Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on October 30, 2025 has been entered.
Detailed Action
This action is in response to the papers filed October 30, 2025.
Amendments
Applicant's response and amendments, filed October 30, 2025, to the prior Office Action is acknowledged. Applicant has cancelled Claims 2, 6, and 17, and amended Claims 1 and 18-19.
Claims 1, 3-5, 7-16, and 18-19 are pending and under consideration.
Priority
This application is a continuation of application 17/577,940 filed on January 18, 2022, now abandoned. Applicant’s claim for the benefit of a prior-filed application provisional applications:
63/244,166 filed on September 14, 2021;
63/226,114 filed on July 27, 2021;
63/153,367 filed on February 24, 2021; and
63/139,305 filed on January 19, 2021
under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged.
Information Disclosure Statement
Applicant has filed an Information Disclosure Statement on September 26, 2025 that has been considered.
The signed and initialed PTO Forms 1449 are mailed with this action.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
1. The prior rejection of Claims 1, 3-5, and 7-19 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendment to Claim 1 to recite in step (b) the administration of the expanded cells of step (a).
2. The prior rejections of Claim 17 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, are withdrawn in light of Applicant’s cancellation of the claim.
3. The prior rejection of Claims 18-19 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendment to the claims.
4. Claims 18-19 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c).
In the present instance, Claim 18 recites the broad recitations “the mbIL15 construct comprises: a leader sequence, … an IL15 polypeptide, …a (GS)15 linker, etc….”, and the claim also recites “encoded by the nucleic acid sequence of SEQ ID NO:” which is/are the narrower statement of the range/limitations, respectively.
Claim 19 recites the broad recitation “the mbIL15 construct” and the claim also recites “is encoded by the nucleic acid sequence of SEQ ID NO:31” which is the narrower statement of the range/limitation.
The claim(s) are considered indefinite because there is a question or doubt as to whether the features introduced by such narrower language, to wit, the SEQ ID NOs, is/are (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. While it is clear that the construct is to encode a leader sequence, an IL-15 polypeptide, a (GS)15 linker, etc…, the present phrases "encoded by" render the claims indefinite because it is unclear whether the limitation(s) SEQ ID NO’s following the phrase are part of the claimed invention, or merely exemplary limitations. See MPEP § 2173.05(d).
Applicant should amend Claim 18 to instead recite, for example, “the mbIL15 construct comprises:
i) the nucleic acid sequence of SEQ ID NO:11 which encodes a leader sequence;
ii) the nucleic acid sequence of SEQ ID NO:13 which encodes an IL15 polypeptide; etc…”.
Applicant should amend Claim 19 to instead recite “the mbIL15 construct comprises the nucleic acid sequence of SEQ ID NO:31”.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
5. Claims 1, 3-5, 7-14, and 16 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Forget et al (2014; of record), in view of Liu et al (2013; of record; co-authors to Forget et al), Campana et al (of record in IDS), Kamiya et al (co-author to Campana et al; of record in IDS), Suri et al (of record in IDS), and Pan et al (2012; of record in IDS).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Claim 1 is interpreted to be directed to a method of treating a subject having a cancer, the method comprising the steps of:
a) isolating a population of TILs comprising CD8+ and CD4+ T cells from a tumor;
b) engineering said isolated population of TILs to express mbIL-15-B7.1tm-DRD;
c) expanding said engineered population of TILs in vitro, in the absence of IL-2, with K562 feeder cells that:
i) express 41BB ligand;
ii) express mbIL-21; and
iii) not express mbIL-15; and
d) administering said expanded, engineered population of TILs to a recipient subject,
wherein the recipient subject is not administered IL-2.
With respect to Claim 1, Forget et al is considered relevant prior art for having taught a method for treating a recipient subject having cancer, the method comprising the steps(s) of:
a) isolating a population of TILs comprising CD8+ and CD4+ T cells from a tumor (e.g. pg 449, col. 1, Methods, Initial propagation of TIL from human melanoma tumors);
c) expanding said population of TILs in vitro with K562 feeder cells that are engineered to:
i) express 41BB ligand (syn. CD137L); and
ii) express mbIL-15 (e.g. pg 449, col. 2, Rapid expansion of TIL by aAPC); and
d) administering said expanded, engineered population of TILs to a recipient subject (e.g. Title, “for Adoptive immunotherapy of melanoma”; pg 458, col. 1, “infusion product”; pg 458, col. 2, “clinical trial with evaluation of clinical responses and long-term persistence tracking of the infused cells”).
Forget et al taught that the TILs obtained from the tumor naturally comprise CD8+ T cells, CD4+ T cells, and NK cells (e.g. pg 451, col. 1).
Forget et al taught that expression of 41BBL on the surface of the K562 cells is known in the art to preferentially expand CD8+ T cells (e.g. pg 457, col. 2).
Forget et al taught that the use of genetically modified K562 cells is a practical and effective alternative to peripheral blood mononuclear feeder cells for expansion of tumor infiltrating lymphocytes (e.g. pg 457, col. 1).
Forget et al do not teach:
c) expanding said engineered population of TILs in vitro with K562 feeder cells that are engineered to:
i) express mbIL-21, and
ii) not express mbIL-15.
However, prior to the effective filing date of the instant application, and with respect to Claim 1, Liu et al is considered relevant prior art for having taught a method of treating a recipient subject having a cancer, the method comprising the steps of:
a) providing a population of natural killer (NK) cells;
c) culturing and expanding the NK cells in vitro with K562 feeder cells that are engineered to:
i) express 41BB ligand (e.g. pg 2133, col. 1, para 2);
ii) express mbIL-21 (e.g. pg 2133, col. 1, para 2); and
iii) do not express mbIL-15; and
d) administering to the recipient subject the expanded population of NK cells (e.g. pg 2134, col. 2, Materials and Methods, Murine model).
Liu et al taught the NK cells were cultured in the presence of exogenous IL-2 (e.g. pg 2133-2134, Materials and Methods, joining para), and that the recipient subject is administered IL-2.
Liu et al taught that the 41BB+, mbIL-21 K562 feeder cells stimulated NK cells to proliferate more than 2,000-fold in 14 days, and to become highly cytotoxic against tumor cells, and retain potent antitumor activity in vivo in subjects having a cancer, resulting in significantly decreased tumor growth and increased survival (e.g. pg 2133, col. 1, Translational Relevance).
Both Forget et al and Liu et al taught expansion in the presence of IL-2.
Neither Forget et al nor Liu et al teach:
b) engineering said isolated population of TILs to express mbIL-15;
c) expanding said engineered population of TILs in vitro, in the absence of IL-2, with the engineered K562 feeder cells; and
d) administering said expanded, engineered population of TILs to a recipient subject,
wherein the recipient subject is not administered IL-2.
However, prior to the effective filing date of the instant application, and with respect to Claim 1, Campana et al is considered relevant prior art for having disclosed a method of treating a recipient subject having a cancer comprising the steps of:
a) providing a population of natural killer (NK) cells (e.g., [0023], “NK cells refer to a type of cytotoxic lymphocyte”; [0036, 66]);
b) genetically modifying the NK cells to express mbIL-15 (e.g. [0036, 69], [0081] “transduce proliferating NK cells”, “the construct containing mbIL-15”; [0082], “after transduction with mbIL-15, IL-15 was expressed on the NK cell membrane”);
c) culturing and expanding the NK cells in vitro, in the absence of IL-2 (e.g. [0072], “without or with IL-2”; [0084], “[NK-mbIL-15] cultured them in the absence of IL-2”), whereby the expression of mbIL-15 by the NK cells could replace exogenous IL-2 in maintaining NK cell survival, thus providing mbIL-15 expressing NK cells having autonomous survival and expansion capacity [0083-84] and supported their autonomous expansion and extended survival in the absence of IL-2 [0099], including an example with K562 feeder cells that are engineered to:
i) not express mbIL-15 (e.g. Figure 11b, “K + NK92-mbIL-15”); and
d) administering to the recipient subject the expanded population of NK-mbIL-15 cells (e.g. [0088], Expansion and homing of mbIL-15 NK cells in vivo),
wherein the recipient subject is not administered IL-2 (e.g. [0088], Expansion and homing of mbIL-15 NK cells in vivo; Figure 3a, “no IL-2, mbIL-15”).
Campana et al disclosed that “expansion of human NK cells in large numbers ex vivo is feasible”; clinical-grade conditions is realistic and it is warranted by the superior expansion and cytotoxicity of mbIL-15-NK cells” [00102].
Campana et al disclosed that NK cells expressing mbIL-15 could expand in immunodeficient mice and infiltrated multiple tissues where they could be found in much larger numbers than mock-transduced cells. Expression of mbIL-15 did not impair the cytotoxic capacity of NK cells. In fact, in xenograft models, mbIL-15 NK cells exerted anticancer activity which was more powerful than that of mock-transduced cells, indicating that this approach might improve the antitumor capacity of NK cell infusions while averting the side effects of IL-2 administration [0099].
Campana et al disclosed that expression of a membrane-bound form of IL-15 in human NK cells supported their autonomous expansion and extended survival in the absence of IL-2. NK cells expressing mbIL-15 could be maintained in vitro for up to 2 months without exogenous IL-2 [0099].
Campana et al disclosed wherein the mbIL-15 NK cells “have increased release of lytic granules in the presence of target cells” in vitro, including tumor target cells, and exert anti-tumor activity in vivo [0010].
Campana et al disclosed that the primary mechanism of mbIL-15 stimulation was autocrine (e.g. [0093, 100]), and that survival of the mbIL-15 NK cells without IL-2 after 7 days in culture was vastly superior to that of mock-transduced NK cells (e.g. [0093]), the mbIL-15 NK cells expanded in vivo without IL-2, and had higher cytotoxicity against different tumor types in vitro and in vivo. Thus, mbIL-15 confers independent growth to NK cells and enhances their antitumor capacity (e.g. [00102]). Infusion of mbIL-15-NK cells would allow NK cell therapy without the potential adverse effects of cytokine administration (e.g. [0099]).
Similarly, Kamiya et al (co-authors to Campana et al) is considered relevant prior art for having disclosed a method of treating cancer in a subject, the method comprising the steps of:
a) obtaining NK cells from a subject (e.g. [0039], autologous or donor-derived allogeneic cells”);
b) engineering said NK cells to express membrane-bound IL-15 or membrane-bound IL12 [0026, 35], wherein the mbIL12 or mbIL-15 comprises CD8alpha transmembrane domain [0047, 49];
c) expanding the engineered NK cells in the presence of K562 feeder cells (e.g. [0021], “the engineered cells are derived from K562 cells”) engineered to express 41BB ligand, wherein the K562 cells may be further engineered to express membrane bound IL-21 (mbIL-21) and/or mbIL-15 (e.g. [0015], “one, two, or more of...”; [0018], “either in combination with [membrane-bound] IL-21, or alone”); and
d) administering to the recipient subject said expanded NK cells (e.g. [0039], “for genetic manipulation and infusion”; [0040], “for use in NK cell-based immunotherapy”).
Campana et al disclosed wherein the mbIIL-15 is operably linked to a CD8alpha transmembrane domain (e.g. [0081]), although other transmembrane domains may be used instead (e.g. [0033]).
Neither Campana et al nor Kamiya et al disclose:
b) the TIL is engineered to express mbIL-15 operably linked to a drug-responsive domain.
However, prior to the effective filing date of the instant application, and with respect to Claim 1, Suri et al is considered relevant prior art for having disclosed a method of treating a recipient subject having a cancer, the method comprising the step(s) of:
a) isolating TILs, including CD4+ and CD8+ TILs, from a subject, whereby said TILs are ssorted ex vivo [00262];
b) engineering said isolated TILs to express mbIL-15 (e.g. [00262, 266], wherein the mbIL-15 is operably linked to a drug responsive domain (DRD) (e.g. [00147]; Example 6, [00446], “DD regulated [membrane bound IL-15]”;
c) expanding said engineered TILs (e.g. [00241], “NK cells isolated…may be further expanded for adoptive immunotherapy”; [00266], “Immune cells can be isolated and expanded ex vivo using…methods known in the art”); and
d) administering to the recipient subject immune cells for adoptive cell transfer, e.g. used for cancer immunotherapy [0009, 257], said immune cells being natural killer cells or tumor infiltrating lymphocytes [0025], said immune cells being genetically modified to express membrane-bound IL-15 [0075], and wherein said immune cells may be expanded ex vivo [00241, 266].
Suri et al disclosed the immune cell may be a CD4+ T cell, a CD8+ T cell, an NK cell, or a tumor infiltrating cell [0025].
Suri et al disclosed that one embodiment of the invention is to use IL-21, as it, too, is a promising immunotherapeutic agent for cancer immunotherapy, shares the same common cytokine receptor subunit with IL-15, and can expand antigen-specific T cell numbers and rejuvenate multiple immune effector cells [00154].
Suri et al disclosed membrane-bound IL12 comprising a B7-1 transmembrane domain ([00146], citing Pan et al) or CD8alpha transmembrane domain (Table 4B).
Pan et al is considered relevant prior art for having taught a method of cancer immunotherapy, the method comprising the use of cells expressing membrane-bound IL12, wherein the mbIL12 comprises a B7-1 transmembrane domain.
Resolving the level of ordinary skill in the pertinent art.
People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology and enzymology. Therefore, the level of ordinary skill in this art is high.
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first transmembrane domain, e.g. CD8alpha, as disclosed by Campana et al, Kamiya et al, and Suri et al, with a second transmembrane domain, i.e. B7-1, as taught/disclosed by Suri et al and Pan et al, in a recombinant mbIL-15 protein, including wherein the mbIL-15 is operably linked to a drug responsive domain (DRD), with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first transmembrane domain, e.g. CD8alpha, with a second transmembrane domain, i.e. B7-1, in a recombinant mbIL-15 protein, including wherein the mbIL-15 is operably linked to a drug responsive domain (DRD), because Suri et al disclosed the transmembrane domain is substitutable with known transmembrane domains (Table 4B), including B7-1 ([00146], citing Pan et al), whereby both mbIL12 and mbIL-15 may have the same type of heterologous transmembrane domain (Kamiya et al, [0026, 47, 49], and whereby the B7-1 transmembrane domain had been successfully reduced to practice in the context of mbIL12 (Pan et al).
Prior to the effective filing date of the instantly claimed invention, it also would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” Suri et al disclosed a finite number of identified predictable potential transmembrane domains capable of use in membrane-bound cytokines, whereby the transmembrane domain is substitutable with known transmembrane domains (Table 4B), including B7-1 ([00146], citing Pan et al), whereby both mbIL12 and mbIL-15 may have the same type of heterologous transmembrane domain (Kamiya et al, [0026, 47, 49], and whereby the B7-1 transmembrane domain had been successfully reduced to practice in the context of mbIL12 (Pan et al).
Prior to the effective filing date of the instantly claimed invention, it also would have been obvious to modify the method of Forget et al, Liu et al, and Campana et al to comprise the steps of expanding mbIL-15-expressing tumor-infiltrating immune cells in the presence of K562 feeder cells engineered to express 41BB ligand and membrane bound IL-21 (mbIL-21), but not mbIL-15, and in the absence of exogenous IL-2, being motivated to do so with a reasonable expectation of success because:
i) Liu et al successfully demonstrated that primary human NK cells may be expanded in the presence of K562 feeder cells that have been genetically modified to express mbIL-21 and 41BBL, and do not express mbIL-15, whereby the 41BB+, mbIL-21 K562 feeder cells stimulated NK cells to proliferate more than 2,000-fold in 14 days, and to become highly cytotoxic against tumor cells, and retain potent antitumor activity in vivo in subjects having a cancer, resulting in significantly decreased tumor growth and increased survival (e.g. pg 2133, col. 1, Translational Relevance);
ii) Campana et al disclosed that the primary mechanism of mbIL-15 stimulation was autocrine, and successfully demonstrated culturing the mbIL-15 NK cells in the presence of K562 cells that do not express mbIL-15 (e.g. Figure 11b), and in the absence of IL-2, as the mbIL-15 NK cells no longer need IL-2 to proliferate;
iii) Kamiya et al disclosed, for example, wherein NK cells are expanded in the presence of K562 feeder cells engineered to express 41BB ligand, wherein the K562 cells may be further engineered to express membrane bound IL-21 (mbIL-21) and/or mbIL-15 (e.g. [0015], “one, two, or more of...”; [0018], “either in combination with [membrane-bound] IL-21, or alone”), and wherein the expanding step does not require adding IL-2 to the media, such being optional; and
iv) Suri et al disclosed that one embodiment of the invention is to use IL-21, as it, too, is a promising immunotherapeutic agent for cancer immunotherapy, shares the same common cytokine receptor subunit with IL-15, and can expand antigen-specific T cell numbers, including CD8+ T cells, and rejuvenate multiple immune effector cells [00154], whereby the immune cell population may be expanded in the presence of feeder cells genetically modified to express mbIL-21 [00266].
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 7-8, Forget et al taught wherein the expanded TILs demonstrated antitumor activity against both autologous (Claim 7) and allogeneic (Claim 8) tumor cells (e.g. pg 450, col. 2).
Liu et al taught wherein the NK cells were obtained from either healthy adults or patients suffering from cancer (e.g. pg 2133, col. 2, Materials and Methods, preparation of PBMCs).
Kamiya et al disclosed obtaining NK cells from a subject (e.g. [0039], autologous or donor-derived allogeneic cells”).
Suri et al disclosed wherein the immune cells for adoptive immunotherapy may be autologous (syn. isolated from the recipient subject) or allogeneic (syn. donor subject is not the recipient subject) (e.g. [00261]).
Those of ordinary skill in the art had long-recognized that there are only two options regarding the relationship of the adoptive immunotherapy cells relative to the recipient subject, to wit, either the immunotherapy cells are obtained from the recipient subject (Claim 7) or from a donor different than the recipient subject (Claim 8). It is obvious to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.”
With respect to Claim 10, Forget et al taught wherein the expanded TILs demonstrated antitumor activity against allogeneic tumor cells that are HLA-A-matched (e.g. pg 450, col. 2).
With respect to Claim 9, Forget et al taught wherein the expanded TILs demonstrated antitumor activity against allogeneic tumor cells that comprise cancer antigens that are present in the tumor of the recipient subject (e.g. pg 450, col. 2; Figure 5b).
With respect to Claim 16, Forget et al taught wherein the TILs were isolated from melanoma patients (e.g. pg 449, col. 1, Methods, Initial propagation of TIL from human melanoma tumors), and the recipient suffers from melanoma (e.g. Title).
Kamiya et al disclosed wherein the expanded immune cells are used to treat melanoma in a patient or subject [0064].
Suri et al disclosed wherein the cancer is a melanoma (e.g. [00302]).
With respect to Claim 11, Campana et al disclosed wherein the NK cells are transduced with a viral vector encoding the mbIL-15 (e.g. [0081], “retroviral transduction”).
Kamiya et al disclosed wherein the mbIL-15 comprises a transmembrane domain (e.g. [0007, 47]).
Suri et al disclosed wherein the mbIL-12 comprises a transmembrane domain (e.g. [00146]; Table 4B) and the mbIL-15 … [00446] (mbIL-15/IL-15Ra fusion), whereby those of ordinary skill in the art have long-recognized that human IL-15Ra naturally comprises a transmembrane domain.
Suri et al disclosed the immune cells for adoptive immunotherapy may be NK cells or tumor infiltrating lymphocytes (TILs) (e.g. [00261]), whereby said TILs may be cultured ex vivo (and thus necessarily isolated from a tumor) and genetically engineered to express the cytokine (e.g. [00262]; [00370], “tumor infiltrating lymphocytes (TILs) derived from the resected tumor”).
Pan et al taught wherein the mbIL-12 comprises a B7-1 transmembrane and cytoplasmic domains (e.g. Abstract) and expressed from a viral vector (e.g. pg 928, col. 1, Results, Construction and expression).
With respect to Claim 12, Kamiya et al disclosed wherein the mbIL-15 comprises a transmembrane domain (e.g. [0007, 47]) and a cytoplasmic domain (e.g. Figure 1, mb1L-15 symbol comprises extracellular, transmembrane, and intracellular domains).
Suri et al disclosed wherein the mbIL comprises a transmembrane domain and a cytoplasmic domain (e.g.Table 4B).
Suri et al disclosed wherein the mbIL-12 comprises a transmembrane domain (e.g. [00146]; Table 4B) and the mbIL-15 … [00446] (mbIL-15/IL-15Ra fusion), whereby those of ordinary skill in the art have long-recognized that human IL-15Ra naturally comprises a transmembrane domain and a cytoplasmic domain (e.g. Anderson et al (1995), Figure 1).
Suri et al also disclosed wherein the mbIL-12 comprises a cytoplasmic domain (e.g. Table 4B).
Pan et al taught wherein the mbIL-12 comprises a B7-1 transmembrane and cytoplasmic domains (e.g. Abstract).
With respect to Claim 13, Campana et al disclosed wherein the mbIL-15 comprises a hinge domain (e.g. Figure 1A).
Kamiya et al disclosed wherein the membrane-bound protein may comprise a linker domain (e.g. [0046]).
Suri et al disclosed wherein the mbIL-15 comprises a linker domain (e.g. Example 6, “DD linked IL-15-IL-15Ra”).
Pan et al taught wherein the mbIL-12 comprises a linker domain (e.g. Figure 1a).
With respect to Claim 14, Campana et al disclosed wherein the NK cells are transduced with a viral vector encoding the mbIL-15 (e.g. [0081], “retroviral transduction”), and wherein the viral vector may also be a lentiviral vector (e.g. [0037]).
Suri et al disclosed wherein the viral vector is a retroviral vector or a lentiviral vector (e.g. [00317]; [00323]; [00324], vector comprises both lentiviral and retroviral sequences; Example 19).
With respect to Claim 3, Suri et al disclosed the method further comprising the step(s) of:
administering to the subject a ligand that binds to the DRD operably linked to mbIL-15 (e.g. Example 29).
With respect to Claim 4, Suri et al disclosed wherein the DRD is a carbonic anhydrase DRD, e.g. CA2 ([0013]; Table 1).
With respect to Claim 5, Suri et al disclosed wherein the agent that binds to the carbonic anhydrase DRD is acetazolamide (Table 1).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant iterates prior arguments.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner responded to prior arguments in prior Office Action.
6. Claims 7-10 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Forget et al (2014), in view of Liu et al (2013; of record; co-authors to Forget et al), Campana et al (of record in IDS), Kamiya et al (co-author to Campana et al; of record in IDS), Suri et al (of record in IDS), and Pan et al (2012; of record in IDS), as applied to Claims 1, 3-5, 7-14, and 16 above, and in further view of Nakauchi et al (of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claims 7-8, Forget et al taught isolating TILs from a tumor, wherein the expanded TILs demonstrated antitumor activity against both autologous (Claim 7) and allogeneic (Claim 8) tumor cells (e.g. pg 450, col. 2).
With respect to Claim 10, Forget et al taught wherein the expanded TILs demonstrated antitumor activity against allogeneic tumor cells that are HLA-A-matched (e.g. pg 450, col. 2).
With respect to Claim 9, Forget et al taught wherein the expanded TILs demonstrated antitumor activity against allogeneic tumor cells that comprise cancer antigens that are present in the tumor of the recipient subject (e.g. pg 450, col. 2; Figure 5b).
Similarly, Nakauchi et al is considered relevant prior art for having disclosed a method of treating cancer in a patient (e.g. claim 1), wherein the cancer may be melanoma [0098], the method comprising the use of adoptive T cell therapies using autologous or allogeneic T cells ([0010], claim 11), wherein the T cells are HLA-matched to the patient ([0010, 68, 70], claim 12). Nakauchi et al disclosed that successful treatment of cancers with allogeneic T lymphocytes is a direct proof that human T-cell immunity has the potential to eradicate cancers [0106]. Nakauchi et al disclosed wherein the CTLs are obtained from a tumor biopsy (e.g. claims 8 and 34), and wherein the adoptive cells recognize the patient’s tumor antigen (e.g. Abstract, “neo-antigen epitopes recognized by the original CTLs”, [0004, 68-69]).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first donor subject, e.g. the TIL donor is the same as the recipient, for a second donor subject, i.e. the TIL donor comprises tumor antigens present in the recipient and/or is HLA-matched for the recipient, in an adoptive immunotherapy method of treating a subject suffering from cancer with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first donor subject, e.g. the TIL donor is the same as the recipient, for a second donor subject, i.e. the TIL donor comprises tumor antigens present in the recipient and/or is HLA-matched for the recipient, in an adoptive immunotherapy method of treating a subject suffering from cancer because those of ordinary skill in the art have long-recognized that the tumor antigen-specific immune cells used in adoptive immunotherapy may be autologous or allogeneic to the recipient subject, and wherein the tumor antigen-specific immune cells recognize cancer antigens present in the recipient subject and are HLA-matched to the recipient subject.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant iterates prior arguments.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner responded to prior arguments in prior Office Action.
Applicant does not contest the teachings of Nakauchi et al as applied to the obviousness to substitute a first donor subject, e.g. the TIL donor is the same as the recipient, for a second donor subject, i.e. the TIL donor comprises tumor antigens present in the recipient and/or is HLA-matched for the recipient, in an adoptive immunotherapy method of treating a subject suffering from cancer with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first donor subject, e.g. the TIL donor is the same as the recipient, for a second donor subject, i.e. the TIL donor comprises tumor antigens present in the recipient and/or is HLA-matched for the recipient, in an adoptive immunotherapy method of treating a subject suffering from cancer because those of ordinary skill in the art have long-recognized that the tumor antigen-specific immune cells used in adoptive immunotherapy may be autologous or allogeneic to the recipient subject, and wherein the tumor antigen-specific immune cells recognize cancer antigens present in the recipient subject and are HLA-matched to the recipient subject.
7. Claims 14-15 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Forget et al (2014), in view of Liu et al (2013; of record; co-authors to Forget et al), Campana et al (of record in IDS), Kamiya et al (co-author to Campana et al; of record in IDS), Suri et al (of record in IDS), Pan et al (2012; of record in IDS), and Nakauchi et al (of record), as applied to Claims 1, 3-5, 7-14, and 16 above, and in further view of Colamartino et al (available online May 2, 2019; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Neither Campana et al, Suri et al, Kamiya et al, Pan et al, nor Liu et al teach/disclose wherein the lentivirus is psuedotyped with a baboon envelope.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim 15, Colamartino et al is considered relevant prior art for having taught that NK-cell resistance to transduction is a major technical hurdle for developing NK-cell immunotherapy; however, by using baboon envelope pseudotyped lentiviral vectors, one is able to achieve a transduction rate of about 23% in freshly isolated human NK cells and about 84% in activated and expanded NK cells, superior results as compared to other pseudotyped lentiviral vectors. Our results suggest that BaEV-LVs may efficiently enable NK-cell biological studies and translation of NK-cell-based immunotherapy to the clinic (Abstract).
Colamartino et al taught wherein the NK cells were expanded in vitro with K562 feeder cells engineered to express mbIL-21 or mbIL-15 (e.g. pg 2, col. 1, Methods, Cells and Culture Condition).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first lentiviral vector, as disclosed by Suri et al, with a second lentiviral vector, i.e. a baboon pseudotyped lentiviral vector, as taught by Colamartino et al, in a method of transducing tumor infiltrating immune cells, e.g. natural killer cells, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first lentiviral vector with a second lentiviral vector, i.e. a baboon pseudotyped lentiviral vector, in a method of transducing tumor infiltrating immune cells, e.g. natural killer cells, because Colamartino et al taught that those of ordinary skill in the art previously recognized that NK cells were difficult to transduce, and solved the art-recognized problem, successfully reducing to practice the ability to achieve a transduction rate of about 23% in freshly isolated human NK cells and about 84% in activated and expanded NK cells, superior results as compared to other pseudotyped lentiviral vectors.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant iterates prior arguments.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner responded to prior arguments in prior Office Action.
Applicant does not contest the teachings of Colamartino et al as applied to the obviousness to substitute a first lentiviral vector, as disclosed by Suri et al, with a second lentiviral vector, i.e. a baboon pseudotyped lentiviral vector, as taught by Colamartino et al, in a method of transducing tumor infiltrating immune cells, e.g. natural killer cells, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first lentiviral vector with a second lentiviral vector, i.e. a baboon pseudotyped lentiviral vector, in a method of transducing tumor infiltrating immune cells, e.g. natural killer cells, because Colamartino et al taught that those of ordinary skill in the art previously recognized that NK cells were difficult to transduce, and solved the art-recognized problem, successfully reducing to practice the ability to achieve a transduction rate of about 23% in freshly isolated human NK cells and about 84% in activated and expanded NK cells, superior results as compared to other pseudotyped lentiviral vectors.
8. Claims 18-19 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Forget et al (2014; of record), in view of Liu et al (2013; of record; co-authors to Forget et al), Campana et al (of record in IDS), Kamiya et al (co-author to Campana et al; of record in IDS), Suri et al (of record in IDS), and Pan et al (2012; of record in IDS), as applied to Claims 1, 3-5, 7-14, and 16 above, and in further view of Elpek et al (U.S. 2021/0069248; priority to 62/898520, effectively filed September 10, 2019).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claim 19, Forget et al taught the use of the art-recognized mbIL-15 construct (e.g. pg 499, Methods), and thus is considered to reasonably fulfill:
i) a leader sequence comprising at least on nucleic acid sequence of SEQ ID NO:11, e.g. a, t, g, c, at, ag, ac, ta, tg, tc, ga, gt, gc, ca, ct, and/or cg, for example; and
ii) an IL-15 sequence comprising at least on nucleic acid sequence of SEQ ID NO:13, e.g. a, t, g, c, at, ag, ac, ta, tg, tc, ga, gt, gc, ca, ct, and/or cg, for example.
Campana et al disclosed an mbIL-15 construct comprising SEQ ID NO:1, said construct encoding a signal peptide, an IL-15, a hinge domain, and a transmembrane domain, wherein:
i) the signal peptide is encoded by a nucleotide sequence (lower line) that comprises at least one nucleotide sequence of SEQ ID NO:11/SEQ ID NO:31 (upper line), as shown below:
ATGGACATGCGGGTGCCTGCACAACTTCTGGGCCTGCTGTTGTTG
|||| | | | ||| | || || ||| ||| ||| ||
ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTG
ii) the IL-15 protein is encoded by a nucleotide sequence (lower line) that comprises at least one nucleotide sequence of SEQ ID NO:13/SEQ ID NO:31 (upper line), as shown below:
AATTGGGTAAATGTTATCAGTGATCTCAAGAAGATAGAGGATCTCATCCAGTCCATGCAT
|| ||||| ||||| || |||||| | || || || || ||||| || || || ||||||
AACTGGGTGAATGTAATAAGTGATTTGAAAAAAATTGAAGATCTTATTCAATCTATGCAT
ATTGATGCCACGCTGTACACAGAAAGCGATGTGCATCCTAGCTGTAAGGTGACAGCGATG
|||||||| || | || || ||||| ||||| || || || || || || ||||| |||
ATTGATGCTACTTTATATACGGAAAGTGATGTTCACCCCAGTTGCAAAGTAACAGCAATG
AAGTGTTTTCTTTTGGAGCTGCAGGTAATTAGTCTTGAGTCCGGCGATGCCAGCATTCAT
||||| ||||| |||||| | || || ||| ||||||||||| ||||| || ||||||
AAGTGCTTTCTCTTGGAGTTACAAGTTATTTCACTTGAGTCCGGAGATGCAAGTATTCAT
GATACCGTAGAAAACTTGATTATCCTGGCCAACAATTCTCTGTCCTCAAACGGAAACGTA
||||| |||||||| |||| ||||| || ||||| | |||| || || || || |||
GATACAGTAGAAAATCTGATCATCCTAGCAAACAACAGTTTGTCTTCTAATGGGAATGTA
ACCGAGAGCGGTTGTAAAGAATGTGAAGAACTGGAAGAAAAGAACATCAAGGAGTTTCTG
|| || || || ||||||||||| |||||||| ||||| || || || || ||| ||
ACAGAATCTGGATGCAAAGAATGTGAGGAACTGGAGGAAAAAAATATTAAAGAATTTTTG
CAATCATTCGTTCACATCGTACAAATGTTCATAAATACGTC
|| || || || || || ||||||||||| || || ||
CAGAGTTTTGTACATATTGTCCAAATGTTCATCAACACTTC;
iii) the linker domain is encoded by a nucleotide sequence (lower line) that comprises at least one nucleotide sequence of SEQ ID NO:15/SEQ ID NO:31 (upper line), as shown below:
GTGGAAGCGGTAGTGGGTCTGG
||| | ||| | || ||||
GTGTTGGTGGTCGCGGCGCTGG;
iv) the hinge domain is encoded by a nucleotide sequence (lower line) that comprises at least one nucleotide sequence of SEQ ID NO:17/SEQ ID NO:31 (upper line), as shown below:
ACAAGAG
||| |||
ACACGAG;
v) the transmembrane domain is encoded by a nucleotide sequence (lower line) that comprises at least one nucleotide sequence of SEQ ID NO:19/SEQ ID NO:31 (upper line), as shown below:
GCTTATCAGTGTAAACGGC
| |||||| | || ||
GGTTATCACCCTTTACTGC; and
vi) the intracellular domain is encoded by a nucleotide sequence (lower line) that comprises at least one nucleotide sequence of SEQ ID NO:21/SEQ ID NO:31 (upper line), as shown below:
TGAAAGACTGAGAAGGGAGA
||| | | | || |||||
TGATAACCAGTGACAGGAGA.
Suri et al disclosed an mbIL-15 construct comprising:
i) a signal peptide comprising at least a QLL motif (e.g. Table 5), as encoded by instant SEQ ID NO:11/SEQ ID NO:31, and thus is considered to reasonably comprise at least one nucleotide sequence of SEQ ID NO:11/SEQ ID NO:31;
ii) an IL-15 polypeptide comprising the same or substantially the same amino acid sequence (e.g. Table 5) encoded by instant SEQ ID NO:13/SEQ ID NO:31, and thus is considered to reasonably comprise at least one nucleotide sequence of SEQ ID NO:13/SEQ ID NO:31; and
iii) a GlySer linker sequence (e.g. Tables 6a-6b), as encoded by instant SEQ ID NO:15/SEQ ID NO:31, and thus is considered to reasonably comprise at least one nucleotide sequence of SEQ ID NO:15/SEQ ID NO:31.
Pan et al taught a mbIL-12 fusion protein comprising a B7.1 transmembrane and cytoplasmic domains, and thus is considered to reasonably comprise at least one nucleotide sequence of SEQ ID NO:19/SEQ ID NO:31 (B7-1 transmembrane domain), and at least one nucleotide sequence of SEQ ID NO:21/SEQ ID NO:31 (B7.1 intracellular domain).
The effective filing date of instant Claims 18-19 is January 19, 2021.
Instantly recited SEQ ID NO’s were effectively filed September 10, 2019 by Elpek et al.
With respect to Claims 18-19, Elpek et al disclosed an mbIL-15 construct (‘520, Table 4), wherein:
i) the signal peptide is encoded by a nucleotide sequence (lower line) that comprises at least one nucleotide sequence of SEQ ID NO:11/SEQ ID NO:31 (upper line), as shown below:
ATGGACATGCGGGTGCCTGCACAACTTCTGGGCCTGCTGTTGTTGTGGCTGTCTGGAGCC
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ATGGACATGCGGGTGCCTGCACAACTTCTGGGCCTGCTGTTGTTGTGGCTGTCTGGAGCC
CGGTGT
||||||
CGGTGT;
ii) the IL-15 protein is encoded by a nucleotide sequence (lower line) that comprises at least one nucleotide sequence of SEQ ID NO:13/SEQ ID NO:31 (upper line), as shown below:
AATTGGGTAAATGTTATCAGTGATCTCAAGAAGATAGAGGATCTCATCCAGTCCATGCAT
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AATTGGGTAAATGTTATCAGTGATCTCAAGAAGATAGAGGATCTCATCCAGTCCATGCAT
ATTGATGCCACGCTGTACACAGAAAGCGATGTGCATCCTAGCTGTAAGGTGACAGCGATG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ATTGATGCCACGCTGTACACAGAAAGCGATGTGCATCCTAGCTGTAAGGTGACAGCGATG
AAGTGTTTTCTTTTGGAGCTGCAGGTAATTAGTCTTGAGTCCGGCGATGCCAGCATTCAT
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AAGTGTTTTCTTTTGGAGCTGCAGGTAATTAGTCTTGAGTCCGGCGATGCCAGCATTCAT
GATACCGTAGAAAACTTGATTATCCTGGCCAACAATTCTCTGTCCTCAAACGGAAACGTA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GATACCGTAGAAAACTTGATTATCCTGGCCAACAATTCTCTGTCCTCAAACGGAAACGTA
ACCGAGAGCGGTTGTAAAGAATGTGAAGAACTGGAAGAAAAGAACATCAAGGAGTTTCTG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ACCGAGAGCGGTTGTAAAGAATGTGAAGAACTGGAAGAAAAGAACATCAAGGAGTTTCTG
CAATCATTCGTTCACATCGTACAAATGTTCATAAATACGTCA
||||||||||||||||||||||||||||||||||||||||||
CAATCATTCGTTCACATCGTACAAATGTTCATAAATACGTCA;
iii) the linker domain is encoded by a nucleotide sequence (lower line) that comprises at least one nucleotide sequence of SEQ ID NO:15/SEQ ID NO:31 (upper line), as shown below:
GGATCTGGTTCTGGTTCCGGAAGTGGATCTGGTTCAGGGTCCGGTAGTGGATCTGGGTCA
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
GGATCTGGTTCTGGTTCCGGAAGTGGATCTGGTTCAGGGTCCGGTAGTGGATCTGGGTCA
GGAAGTGGAAGCGGTAGTGGGTCTGGATCT
||||||||||||||||||||||||||||||
GGAAGTGGAAGCGGTAGTGGGTCTGGATCT;
iv) the hinge domain is encoded by a nucleotide sequence (lower line) that comprises at least one nucleotide sequence of SEQ ID NO:17/SEQ ID NO:31 (upper line), as shown below:
AAACAAGAGCACTTTCCTGATAAC
||||||||||||||||||||||||
AAACAAGAGCACTTTCCTGATAAC;
v) the transmembrane domain is encoded by a nucleotide sequence (lower line) that comprises at least one nucleotide sequence of SEQ ID NO:19/SEQ ID NO:31 (upper line), as shown below:
CTGTTGCCGAGCTGGGCGATTACGCTTATCAGTGTAAACGGCATCTTTGTAATATGCTGT
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CTGTTGCCGAGCTGGGCGATTACGCTTATCAGTGTAAACGGCATCTTTGTAATATGCTGT
CTG
|||
CTG; and
vi) the intracellular domain is encoded by a nucleotide sequence (lower line) that comprises at least one nucleotide sequence of SEQ ID NO:21/SEQ ID NO:31 (upper line), as shown below:
ACCTACTGCTTCGCACCAAGGTGCCGGGAGAGAAGGAGAAATGAAAGACTGAGAAGGGAG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ACCTACTGCTTCGCACCAAGGTGCCGGGAGAGAAGGAGAAATGAAAGACTGAGAAGGGAG
AGCGTGAGACCTGTG
|||||||||||||||
AGCGTGAGACCTGTG.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first nucleic acid construct encoding a mbIL-15/B7.1 fusion protein with a second nucleic acid construct encoding a mbIL-15/B7.1 fusion protein comprising one or more nucleotide sequences of SEQ ID NO’s:11, 13, 15, 17, 19, 21 and/or 31, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first nucleic acid construct encoding a mbIL-15/B7.1 fusion protein with a second nucleic acid construct encoding a mbIL-15/B7.1 fusion protein comprising one or more nucleotide sequences of SEQ ID NO’s:11, 13, 15, 17, 19, 21 and/or 31, because Elpek et al previously disclosed a nucleic acid construct encoding a mbIL-15/B7.1 fusion protein comprising one or more nucleotide sequences of SEQ ID NO’s:11, 13, 15, 17, 19, 21 and/or 31.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Elpeck et al do not cure the defect of Forget et al, Liu et al, Campana et al, Kamiya et al, Suri et al, and Pan et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Forget et al, Liu et al, Campana et al, Kamiya et al, Suri et al, and Pan et al are discussed in prior Office Actions, and incorporated herein. Applicant does not contest the teachings of Elpeck et al as applied to the obviousness to substitute a first nucleic acid construct encoding a mbIL-15/B7.1 fusion protein with a second nucleic acid construct encoding a mbIL-15/B7.1 fusion protein comprising one or more nucleotide sequences of SEQ ID NO’s:11, 13, 15, 17, 19, 21 and/or 31, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first nucleic acid construct encoding a mbIL-15/B7.1 fusion protein with a second nucleic acid construct encoding a mbIL-15/B7.1 fusion protein comprising one or more nucleotide sequences of SEQ ID NO’s:11, 13, 15, 17, 19, 21 and/or 31, because Elpek et al previously disclosed a nucleic acid construct encoding a mbIL-15/B7.1 fusion protein comprising one or more nucleotide sequences of SEQ ID NO’s:11, 13, 15, 17, 19, 21 and/or 31.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
9. Claims 1, 3-5, 7-14, 6, 16, and 18-19 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-21 of U.S. Patent No. 11,058,725 in view of Forget et al (2014; of record), in view of Liu et al (2013; of record; co-authors to Forget et al), Campana et al (of record in IDS), Kamiya et al (co-author to Campana et al; of record in IDS), Suri et al (of record in IDS), and Pan et al (2012; of record in IDS).
‘725 claims a method of making genetically engineered T cells, NK cells, or TIL cells comprising the step of transducing said cells with a viral vector encoding the polynucleotide of SEQ ID NO:25.
‘725 SEQ ID NO:25 is 100% identical to instantly recited SEQ ID NO:31 (search results available in SLIC).
Double-patenting rejections of claims to a method of use based on a claimed composition are proper. This rejection is necessitated by the decision of the Court of Appeals for the Federal Circuit in Pfizer Inc. v Teva pharmaceuticals USA Inc., 86 USPQ2d 1001, at page 1008 (March 2008), which indicates that there is no patentable distinction between claims to a product and a method of using that product disclosed in the specification of the application and that the preclusion of such a double patenting rejection under 35 USC 121 does not apply where the present application is other than a divisional application of the patent application containing such patentably indistinct claims.
‘725 discloses methods of using said genetically engineered T cells, NK cells, or TIL cells, e.g. immunotherapy methods for the treatment of cancer (e.g. Abstract; col. 1, lines 44-46; col. 3, lines 58-67; col. 4, lines 33-50).
‘725 does not claim wherein the genetically engineered T cells, NK cells, or TIL cells comprising the polynucleotide of SEQ ID NO:25 are expanded in vitro with 4-1BBL+, mbIL21+ K562 cells, and wherein the thus-expanded cells are administered to a cancer subject.
However, as discussed above, Forget et al is considered relevant prior art for having taught a method for treating a recipient subject having cancer, the method comprising the steps(s) of:
a) isolating a population of TILs comprising CD8+ and CD4+ T cells from a tumor (e.g. pg 449, col. 1, Methods, Initial propagation of TIL from human melanoma tumors);
c) expanding said population of TILs in vitro with K562 feeder cells that are engineered to:
i) express 41BB ligand (syn. CD137L); and
ii) express mbIL-15 (e.g. pg 449, col. 2, Rapid expansion of TIL by aAPC); and
d) administering said expanded, engineered population of TILs to a recipient subject (e.g. Title, “for Adoptive immunotherapy of melanoma”; pg 458, col. 1, “infusion product”; pg 458, col. 2, “clinical trial with evaluation of clinical responses and long-term persistence tracking of the infused cells”).
Forget et al taught that the TILs obtained from the tumor naturally comprise CD8+ T cells, CD4+ T cells, and NK cells (e.g. pg 451, col. 1).
Forget et al taught that expression of 41BBL on the surface of the K562 cells is known in the art to preferentially expand CD8+ T cells (e.g. pg 457, col. 2).
Forget et al taught that the use of genetically modified K562 cells is a practical and effective alternative to peripheral blood mononuclear feeder cells for expansion of tumor infiltrating lymphocytes (e.g. pg 457, col. 1).
Forget et al do not teach:
c) expanding said engineered population of TILs in vitro with K562 feeder cells that are engineered to:
i) express mbIL-21, and
ii) not express mbIL-15.
However, Liu et al is considered relevant prior art for having taught a method of treating a recipient subject having a cancer, the method comprising the steps of:
a) providing a population of natural killer (NK) cells;
c) culturing and expanding the NK cells in vitro with K562 feeder cells that are engineered to:
i) express 41BB ligand (e.g. pg 2133, col. 1, para 2);
ii) express mbIL-21 (e.g. pg 2133, col. 1, para 2); and
iii) do not express mbIL-15; and
d) administering to the recipient subject the expanded population of NK cells (e.g. pg 2134, col. 2, Materials and Methods, Murine model).
Liu et al taught the NK cells were cultured in the presence of exogenous IL-2 (e.g. pg 2133-2134, Materials and Methods, joining para), and that the recipient subject is administered IL-2.
Liu et al taught that the 41BB+, mbIL-21 K562 feeder cells stimulated NK cells to proliferate more than 2,000-fold in 14 days, and to become highly cytotoxic against tumor cells, and retain potent antitumor activity in vivo in subjects having a cancer, resulting in significantly decreased tumor growth and increased survival (e.g. pg 2133, col. 1, Translational Relevance).
Both Forget et al and Liu et al taught expansion in the presence of IL-2.
Neither Forget et al nor Liu et al teach:
b) engineering said isolated population of TILs to express mbIL-15;
c) expanding said engineered population of TILs in vitro, in the absence of IL-2, with the engineered K562 feeder cells; and
d) administering said expanded, engineered population of TILs to a recipient subject,
wherein the recipient subject is not administered IL-2.
However, Campana et al is considered relevant prior art for having disclosed a method of treating a recipient subject having a cancer comprising the steps of:
a) providing a population of natural killer (NK) cells (e.g., [0023], “NK cells refer to a type of cytotoxic lymphocyte”; [0036, 66]);
b) genetically modifying the NK cells to express mbIL-15 (e.g. [0036, 69], [0081] “transduce proliferating NK cells”, “the construct containing mbIL-15”; [0082], “after transduction with mbIL-15, IL-15 was expressed on the NK cell membrane”);
c) culturing and expanding the NK cells in vitro, in the absence of IL-2 (e.g. [0072], “without or with IL-2”; [0084], “[NK-mbIL-15] cultured them in the absence of IL-2”), whereby the expression of mbIL-15 by the NK cells could replace exogenous IL-2 in maintaining NK cell survival, thus providing mbIL-15 expressing NK cells having autonomous survival and expansion capacity [0083-84] and supported their autonomous expansion and extended survival in the absence of IL-2 [0099], including an example with K562 feeder cells that are engineered to:
i) not express mbIL-15 (e.g. Figure 11b, “K + NK92-mbIL-15”); and
d) administering to the recipient subject the expanded population of NK-mbIL-15 cells (e.g. [0088], Expansion and homing of mbIL-15 NK cells in vivo),
wherein the recipient subject is not administered IL-2 (e.g. [0088], Expansion and homing of mbIL-15 NK cells in vivo; Figure 3a, “no IL-2, mbIL-15”).
Campana et al disclosed that “expansion of human NK cells in large numbers ex vivo is feasible”; clinical-grade conditions is realistic and it is warranted by the superior expansion and cytotoxicity of mbIL-15-NK cells” [00102].
Campana et al disclosed that NK cells expressing mbIL-15 could expand in immunodeficient mice and infiltrated multiple tissues where they could be found in much larger numbers than mock-transduced cells. Expression of mbIL-15 did not impair the cytotoxic capacity of NK cells. In fact, in xenograft models, mbIL-15 NK cells exerted anticancer activity which was more powerful than that of mock-transduced cells, indicating that this approach might improve the antitumor capacity of NK cell infusions while averting the side effects of IL-2 administration [0099].
Campana et al disclosed that expression of a membrane-bound form of IL-15 in human NK cells supported their autonomous expansion and extended survival in the absence of IL-2. NK cells expressing mbIL-15 could be maintained in vitro for up to 2 months without exogenous IL-2 [0099].
Campana et al disclosed wherein the mbIL-15 NK cells “have increased release of lytic granules in the presence of target cells” in vitro, including tumor target cells, and exert anti-tumor activity in vivo [0010].
Campana et al disclosed that the primary mechanism of mbIL-15 stimulation was autocrine (e.g. [0093, 100]), and that survival of the mbIL-15 NK cells without IL-2 after 7 days in culture was vastly superior to that of mock-transduced NK cells (e.g. [0093]), the mbIL-15 NK cells expanded in vivo without IL-2, and had higher cytotoxicity against different tumor types in vitro and in vivo. Thus, mbIL-15 confers independent growth to NK cells and enhances their antitumor capacity (e.g. [00102]). Infusion of mbIL-15-NK cells would allow NK cell therapy without the potential adverse effects of cytokine administration (e.g. [0099]).
Similarly, Kamiya et al (co-authors to Campana et al) is considered relevant prior art for having disclosed a method of treating cancer in a subject, the method comprising the steps of:
a) obtaining NK cells from a subject (e.g. [0039], autologous or donor-derived allogeneic cells”);
b) engineering said NK cells to express membrane-bound IL-15 or membrane-bound IL12 [0026, 35], wherein the mbIL12 or mbIL-15 comprises CD8alpha transmembrane domain [0047, 49];
c) expanding the engineered NK cells in the presence of K562 feeder cells (e.g. [0021], “the engineered cells are derived from K562 cells”) engineered to express 41BB ligand, wherein the K562 cells may be further engineered to express membrane bound IL-21 (mbIL-21) and/or mbIL-15 (e.g. [0015], “one, two, or more of...”; [0018], “either in combination with [membrane-bound] IL-21, or alone”); and
d) administering to the recipient subject said expanded NK cells (e.g. [0039], “for genetic manipulation and infusion”; [0040], “for use in NK cell-based immunotherapy”).
Campana et al disclosed wherein the mbIIL-15 is operably linked to a CD8alpha transmembrane domain (e.g. [0081]), although other transmembrane domains may be used instead (e.g. [0033]).
Neither Campana et al nor Kamiya et al disclose:
b) the TIL is engineered to express mbIL-15 operably linked to a drug-responsive domain.
However, Suri et al is considered relevant prior art for having disclosed a method of treating a recipient subject having a cancer, the method comprising the step(s) of:
a) isolating TILs, including CD4+ and CD8+ TILs, from a subject, whereby said TILs are ssorted ex vivo [00262];
b) engineering said isolated TILs to express mbIL-15 (e.g. [00262, 266], wherein the mbIL-15 is operably linked to a drug responsive domain (DRD) (e.g. [00147]; Example 6, [00446], “DD regulated [membrane bound IL-15]”;
c) expanding said engineered TILs (e.g. [00241], “NK cells isolated…may be further expanded for adoptive immunotherapy”; [00266], “Immune cells can be isolated and expanded ex vivo using…methods known in the art”); and
d) administering to the recipient subject immune cells for adoptive cell transfer, e.g. used for cancer immunotherapy [0009, 257], said immune cells being natural killer cells or tumor infiltrating lymphocytes [0025], said immune cells being genetically modified to express membrane-bound IL-15 [0075], and wherein said immune cells may be expanded ex vivo [00241, 266].
Suri et al disclosed the immune cell may be a CD4+ T cell, a CD8+ T cell, an NK cell, or a tumor infiltrating cell [0025].
Suri et al disclosed that one embodiment of the invention is to use IL-21, as it, too, is a promising immunotherapeutic agent for cancer immunotherapy, shares the same common cytokine receptor subunit with IL-15, and can expand antigen-specific T cell numbers and rejuvenate multiple immune effector cells [00154].
Suri et al disclosed membrane-bound IL12 comprising a B7-1 transmembrane domain ([00146], citing Pan et al) or CD8alpha transmembrane domain (Table 4B).
Pan et al is considered relevant prior art for having taught a method of cancer immunotherapy, the method comprising the use of cells expressing membrane-bound IL12, wherein the mbIL12 comprises a B7-1 transmembrane domain.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify the ‘725 method of producing the genetically engineered T, NK, or TIL cells comprising the polynucleotide of SEQ ID NO:25 (syn. instant SEQ ID NO:31) to comprise the steps of expanding said genetically engineered T, NK, or TIL cells in the presence of K562 feeder cells engineered to express 41BB ligand and membrane bound IL-21 (mbIL-21), but not mbIL-15, and in the absence of exogenous IL-2, prior to administering said expanded genetically engineered T, NK, or TIL cells to a cancer subject, the artisan being motivated to do so with a reasonable expectation of success because:
i) Forget et al taught that “Our results show that artificial antigen-presenting cells (aAPC), developed from K562 cells expressing 4-1BBL and mbIL15, may be used in lieu of PBMC to support the production of T cells from tumor-infiltrating lymphocytes…, and thus, we plan on retiring the traditional PBMC feeders from our approach to manufacturing clinical-grade T cells” (e.g. pg 449, col. 1);
ii) Liu et al successfully demonstrated that primary human NK cells may be expanded in the presence of K562 feeder cells that have been genetically modified to express mbIL-21 and 41BBL, and do not express mbIL-15, whereby the 41BB+, mbIL-21 K562 feeder cells stimulated NK cells to proliferate more than 2,000-fold in 14 days, and to become highly cytotoxic against tumor cells, and retain potent antitumor activity in vivo in subjects having a cancer, resulting in significantly decreased tumor growth and increased survival (e.g. pg 2133, col. 1, Translational Relevance);
iii) Campana et al disclosed that the primary mechanism of mbIL-15 stimulation was autocrine, and successfully demonstrated culturing the mbIL-15 NK cells in the presence of K562 cells that do not express mbIL-15 (e.g. Figure 11b), and in the absence of IL-2, as the mbIL-15 NK cells no longer need IL-2 to proliferate;
iv) Kamiya et al disclosed, for example, wherein NK cells are expanded in the presence of K562 feeder cells engineered to express 41BB ligand, wherein the K562 cells may be further engineered to express membrane bound IL-21 (mbIL-21) and/or mbIL-15 (e.g. [0015], “one, two, or more of...”; [0018], “either in combination with [membrane-bound] IL-21, or alone”), and wherein the expanding step does not require adding IL-2 to the media, such being optional; and
v) Suri et al disclosed that one embodiment of the invention is to use IL-21, as it, too, is a promising immunotherapeutic agent for cancer immunotherapy, shares the same common cytokine receptor subunit with IL-15, and can expand antigen-specific T cell numbers, including CD8+ T cells, and rejuvenate multiple immune effector cells [00154], whereby the immune cell population may be expanded in the presence of feeder cells genetically modified to express mbIL-21 [00266].
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
Thus, instant claims are considered to be an obvious variant of the ‘725 patented claims.
Response to Arguments
Applicant argues that ‘725 does not disclose or suggest the culturing steps of the instant claims.
Applicant’s argument(s) has been fully considered, but is not persuasive.In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
‘725 claims a method of making genetically engineered T cells, NK cells, or TIL cells comprising the step of transducing said cells with a viral vector encoding the polynucleotide of SEQ ID NO:25.
‘725 SEQ ID NO:25 is 100% identical to instantly recited SEQ ID NO:31 (search results available in SLIC).
Double-patenting rejections of claims to a method of use based on a claimed composition are proper. This rejection is necessitated by the decision of the Court of Appeals for the Federal Circuit in Pfizer Inc. v Teva pharmaceuticals USA Inc., 86 USPQ2d 1001, at page 1008 (March 2008), which indicates that there is no patentable distinction between claims to a product and a method of using that product disclosed in the specification of the application and that the preclusion of such a double patenting rejection under 35 USC 121 does not apply where the present application is other than a divisional application of the patent application containing such patentably indistinct claims.
‘725 discloses methods of using said genetically engineered T cells, NK cells, or TIL cells, e.g. immunotherapy methods for the treatment of cancer (e.g. Abstract; col. 1, lines 44-46; col. 3, lines 58-67; col. 4, lines 33-50).
‘725 does not claim wherein the genetically engineered T cells, NK cells, or TIL cells comprising the polynucleotide of SEQ ID NO:25 are expanded in vitro with 4-1BBL+, mbIL21+ K562 cells, and wherein the thus-expanded cells are administered to a cancer subject.
However, as discussed above, the other cited references render the presently recited expansion culture step obvious.
Thus, instant claims are considered to be an obvious variant of the ‘725 patented claims.
10. Claims 14-15 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-21 of U.S. Patent No. 11,058,725 in view of Forget et al (2014; of record), in view of Liu et al (2013; of record; co-authors to Forget et al), Campana et al (of record in IDS), Kamiya et al (co-author to Campana et al; of record in IDS), Suri et al (of record in IDS), and Pan et al (2012; of record in IDS), as applied to Claims 1, 3-5, 7-14, 6, 16, and 18-19 above, and in further view of Colamartino et al (available online May 2, 2019; of record).
Neither ‘725, Campana et al, Suri et al, Kamiya et al, Pan et al, nor Liu et al claim/teach/disclose wherein the lentivirus is psuedotyped with a baboon envelope.
However, prior to the effective filing date of the instantly claimed invention, Colamartino et al is considered relevant prior art for having taught that NK-cell resistance to transduction is a major technical hurdle for developing NK-cell immunotherapy; however, by using baboon envelope pseudotyped lentiviral vectors, one is able to achieve a transduction rate of about 23% in freshly isolated human NK cells and about 84% in activated and expanded NK cells, superior results as compared to other pseudotyped lentiviral vectors. Our results suggest that BaEV-LVs may efficiently enable NK-cell biological studies and translation of NK-cell-based immunotherapy to the clinic (Abstract).
Colamartino et al taught wherein the NK cells were expanded in vitro with K562 feeder cells engineered to express mbIL-21 or mbIL-15 (e.g. pg 2, col. 1, Methods, Cells and Culture Condition).
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first lentiviral vector, as disclosed by Suri et al, with a second lentiviral vector, i.e. a baboon pseudotyped lentiviral vector, as taught by Colamartino et al, in a method of transducing tumor infiltrating immune cells, e.g. natural killer cells, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first lentiviral vector with a second lentiviral vector, i.e. a baboon pseudotyped lentiviral vector, in a method of transducing tumor infiltrating immune cells, e.g. natural killer cells, because Colamartino et al taught that those of ordinary skill in the art previously recognized that NK cells were difficult to transduce, and solved the art-recognized problem, successfully reducing to practice the ability to achieve a transduction rate of about 23% in freshly isolated human NK cells and about 84% in activated and expanded NK cells, superior results as compared to other pseudotyped lentiviral vectors.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Thus, instant claims are considered to be an obvious variant of the ‘725 patented claims.
Conclusion
11. No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
KEVIN K. HILL
Examiner
Art Unit 1638
/KEVIN K HILL/Primary Examiner, Art Unit 1638