbidity) and viscosity but also the pH. Since buffering to around 7.0 is suggested by Dibble et al. and near neutral pH includes pH of 6 one skilled in the art would manipulate the excipient(s) necessary in order to achieve the desired pH. Depending on the concentration of the antisense oligonucleotide and the desired level of turbidity and/or viscosity, one skilled in the art would recognize that the concentration of excipients would need to be manipulated. It is generally noted that differences in concentration do not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-2, 4, 8, 12-13, 17-20, 22, 24, 26, 28, 30-31, 33-34, 36 and 41 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-51 of U.S. Patent No. 9833468 in view of Dibble et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. The instant application claims a pharmaceutical composition comprising benzyl alcohol and an antisense oligomer conjugate of formula I. The instant application claims a method for treating Hutchinson-Gilford progeria syndrome (HGPS) in a subject in need thereof comprising administering to the subject the pharmaceutical composition comprising benzyl alcohol and an antisense oligomer conjugate of formula (I). Patent ‘468 claims a method for treating Hutchinson-Gilford progeria syndrome in a subject in need thereof comprising administering to the subject an antisense oligonucleotide. A specific antisense oligonucleotide claimed is: PNG media_image7.png 599 347 media_image7.png Greyscale . The Pj sequence as claimed is SEQ ID NO: 4 which is has 100% identity to instantly claimed SEQ ID NO: 3 and SEQ ID NO: 11 which has 100% identity to instantly claimed SEQ ID NO: 4. SEQ ID NO: 39-54 overlap in scope with instantly claimed SEQ ID NO: 5-21 (for example SEQ ID NO: 5 (instant) has 100% identity with SEQ ID NO: 39 (Patent ‘468). While Patent ‘468 claims an antisense oligonucleotide with the same structure as instantly claimed, Patent ‘468 does not expressly claim a pharmaceutical composition, benzyl alcohol or the other claimed excipients/pH. However, this deficiency is cured by Dibble et al. Dibble et al. is directed to antisense oligonucleotide compositions. Taught are compositions and methods that facilitate the manufacture, storage, administering and delivery of antisense oligonucleotide solutions. Specifically, the disclosure provides a number of excipients that reduce the viscosity; reduce the rabidity or both of an antisense oligonucleotide solution (page 1). As claimed, one excipient which modulates the viscosity, rabidity or both is benzyl alcohol (claim 81); D-mannitol (claim 88). Table 5 shows 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection. Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Certain properties of effective excipients, e.g. (i) aromatic homocyclicity or heterocyclicity and (ii) the ability to act as a hydrogen bond donor and/or acceptor, may be consolidated into one excipient or compound. In certain embodiments, two or more excipients may together possess one or more properties of effective excipients. For example, in certain embodiments, a first excipient may be an aromatic homocyclic or heterocyclic compound but may not have the ability to act as a hydrogen bond donor and/or acceptor. In certain such embodiments, a second excipient may have the ability to act as a hydrogen bond donor and/or acceptor but may not be an aromatic homocyclic or heterocyclic compound. In certain such embodiments, the first excipient may act as an aromatic homocyclic or heterocyclic compound and a second excipient may act as a hydrogen bond donor and/or acceptor and the combination of the first and second excipient may produce an effective excipient for mitigating turbidity, viscosity, or both. In certain embodiments, a mixture of two or more excipients, the sum of which contain (i) aromatic homocyclicity or heterocyclicity and (ii) the ability to act as a hydrogen bond donor and/or acceptor, are effective in mitigating both turbidity and viscosity (page 65). Taught is the investigation of combining excipient which are ineffective by themselves at mitigating both rabidity and viscosity was investigate. For example, the combination of mannitol and pyridine were able to mitigate both turbidity and viscosity whereas alone neither one could (page 80; see also example 8). Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). Excipients specifically claimed are benzyl alcohol, D-mannitol, propylene glycol, histidine, etc. (claim 79). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘468 and Dibble et al. and utilize benzyl alcohol as an excipient which can be used with antisense oligonucleotides to mitigate turbidity and viscosity. One skilled in the art would have been motivated to select benzyl alcohol with a reasonable expectation of success as Dibble et al. teaches that it can mitigate turbidity and viscosity in antisense oligonucleotide formulations. Therefore, when formulating a liquid dosage form which can be used to deliver the antisense oligonucleotide and when turbidity and viscosity are of a concern, one skilled in the art would have been motivated to combine benzyl alcohol with the antisense oligonucleotide. Regarding the claimed antisense oligomer (claims 1, 2, 4, 8, 12-13, 17-19, 22, 36 and 41), Patent ‘468 expressly claims a compound which corresponds to A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23. Regarding R2, Patent ‘468 claims the nucleobases are SEQ ID NO: 4 (CTGAGCCGCTGGCAGATGCCTTGTC) wherein X is 23; and SEQ ID NO: 11 (GAGGAGATGGGTCCACCCACCTGGG) wherein X is 23. These sequences have 100% identity to instantly claimed SEQ ID NO: 3 and 4 Regarding claim 20, pharmaceutically acceptable salts are claimed. Regarding claims 24, 30 and 33, Dibble et al. teaches two or more excipients may together possess one or more properties of effective excipients. Dibble et al. teaches excipients which can be utilized include mannitol, propylene glycol and histidine. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘468 and Dibble et al. and manipulate the type and quantity of the excipients utilized in order to achieve the desired properties. One skilled in the art would have a reasonable expectation of success as Dibble et al. expressly teaches experimentation with excipients by combining two or more in order to achieve desired properties. Specific excipients taught include histidine, mannitol, propylene glycol, glycerin, etc. Regarding claim 26, Dibble et al. teaches excipients increase the pH of the solution (claim 157), decrease the pH of the solution (claim 158) and buffers the pH of the solution (claim 159). In some embodiments the excipient buffers the pH of the antisense oligonucleotide solution around a pH or 7.0 (e.g. 6.8-72) (page 60-61). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘468 and Dibble et al. and manipulate the excipients and select combination that not only modulate viscosity and turbidity but also buffer the pH to around 7.0 as taught by Dibble et al. Regarding claim 28, 31 and 34, Dibble et al. teaches concentrations of benzyl alcohol 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection (table 5). Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘468 and Dibble et al. and manipulate not only the type but the concentration of the excipients in order to achieve the desired level of solubility (e.g. turbidity) and viscosity but also the pH. Since buffering to around 7.0 is suggested by Dibble et al. and near neutral pH includes pH of 6 one skilled in the art would manipulate the excipient(s) necessary in order to achieve the desired pH. Depending on the concentration of the antisense oligonucleotide and the desired level of turbidity and/or viscosity, one skilled in the art would recognize that the concentration of excipients would need to be manipulated. It is generally noted that differences in concentration do not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05. Claims 1-2, 4, 8, 12-13, 17-20, 22, 24, 26, 28, 30-31, 33-34, 36 and 41 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-19 of U.S. Patent No. 10398721 in view of Dibble et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. The instant claims are set forth above. Patent ‘721 claims a method for treating atherosclerosis in n a subject in need thereof comprising administering to the subject an antisense oligonucleotide (the specification teaches that this is a patient with HGPS (column 1, lines 23-25). As claimed, the oligonucleotide being composed of morpholino subunits and phosphorus-containing intersubunit linkages joining a morpholino nitrogen of one subunit to a 5′-exocyclic carbon of an adjacent subunit, containing about 12-40 bases; and having a targeting sequence comprising any one of SEQ ID NOs: 3-8, 10-18, and 20-34, wherein the antisense oligonucleotide is covalently attached to a cell-penetrating peptide and linker moiety of the formula -G-CPP, wherein G is the linker moiety and is selected from glycine, cysteine, proline, 6-aminohexanoic acid (Ahx), β-alanine (B), and Ahx-B, and CPP is the cell-penetrating peptide and is selected from SEQ ID NOS: 39-54. Structures claimed include: PNG media_image8.png 205 242 media_image8.png Greyscale and PNG media_image9.png 141 266 media_image9.png Greyscale . The Pj sequence as claimed is SEQ ID NO: 4 which is has 100% identity to instantly claimed SEQ ID NO: 3 and SEQ ID NO: 11 which has 100% identity to instantly claimed SEQ ID NO: 4. SEQ ID NO: 39-54 overlap in scope with instantly claimed SEQ ID NO: 5-21 (for example SEQ ID NO: 5 (instant) has 100% identity with SEQ ID NO: 39 (Patent ‘468). While Patent ‘721 claims an antisense oligonucleotide with the same structure as instantly claimed, Patent ‘721 does not expressly claim a pharmaceutical composition, benzyl alcohol or the other claimed excipients/pH. However, this deficiency is cured by Dibble et al. The teachings of Dibble et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘721 and Dibble et al. and utilize benzyl alcohol as an excipient which can be used with antisense oligonucleotides to mitigate turbidity and viscosity. One skilled in the art would have been motivated to select benzyl alcohol with a reasonable expectation of success as Dibble et al. teaches that it can mitigate turbidity and viscosity in antisense oligonucleotide formulations. Therefore, when formulating a liquid dosage form which can be used to deliver the antisense oligonucleotide and when turbidity and viscosity are of a concern, one skilled in the art would have been motivated to combine benzyl alcohol with the antisense oligonucleotide. Regarding the claimed antisense oligomer (claims 1, 2, 4, 8, 12-13, 17-19, 22, 36 and 41), Patent ‘721 expressly claims a compound which corresponds to A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23. Regarding R2, Patent ‘721 claims the nucleobases are SEQ ID NO: 4 (CTGAGCCGCTGGCAGATGCCTTGTC) wherein X is 23; and SEQ ID NO: 11 (GAGGAGATGGGTCCACCCACCTGGG) wherein X is 23. These sequences have 100% identity to instantly claimed SEQ ID NO: 3 and 4 Regarding claim 20, pharmaceutically acceptable salts are claimed. Regarding claims 24, 30 and 33, Dibble et al. teaches two or more excipients may together possess one or more properties of effective excipients. Dibble et al. teaches excipients which can be utilized include mannitol, propylene glycol and histidine. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘721 and Dibble et al. and manipulate the type and quantity of the excipients utilized in order to achieve the desired properties. One skilled in the art would have a reasonable expectation of success as Dibble et al. expressly teaches experimentation with excipients by combining two or more in order to achieve desired properties. Specific excipients taught include histidine, mannitol, propylene glycol, glycerin, etc. Regarding claim 26, Dibble et al. teaches excipients increase the pH of the solution (claim 157), decrease the pH of the solution (claim 158) and buffers the pH of the solution (claim 159). In some embodiments the excipient buffers the pH of the antisense oligonucleotide solution around a pH or 7.0 (e.g. 6.8-72) (page 60-61). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘721 and Dibble et al. and manipulate the excipients and select combination that not only modulate viscosity and turbidity but also buffer the pH to around 7.0 as taught by Dibble et al. Regarding claim 28, 31 and 34, Dibble et al. teaches concentrations of benzyl alcohol 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection (table 5). Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘721 and Dibble et al. and manipulate not only the type but the concentration of the excipients in order to achieve the desired level of solubility (e.g. turbidity) and viscosity but also the pH. Since buffering to around 7.0 is suggested by Dibble et al. and near neutral pH includes pH of 6 one skilled in the art would manipulate the excipient(s) necessary in order to achieve the desired pH. Depending on the concentration of the antisense oligonucleotide and the desired level of turbidity and/or viscosity, one skilled in the art would recognize that the concentration of excipients would need to be manipulated. It is generally noted that differences in concentration do not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05. Claims 1-2, 4, 8, 12-13, 17-20, 22, 24, 26, 28, 30-31, 33-34, 36 and 41 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-4 of U.S. Patent No. 10822608 in view of Dibble et al. Erdos et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. The instant claims are set forth above. Patent ‘608 claims an antisense oligomer which has the same sequence as instantly claimed SEQ ID NO: 4 and the structure corresponding to the instantly claimed compound wherein A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23; E’ is L-J-G wherein L is glycine, J is cell-penetrating peptide of (R)6 (which corresponds to instantly claimed SEQ ID NO: 11) and G is C(O)CH3 (C1 alkyl). Pharmaceutically acceptable salts are claimed. A carrier is claimed. While Patent ‘608 claims an antisense oligonucleotide with the same structure as instantly claimed, Patent ‘608 does not expressly claim benzyl alcohol or the other claimed excipients/pH. However, this deficiency is cured by Dibble et al. While Patent ‘608 claims the same sequence as instantly claimed, Patent ‘608 does not expressly claim administering to a patient with HGPS. However, this deficiency is cured by Erdos et al. The teachings of Dibble et al. are set forth above. Erdos et al. is directed to oligonucleotide analogues targeting human LMNA. A specific compound claimed is: PNG media_image4.png 770 556 media_image4.png Greyscale PNG media_image5.png 217 716 media_image5.png Greyscale (claim 9). As claimed the Ra is C(O)CH3 (claim 14). Taught are methods for treating progeroid disease which include HGPS (Hutchinson-Gilford progeria syndrome) by administering to a subject in need there of the antisense oligonucleotides (page 45). Formulations or compositions suitable for the therapeutic delivery of antisense oligomers include those formulated together with one or more pharmaceutically acceptable carriers and/or diluents (page 46). Liquid dosage forms include solubilizing agents such as benzyl alcohol (page 53). It is taught that near-neutral pH is about 6 to 8 (page 12). HCl salts of the oligomers are taught including 0.6HCl (page 42). Examples of carriers include glycols such as propylene glycol; polyols such as glycerin and mannitol; pH buffered solutions (page 47). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘608, Erdos et al. and Dibble et al. and utilize benzyl alcohol as an excipient which can be used with antisense oligonucleotides to mitigate turbidity and viscosity. One skilled in the art would have been motivated to select benzyl alcohol with a reasonable expectation of success as Dibble et al. teaches that it can mitigate turbidity and viscosity in antisense oligonucleotide formulations. Therefore, when formulating a liquid dosage form which can be used to deliver the antisense oligonucleotide and when turbidity and viscosity are of a concern, one skilled in the art would have been motivated to combine benzyl alcohol with the antisense oligonucleotide. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘608, Erdos et al. and Dibble et al. and administer to a subject with HGPS. One skilled in the art would have been motivated to administer the oligonucleotide of Patent ‘608 in this manner as it claims the same structure as Erdos et al. (sequence and chemical structure) and Erdos et al. teaches this compound can be administered to a subject with HGPS to treat HGPS. Regarding the claimed antisense oligomer (claims 1, 2, 4, 8, 12-13, 17-19, 22, 36 and 41), Patent ‘608 expressly claims a compound which corresponds to A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23. Regarding claim 20, pharmaceutically acceptable salts are claimed. Regarding claims 24, 30 and 33, Dibble et al. teaches two or more excipients may together possess one or more properties of effective excipients. Dibble et al. teaches excipients which can be utilized include mannitol, propylene glycol and histidine. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘608, Erdos et al. and Dibble et al. and manipulate the type and quantity of the excipients utilized in order to achieve the desired properties. One skilled in the art would have a reasonable expectation of success as Dibble et al. expressly teaches experimentation with excipients by combining two or more in order to achieve desired properties. Specific excipients taught include histidine, mannitol, propylene glycol, glycerin, etc. Regarding claim 26, Dibble et al. teaches excipients increase the pH of the solution (claim 157), decrease the pH of the solution (claim 158) and buffers the pH of the solution (claim 159). In some embodiments the excipient buffers the pH of the antisense oligonucleotide solution around a pH or 7.0 (e.g. 6.8-72) (page 60-61). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘608, Erdos et al. and Dibble et al. and manipulate the excipients and select combination that not only modulate viscosity and turbidity but also buffer the pH to around 7.0 as taught by Dibble et al. Regarding claim 28, 31 and 34, Dibble et al. teaches concentrations of benzyl alcohol 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection (table 5). Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘608, Erdos et al. and Dibble et al. and manipulate not only the type but the concentration of the excipients in order to achieve the desired level of solubility (e.g. turbidity) and viscosity but also the pH. Since buffering to around 7.0 is suggested by Dibble et al. and near neutral pH includes pH of 6 one skilled in the art would manipulate the excipient(s) necessary in order to achieve the desired pH. Depending on the concentration of the antisense oligonucleotide and the desired level of turbidity and/or viscosity, one skilled in the art would recognize that the concentration of excipients would need to be manipulated. It is generally noted that differences in concentration do not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05. Claims 1-2, 4, 8, 12-13, 17-20, 22, 24, 26, 28, 30-31, 33-34, 36 and 41 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-4 of U.S. Patent No. 11802283 in view of Dibble et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. The instant claims are set forth above. Patent ‘283 claims a method for treating Hutchinson-Gilford progeria syndrome (HGPS) in a subject in need thereof comprising administering an antisense oligomer which has the same sequence as instantly claimed SEQ ID NO: 4 and the structure corresponding to the instantly claimed compound wherein A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23; E’ is L-J-G wherein L is glycine, J is cell-penetrating peptide of (R)6 (which corresponds to instantly claimed SEQ ID NO: 11) and G is C(O)CH3 (C1 alkyl). Pharmaceutically acceptable salts are claimed. A carrier is claimed. While Patent ‘283 claims an antisense oligonucleotide with the same structure as instantly claimed, Patent ‘283 does not expressly claim benzyl alcohol or the other claimed excipients/pH. However, this deficiency is cured by Dibble et al. The teachings of Dibble et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘283 and Dibble et al. and utilize benzyl alcohol as an excipient which can be used with antisense oligonucleotides to mitigate turbidity and viscosity. One skilled in the art would have been motivated to select benzyl alcohol with a reasonable expectation of success as Dibble et al. teaches that it can mitigate turbidity and viscosity in antisense oligonucleotide formulations. Therefore, when formulating a liquid dosage form which can be used to deliver the antisense oligonucleotide and when turbidity and viscosity are of a concern, one skilled in the art would have been motivated to combine benzyl alcohol with the antisense oligonucleotide. Regarding the claimed antisense oligomer (claims 1, 2, 4, 8, 12-13, 17-19, 22, 36 and 41), Patent ‘283 expressly claims a compound which corresponds to A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23. Regarding claim 20, pharmaceutically acceptable salts are claimed. Regarding claims 24, 30 and 33, Dibble et al. teaches two or more excipients may together possess one or more properties of effective excipients. Dibble et al. teaches excipients which can be utilized include mannitol, propylene glycol and histidine. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘283 and Dibble et al. and manipulate the type and quantity of the excipients utilized in order to achieve the desired properties. One skilled in the art would have a reasonable expectation of success as Dibble et al. expressly teaches experimentation with excipients by combining two or more in order to achieve desired properties. Specific excipients taught include histidine, mannitol, propylene glycol, glycerin, etc. Regarding claim 26, Dibble et al. teaches excipients increase the pH of the solution (claim 157), decrease the pH of the solution (claim 158) and buffers the pH of the solution (claim 159). In some embodiments the excipient buffers the pH of the antisense oligonucleotide solution around a pH or 7.0 (e.g. 6.8-72) (page 60-61). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘283 and Dibble et al. and manipulate the excipients and select combination that not only modulate viscosity and turbidity but also buffer the pH to around 7.0 as taught by Dibble et al. Regarding claim 28, 31 and 34, Dibble et al. teaches concentrations of benzyl alcohol 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection (table 5). Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘283 and Dibble et al. and manipulate not only the type but the concentration of the excipients in order to achieve the desired level of solubility (e.g. turbidity) and viscosity but also the pH. Since buffering to around 7.0 is suggested by Dibble et al. and near neutral pH includes pH of 6 one skilled in the art would manipulate the excipient(s) necessary in order to achieve the desired pH. Depending on the concentration of the antisense oligonucleotide and the desired level of turbidity and/or viscosity, one skilled in the art would recognize that the concentration of excipients would need to be manipulated. It is generally noted that differences in concentration do not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05. Claims 1-2, 4, 8, 12-13, 18-20, 22, 24, 26, 28, 30-31 and 33-34 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-7 of U.S. Patent No. 11382981 in view of Dibble et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. The instant claims are set forth above. Patent ‘981 claims an antisense oligomer conjugate. A specific structure claimed is: PNG media_image10.png 768 325 media_image10.png Greyscale which corresponds to the instantly claimed compound wherein A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23; E’ is L-J-G wherein L is glycine, J is cell-penetrating peptide of (R)6 (which corresponds to instantly claimed SEQ ID NO: 11) and G is C(O)CH3 (C1 alkyl). Pharmaceutically acceptable salts are claimed. Pharmaceutical composition comprising a carrier is claimed. While Patent ‘981 claims an antisense oligonucleotide with the same structure as instantly claimed, Patent ‘981 does not expressly claim benzyl alcohol or the other claimed excipients/pH. However, this deficiency is cured by Dibble et al. The teachings of Dibble et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘981 and Dibble et al. and utilize benzyl alcohol as an excipient which can be used with antisense oligonucleotides to mitigate turbidity and viscosity. One skilled in the art would have been motivated to select benzyl alcohol with a reasonable expectation of success as Dibble et al. teaches that it can mitigate turbidity and viscosity in antisense oligonucleotide formulations. Therefore, when formulating a liquid dosage form which can be used to deliver the antisense oligonucleotide and when turbidity and viscosity are of a concern, one skilled in the art would have been motivated to combine benzyl alcohol with the antisense oligonucleotide. Regarding claim 20, pharmaceutically acceptable salts are claimed. Regarding claims 24, 30 and 33, Dibble et al. teaches two or more excipients may together possess one or more properties of effective excipients. Dibble et al. teaches excipients which can be utilized include mannitol, propylene glycol and histidine. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘981 and Dibble et al. and manipulate the type and quantity of the excipients utilized in order to achieve the desired properties. One skilled in the art would have a reasonable expectation of success as Dibble et al. expressly teaches experimentation with excipients by combining two or more in order to achieve desired properties. Specific excipients taught include histidine, mannitol, propylene glycol, glycerin, etc. Regarding claim 26, Dibble et al. teaches excipients increase the pH of the solution (claim 157), decrease the pH of the solution (claim 158) and buffers the pH of the solution (claim 159). In some embodiments the excipient buffers the pH of the antisense oligonucleotide solution around a pH or 7.0 (e.g. 6.8-72) (page 60-61). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘981 and Dibble et al. and manipulate the excipients and select combination that not only modulate viscosity and turbidity but also buffer the pH to around 7.0 as taught by Dibble et al. Regarding claim 28, 31 and 34, Dibble et al. teaches concentrations of benzyl alcohol 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection (table 5). Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘981 and Dibble et al. and manipulate not only the type but the concentration of the excipients in order to achieve the desired level of solubility (e.g. turbidity) and viscosity but also the pH. Since buffering to around 7.0 is suggested by Dibble et al. and near neutral pH includes pH of 6 one skilled in the art would manipulate the excipient(s) necessary in order to achieve the desired pH. Depending on the concentration of the antisense oligonucleotide and the desired level of turbidity and/or viscosity, one skilled in the art would recognize that the concentration of excipients would need to be manipulated. It is generally noted that differences in concentration do not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05. Claims 1-2, 4, 8, 12-13, 18-20, 22, 24, 26, 28, 30-31 and 33-34 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-18 of U.S. Patent No. 12377150 in view of Dibble et al.. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. The instant claims are set forth above. Patent ‘150 claims a method for treating Duchene muscular dystrophy in a human subject in need thereof by administering to the human subject an antisense oligomer. The antisense oligomer as claimed corresponds to the instantly claimed compound wherein A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23; E’ is L-J-G wherein L is glycine, J is cell-penetrating peptide of (R)6 (which corresponds to instantly claimed SEQ ID NO: 11) and G is C(O)CH3 (C1 alkyl). While Patent ‘150 claims an antisense oligonucleotide with the same structure as instantly claimed, Patent ‘150 does not expressly claim benzyl alcohol or the other claimed excipients/pH. However, this deficiency is cured by Dibble et al. The teachings of Dibble et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘150 and Dibble et al. and utilize benzyl alcohol as an excipient which can be used with antisense oligonucleotides to mitigate turbidity and viscosity. One skilled in the art would have been motivated to select benzyl alcohol with a reasonable expectation of success as Dibble et al. teaches that it can mitigate turbidity and viscosity in antisense oligonucleotide formulations. Therefore, when formulating a liquid dosage form which can be used to deliver the antisense oligonucleotide and when turbidity and viscosity are of a concern, one skilled in the art would have been motivated to combine benzyl alcohol with the antisense oligonucleotide. Regarding claim 20, pharmaceutically acceptable salts are claimed. Regarding claims 24, 30 and 33, Dibble et al. teaches two or more excipients may together possess one or more properties of effective excipients. Dibble et al. teaches excipients which can be utilized include mannitol, propylene glycol and histidine. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘150 and Dibble et al. and manipulate the type and quantity of the excipients utilized in order to achieve the desired properties. One skilled in the art would have a reasonable expectation of success as Dibble et al. expressly teaches experimentation with excipients by combining two or more in order to achieve desired properties. Specific excipients taught include histidine, mannitol, propylene glycol, glycerin, etc. Regarding claim 26, Dibble et al. teaches excipients increase the pH of the solution (claim 157), decrease the pH of the solution (claim 158) and buffers the pH of the solution (claim 159). In some embodiments the excipient buffers the pH of the antisense oligonucleotide solution around a pH or 7.0 (e.g. 6.8-72) (page 60-61). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘150 and Dibble et al. and manipulate the excipients and select combination that not only modulate viscosity and turbidity but also buffer the pH to around 7.0 as taught by Dibble et al. Regarding claim 28, 31 and 34, Dibble et al. teaches concentrations of benzyl alcohol 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection (table 5). Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘150 and Dibble et al. and manipulate not only the type but the concentration of the excipients in order to achieve the desired level of solubility (e.g. turbidity) and viscosity but also the pH. Since buffering to around 7.0 is suggested by Dibble et al. and near neutral pH includes pH of 6 one skilled in the art would manipulate the excipient(s) necessary in order to achieve the desired pH. Depending on the concentration of the antisense oligonucleotide and the desired level of turbidity and/or viscosity, one skilled in the art would recognize that the concentration of excipients would need to be manipulated. It is generally noted that differences in concentration do not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05. Claims 1-2, 4, 8, 12-13, 18-20, 22, 24, 26, 28, 30-31 and 33-34 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-22 of U.S. Patent No. 12286630 in view of Dibble et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. The instant claims are set forth above. Patent ‘630 claims a method for treating Duchene muscular dystrophy in a human subject in need thereof by administering to the human subject an antisense oligomer. The antisense oligomer as claimed corresponds to the instantly claimed compound wherein A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23; E’ is L-J-G wherein L is glycine, J is cell-penetrating peptide of (R)6 (which corresponds to instantly claimed SEQ ID NO: 11) and G is C(O)CH3 (C1 alkyl). The same structure as set forth in instant claim 22 is claimed (see claim 11). While Patent ‘630 claims an antisense oligonucleotide with the same structure as instantly claimed, Patent ‘630 does not expressly claim benzyl alcohol or the other claimed excipients/pH. However, this deficiency is cured by Dibble et al. The teachings of Dibble et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘630 and Dibble et al. and utilize benzyl alcohol as an excipient which can be used with antisense oligonucleotides to mitigate turbidity and viscosity. One skilled in the art would have been motivated to select benzyl alcohol with a reasonable expectation of success as Dibble et al. teaches that it can mitigate turbidity and viscosity in antisense oligonucleotide formulations. Therefore, when formulating a liquid dosage form which can be used to deliver the antisense oligonucleotide and when turbidity and viscosity are of a concern, one skilled in the art would have been motivated to combine benzyl alcohol with the antisense oligonucleotide. Regarding claim 20, pharmaceutically acceptable salts are claimed. Regarding claims 24, 30 and 33, Dibble et al. teaches two or more excipients may together possess one or more properties of effective excipients. Dibble et al. teaches excipients which can be utilized include mannitol, propylene glycol and histidine. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘630 and Dibble et al. and manipulate the type and quantity of the excipients utilized in order to achieve the desired properties. One skilled in the art would have a reasonable expectation of success as Dibble et al. expressly teaches experimentation with excipients by combining two or more in order to achieve desired properties. Specific excipients taught include histidine, mannitol, propylene glycol, glycerin, etc. Regarding claim 26, Dibble et al. teaches excipients increase the pH of the solution (claim 157), decrease the pH of the solution (claim 158) and buffers the pH of the solution (claim 159). In some embodiments the excipient buffers the pH of the antisense oligonucleotide solution around a pH or 7.0 (e.g. 6.8-72) (page 60-61). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘630 and Dibble et al. and manipulate the excipients and select combination that not only modulate viscosity and turbidity but also buffer the pH to around 7.0 as taught by Dibble et al. Regarding claim 28, 31 and 34, Dibble et al. teaches concentrations of benzyl alcohol 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection (table 5). Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘630 and Dibble et al. and manipulate not only the type but the concentration of the excipients in order to achieve the desired level of solubility (e.g. turbidity) and viscosity but also the pH. Since buffering to around 7.0 is suggested by Dibble et al. and near neutral pH includes pH of 6 one skilled in the art would manipulate the excipient(s) necessary in order to achieve the desired pH. Depending on the concentration of the antisense oligonucleotide and the desired level of turbidity and/or viscosity, one skilled in the art would recognize that the concentration of excipients would need to be manipulated. It is generally noted that differences in concentration do not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05. Claims 1-2, 4, 8, 12-13, 18-20, 22, 24, 26, 28, 30-31 and 33-34 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-29 of copending Application No. 18440684 (USPGPUB No. 20250090569) in view of Dibble et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. This is a provisional nonstatutory double patenting rejection. The instant claims are set forth above. Copending ‘684 claims an antisense oligomer conjugate which corresponds to the instantly claimed compound wherein A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23; E’ is L-J-G wherein L is glycine, J is cell-penetrating peptide of (R)6 (which corresponds to instantly claimed SEQ ID NO: 11) and G is C(O)CH3 (C1 alkyl). The same structure as set forth in instant claim 22 is claimed (see claim 6). While Copending ‘684 claims an antisense oligonucleotide with the same structure as instantly claimed, Copending ‘684 does not expressly claim benzyl alcohol or the other claimed excipients/pH. However, this deficiency is cured by Dibble et al. The teachings of Dibble et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘684 and Dibble et al. and utilize benzyl alcohol as an excipient which can be used with antisense oligonucleotides to mitigate turbidity and viscosity. One skilled in the art would have been motivated to select benzyl alcohol with a reasonable expectation of success as Dibble et al. teaches that it can mitigate turbidity and viscosity in antisense oligonucleotide formulations. Therefore, when formulating a liquid dosage form which can be used to deliver the antisense oligonucleotide and when turbidity and viscosity are of a concern, one skilled in the art would have been motivated to combine benzyl alcohol with the antisense oligonucleotide. Regarding claim 20, pharmaceutically acceptable salts are claimed. Regarding claims 24, 30 and 33, Dibble et al. teaches two or more excipients may together possess one or more properties of effective excipients. Dibble et al. teaches excipients which can be utilized include mannitol, propylene glycol and histidine. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘684 and Dibble et al. and manipulate the type and quantity of the excipients utilized in order to achieve the desired properties. One skilled in the art would have a reasonable expectation of success as Dibble et al. expressly teaches experimentation with excipients by combining two or more in order to achieve desired properties. Specific excipients taught include histidine, mannitol, propylene glycol, glycerin, etc. Regarding claim 26, Dibble et al. teaches excipients increase the pH of the solution (claim 157), decrease the pH of the solution (claim 158) and buffers the pH of the solution (claim 159). In some embodiments the excipient buffers the pH of the antisense oligonucleotide solution around a pH or 7.0 (e.g. 6.8-72) (page 60-61). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘684 and Dibble et al. and manipulate the excipients and select combination that not only modulate viscosity and turbidity but also buffer the pH to around 7.0 as taught by Dibble et al. Regarding claim 28, 31 and 34, Dibble et al. teaches concentrations of benzyl alcohol 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection (table 5). Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘684 and Dibble et al. and manipulate not only the type but the concentration of the excipients in order to achieve the desired level of solubility (e.g. turbidity) and viscosity but also the pH. Since buffering to around 7.0 is suggested by Dibble et al. and near neutral pH includes pH of 6 one skilled in the art would manipulate the excipient(s) necessary in order to achieve the desired pH. Depending on the concentration of the antisense oligonucleotide and the desired level of turbidity and/or viscosity, one skilled in the art would recognize that the concentration of excipients would need to be manipulated. It is generally noted that differences in concentration do not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05. Claims 1-2, 4, 8, 12-13, 18-20, 22, 24, 26, 28, 30-31 and 33-34 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-9, 17 and 24-26 of copending Application No. 18634360 (USPGPUB No. 20250092393) in view of Dibble et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. This is a provisional nonstatutory double patenting rejection. The instant claims are set forth above. Copending ‘360 claims an antisense oligomer conjugate which corresponds to the instantly claimed compound wherein A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23; E’ is L-J-G wherein L is glycine, J is cell-penetrating peptide of (R)6 (which corresponds to instantly claimed SEQ ID NO: 11) and G is C(O)CH3 (C1 alkyl). The same structure as set forth in instant claim 22 is claimed (see claim 5). While Copending ‘360 claims an antisense oligonucleotide with the same structure as instantly claimed, Copending ‘360 does not expressly claim benzyl alcohol or the other claimed excipients/pH. However, this deficiency is cured by Dibble et al. The teachings of Dibble et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘360 and Dibble et al. and utilize benzyl alcohol as an excipient which can be used with antisense oligonucleotides to mitigate turbidity and viscosity. One skilled in the art would have been motivated to select benzyl alcohol with a reasonable expectation of success as Dibble et al. teaches that it can mitigate turbidity and viscosity in antisense oligonucleotide formulations. Therefore, when formulating a liquid dosage form which can be used to deliver the antisense oligonucleotide and when turbidity and viscosity are of a concern, one skilled in the art would have been motivated to combine benzyl alcohol with the antisense oligonucleotide. Regarding claim 20, pharmaceutically acceptable salts are claimed. Regarding claims 24, 30 and 33, Dibble et al. teaches two or more excipients may together possess one or more properties of effective excipients. Dibble et al. teaches excipients which can be utilized include mannitol, propylene glycol and histidine. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘360 and Dibble et al. and manipulate the type and quantity of the excipients utilized in order to achieve the desired properties. One skilled in the art would have a reasonable expectation of success as Dibble et al. expressly teaches experimentation with excipients by combining two or more in order to achieve desired properties. Specific excipients taught include histidine, mannitol, propylene glycol, glycerin, etc. Regarding claim 26, Dibble et al. teaches excipients increase the pH of the solution (claim 157), decrease the pH of the solution (claim 158) and buffers the pH of the solution (claim 159). In some embodiments the excipient buffers the pH of the antisense oligonucleotide solution around a pH or 7.0 (e.g. 6.8-72) (page 60-61). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘360 and Dibble et al. and manipulate the excipients and select combination that not only modulate viscosity and turbidity but also buffer the pH to around 7.0 as taught by Dibble et al. Regarding claim 28, 31 and 34, Dibble et al. teaches concentrations of benzyl alcohol 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection (table 5). Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘360 and Dibble et al. and manipulate not only the type but the concentration of the excipients in order to achieve the desired level of solubility (e.g. turbidity) and viscosity but also the pH. Since buffering to around 7.0 is suggested by Dibble et al. and near neutral pH includes pH of 6 one skilled in the art would manipulate the excipient(s) necessary in order to achieve the desired pH. Depending on the concentration of the antisense oligonucleotide and the desired level of turbidity and/or viscosity, one skilled in the art would recognize that the concentration of excipients would need to be manipulated. It is generally noted that differences in concentration do not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05. Claims 1-2, 4, 8, 12-13, 18-20, 22, 24, 26, 28, 30-31 and 33-34 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-22 of copending Application No. 18774061 (USPGPUB No. 20250179487) in view of Dibble et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. This is a provisional nonstatutory double patenting rejection. The instant claims are set forth above. Copending ‘061 claims an antisense oligomer conjugate which corresponds to the instantly claimed compound wherein A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23; E’ is L-J-G wherein L is glycine, J is cell-penetrating peptide of (R)6 (which corresponds to instantly claimed SEQ ID NO: 11) and G is C(O)CH3 (C1 alkyl). The same structure as set forth in instant claim 22 is claimed (see claim 11). While Copending ‘061 claims an antisense oligonucleotide with the same structure as instantly claimed, Copending ‘061 does not expressly claim benzyl alcohol or the other claimed excipients/pH. However, this deficiency is cured by Dibble et al. The teachings of Dibble et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘061 and Dibble et al. and utilize benzyl alcohol as an excipient which can be used with antisense oligonucleotides to mitigate turbidity and viscosity. One skilled in the art would have been motivated to select benzyl alcohol with a reasonable expectation of success as Dibble et al. teaches that it can mitigate turbidity and viscosity in antisense oligonucleotide formulations. Therefore, when formulating a liquid dosage form which can be used to deliver the antisense oligonucleotide and when turbidity and viscosity are of a concern, one skilled in the art would have been motivated to combine benzyl alcohol with the antisense oligonucleotide. Regarding claim 20, pharmaceutically acceptable salts are claimed. Regarding claims 24, 30 and 33, Dibble et al. teaches two or more excipients may together possess one or more properties of effective excipients. Dibble et al. teaches excipients which can be utilized include mannitol, propylene glycol and histidine. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘061 and Dibble et al. and manipulate the type and quantity of the excipients utilized in order to achieve the desired properties. One skilled in the art would have a reasonable expectation of success as Dibble et al. expressly teaches experimentation with excipients by combining two or more in order to achieve desired properties. Specific excipients taught include histidine, mannitol, propylene glycol, glycerin, etc. Regarding claim 26, Dibble et al. teaches excipients increase the pH of the solution (claim 157), decrease the pH of the solution (claim 158) and buffers the pH of the solution (claim 159). In some embodiments the excipient buffers the pH of the antisense oligonucleotide solution around a pH or 7.0 (e.g. 6.8-72) (page 60-61). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘061 and Dibble et al. and manipulate the excipients and select combination that not only modulate viscosity and turbidity but also buffer the pH to around 7.0 as taught by Dibble et al. Regarding claim 28, 31 and 34, Dibble et al. teaches concentrations of benzyl alcohol 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection (table 5). Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘061 and Dibble et al. and manipulate not only the type but the concentration of the excipients in order to achieve the desired level of solubility (e.g. turbidity) and viscosity but also the pH. Since buffering to around 7.0 is suggested by Dibble et al. and near neutral pH includes pH of 6 one skilled in the art would manipulate the excipient(s) necessary in order to achieve the desired pH. Depending on the concentration of the antisense oligonucleotide and the desired level of turbidity and/or viscosity, one skilled in the art would recognize that the concentration of excipients would need to be manipulated. It is generally noted that differences in concentration do not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05. Claims 1-2, 4, 8, 12-13, 18-20, 22, 24, 26, 28, 30-31 and 33-34 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 17-21, 32-33, 35, 44-47, 67-72 and 78 of copending Application No. 19071514 (USPGPUB No. 20250290069) in view of Dibble et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. This is a provisional nonstatutory double patenting rejection. The instant claims are set forth above. Copending ‘514 claims an antisense oligomer conjugate which corresponds to the instantly claimed compound wherein A’ of: PNG media_image6.png 233 295 media_image6.png Greyscale wherein R1 is NR3R4 where R3 and R4 are C1 alkyl; R5 of C(O)(OCH2CH2)3OH; t is 23; E’ is L-J-G wherein L is glycine, J is cell-penetrating peptide of (R)6 (which corresponds to instantly claimed SEQ ID NO: 11) and G is C(O)CH3 (C1 alkyl). The same structure as set forth in instant claim 22 is claimed (see claim 67). While Copending ‘514 claims an antisense oligonucleotide with the same structure as instantly claimed, Copending ‘514 does not expressly claim benzyl alcohol or the other claimed excipients/pH. However, this deficiency is cured by Dibble et al. The teachings of Dibble et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘514 and Dibble et al. and utilize benzyl alcohol as an excipient which can be used with antisense oligonucleotides to mitigate turbidity and viscosity. One skilled in the art would have been motivated to select benzyl alcohol with a reasonable expectation of success as Dibble et al. teaches that it can mitigate turbidity and viscosity in antisense oligonucleotide formulations. Therefore, when formulating a liquid dosage form which can be used to deliver the antisense oligonucleotide and when turbidity and viscosity are of a concern, one skilled in the art would have been motivated to combine benzyl alcohol with the antisense oligonucleotide. Regarding claim 20, pharmaceutically acceptable salts are claimed. Regarding claims 24, 30 and 33, Dibble et al. teaches two or more excipients may together possess one or more properties of effective excipients. Dibble et al. teaches excipients which can be utilized include mannitol, propylene glycol and histidine. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘514 and Dibble et al. and manipulate the type and quantity of the excipients utilized in order to achieve the desired properties. One skilled in the art would have a reasonable expectation of success as Dibble et al. expressly teaches experimentation with excipients by combining two or more in order to achieve desired properties. Specific excipients taught include histidine, mannitol, propylene glycol, glycerin, etc. Regarding claim 26, Dibble et al. teaches excipients increase the pH of the solution (claim 157), decrease the pH of the solution (claim 158) and buffers the pH of the solution (claim 159). In some embodiments the excipient buffers the pH of the antisense oligonucleotide solution around a pH or 7.0 (e.g. 6.8-72) (page 60-61). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘514 and Dibble et al. and manipulate the excipients and select combination that not only modulate viscosity and turbidity but also buffer the pH to around 7.0 as taught by Dibble et al. Regarding claim 28, 31 and 34, Dibble et al. teaches concentrations of benzyl alcohol 1.5% w/v benzyl alcohol afforded 0 turbidity on visual inspection (table 5). Table 5 shows L-histidine affords 0 turbidity at 1.5 or 2 w/v%. Table 6 shows histidine at 2 w/v% decreases viscosity. Concentrations of mannitol taught include 2, 5 10 and 15 w/v% (table 8; page 80-81). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘514 and Dibble et al. and manipulate not only the type but the concentration of the excipients in order to achieve the desired level of solubility (e.g. turbidity) and viscosity but also the pH. Since buffering to around 7.0 is suggested by Dibble et al. and near neutral pH includes pH of 6 one skilled in the art would manipulate the excipient(s) necessary in order to achieve the desired pH. Depending on the concentration of the antisense oligonucleotide and the desired level of turbidity and/or viscosity, one skilled in the art would recognize that the concentration of excipients would need to be manipulated. It is generally noted that differences in concentration do not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). MPEP 2144.05. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to ABIGAIL VANHORN whose telephone number is (571)270-3502. The examiner can normally be reached M-Th 6 am-4 pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Nov 02, 2023
Application Filed
Sep 01, 2026
Non-Final Rejection mailed — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12742162
Conjugates of Guide RNA-Cas Protein Complex
6y 1m to grant Granted Sep 22, 2026
Patent 12735702
ENDOSOMAL CLEAVABLE LINKERS
4y 7m to grant Granted Sep 15, 2026
Patent 12685766
MODIFIED GENE VACCINES AGAINST AVIAN CORONAVIRUSES AND METHODS OF USING THE SAME
3y 8m to grant Granted Jul 21, 2026
Patent 12678400
IMPLANTABLE DEVICES FOR DRUG DELIVERY WITH REDUCED BURST RELEASE
3y 7m to grant Granted Jul 14, 2026
Patent 12678401
IMPLANTABLE DEVICES FOR DRUG DELIVERY WITH REDUCED BURST RELEASE
3y 2m to grant Granted Jul 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
47%
Grant Probability
69%
With Interview (+22.4%)
3y 9m (~9m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1219 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month