Prosecution Insights
Last updated: April 19, 2026
Application No. 18/504,781

Composition Comprising Antisense Oligonucleotide and Use Thereof for Treatment of Duchenne Muscular Dystrophy

Final Rejection §103§DP
Filed
Nov 08, 2023
Examiner
ARIETI, RUTH SOPHIA
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Nippon Shinyaku Co. Ltd.
OA Round
2 (Final)
46%
Grant Probability
Moderate
3-4
OA Rounds
2y 7m
To Grant
99%
With Interview

Examiner Intelligence

Grants 46% of resolved cases
46%
Career Allow Rate
37 granted / 81 resolved
-14.3% vs TC avg
Strong +73% interview lift
Without
With
+72.7%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
37 currently pending
Career history
118
Total Applications
across all art units

Statute-Specific Performance

§101
5.1%
-34.9% vs TC avg
§103
30.5%
-9.5% vs TC avg
§102
12.3%
-27.7% vs TC avg
§112
29.2%
-10.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 81 resolved cases

Office Action

§103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 23-24 and 26-31 are pending. Status of the Application Applicant’s response and amendment filed 23 June 2025 are acknowledged and entered. Applicant has amended Claims 23, 26-27, and 30. Applicant has cancelled Claim 25. Response to Amendment The claim objections are maintained. The 103 rejections are maintained. Some NSDP rejections are withdrawn and some are maintained. Applicant has amended the claims to overcome the 112(b) rejections; the 112(b) rejections are withdrawn. Claims 23-24 and 26-31 are examined. Arguments applicable to newly applied rejections to amended or newly presented claims are addressed below. Arguments that are no longer relevant are not addressed. Rejections not reiterated here are withdrawn. Information Disclosure Statement The IDS has been considered (see signed IDS). Specification The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. The instance occurs in ¶121. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. Claim Objections Claim 23 is objected to because of the following informalities: Claim 23 should recite the SEQ ID NO and structure that correspond to Viltolarsen. Appropriate correction is required. Claim Interpretation The claims do not recite the SEQ ID NO that corresponds to the term Viltolarsen which is recited in Claim 23. In the interest of compact prosecution “Viltolarsen” is interpreted as a phosphorodiamidate morpholino oligomer (PMO) ASO consisting of SEQ ID NO 3. The claims are interpreted that way because the Spec. discloses (¶51) that NS-065/NCNP-01 (Viltolarsen) is a compound disclosed as "PMO No. 8" in U.S. Patent No. 9,079,934 B2. The base sequence of NS-065/NCNP-01 (Viltolarsen) is as set forth in SEQ ID NO: 35 (5'-CCTCCGGTTC TGAAGGTGTTC-3'; SEQ ID NO: 3 in the present 10 description) and the 5'-terminus thereof is -OH. Claim 23 recites a pharmaceutical composition for treating a human patient with DMD… A pharmaceutical composition for treating a human patient with DMD is interpreted as the compound’s intended use. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 23-24, and 26-31are rejected under 35 U.S.C. 103 as being unpatentable over US Patent No. 9,079,934 (issued 14 July 2015, “US934”, of record on IDS filed 22 January 2024) in view of Sarepta (2016. EXONDYS 51 Full Prescribing Information Package Insert, “Sarepta”). This rejection is maintained but updated in response to the claim amendments. US934 teaches antisense oligos (ASO) for skipping exon 53 in the human dystrophin gene, and pharmaceutical compositions thereof. US934 teaches (Col 9 L50-65) their ASO consists of a nt sequence complementary to the 36th to the 56th nts from the 5’end of exon 53 in the human dystrophin gene. That § teaches those nts correspond to SEQ ID NO 35. US934 SEQ ID NO 35 is 100% identical to claimed SEQ ID NO 3 which is the nucleobase sequence of Viltolarsen (see above §Claim interpretation). That is shown in the following sequence alignment: RESULT 1 NASEQ2_03132025_173712 Query Match 100.0%; Score 21; DB 1; Length 21; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CCTCCGGTTCTGAAGGTGTTC 21 ||||||||||||||||||||| Db 1 CCTCCGGTTCTGAAGGTGTTC 21 Furthermore, US934 teaches (Col 15 L1-15) the following PMO structure: PNG media_image1.png 125 323 media_image1.png Greyscale PNG media_image1.png 125 323 media_image1.png Greyscale In addition, US934 teaches (Col 43 L55-60) their experimental results showed that the sequences with —OH group at the 5' end provide a higher skipping efficiency even in the same sequences. Altogether US934 teaches the compound that is called Viltolarsen, and US934 (Col 84, point 6) claims that exact compound. US934 teaches (§starts at Col 25) about preparing the ASO in a pharmaceutical composition for causing exon 53 skipping to treat DMD patients, which indicates treating human patients was contemplated. US934 teaches (Col 25 L10-40) the ASO can be a pharmaceutically acceptable salt or hydrate, including citrate and phosphate. In the same § about pharmaceutical compositions, US934 teaches (Col 26 L45-60) an aqueous solvent can be added to the ASO and the aqueous solvent can be distilled water: An aqueous solvent that can be used in adding the oligomer of the present invention is not particularly limited as far as it is pharmaceutically acceptable, and examples are injectable water or injectable distilled water, electrolyte fluid such as physiological saline, etc., and sugar fluid such as glucose fluid, maltose fluid, etc. A person skilled in the art can appropriately choose conditions for pH and temperature for such matter. Therefore US934 teaches preparing the ASO in the pharmaceutically acceptable carrier that is specifically distilled water. Regarding pH, the preceding § (cited) teaches a person skilled in the art can choose appropriate pH for the pharmaceutical composition: (Col 26 L59-60) A person skilled in the art can appropriately choose conditions for pH and temperature for such matter. US934 teaches (Col 10-11 L66-10) binding of the ASO to a transcript of the human dystrophin gene occurs under physiological conditions which is preferably pH 7.4; that disclosure clearly indicates that pH 7.4 is a physiological pH so an artisan would readily understand that physiological saline has a physiological pH. Therefore, US934 teaches all the limitations of Claims 23-24 and 27 besides for the ASO in a concentration of 50 mg/mL: the pharmaceutical composition for treating a human patient with DMD comprising an ASO or a pharmaceutically acceptable salt or hydrate thereof, wherein the ASO is Viltolarsen (which corresponds to a sequence consisting of nt at positions 36-56 from the 5’terminus of exon 53 in human dystrophin, i.e., US934’s SEQ ID NO 35) in an aqueous solution at pH 7.4. Regarding Claims 23-24 and 26-27: The pharmaceutical composition that comprises the ASO and distilled water would contain no phosphate buffer and no citrate buffer. US934 was clearly aware of the existence of different buffers and mentions (Col 30 L1) a citrate buffer and (Col 33 L3) a phosphate buffer but still allowed for a pharmaceutical composition comprising only the ASO and distilled water. Therefore US934 teaches the limitations of Claims 3-24 and 26-27. Alternatively, those claim limitations would have been obvious in view of the US934 teaching which allows for a composition of the ASO in an aqueous solvent that is distilled water. Regarding Claims 28-30: The same § of US934 teaches (Col 26 L34-48) pharmaceutically acceptable additives may be formulated in the pharmaceutical composition, and those include isotonizing agents (e.g., sodium chloride, glucose, maltose, lactose, sucrose, trehalose), and pH controlling agents (e.g., hydrochloric acid, sulfuric acid, … acetic acid, sodium hydroxide, potassium hydroxide and triethanolamine). The US934 term “isotonizing agents” and instantly claimed term “tonicity agent” are simply two different terms used to describe the same concept and an artisan would have readily recognized that glucose, maltose, lactose, sucrose, and trehalose can be used to control tonicity. Similarly, the US934 term “pH controlling agent” and the instantly claimed term “pH adjuster” are simply two different terms used to describe the same concept and an artisan would have readily recognized that hydrochloric acid and sodium hydroxide can be used to control pH. It was previously discussed that US934 teaches (Col 26 L53-57) preparing the pharmaceutical composition in an aqueous solvent that can be water. Therefore US934 teaches the limitations of Claims 28-30. Regarding Claim 31, which depends from Claim 28: As discussed above, US934 teaches (Col 26 L45-60) a pharmaceutical composition that comprises the ASO in an aqueous solvent that can be injectable water or injectable distilled water. Therefore US934 teaches all the limitations of Claim 31. Altogether, US934 teaches all the limitations of Claims 23 and 26-31 besides for the ASO in a concentration of 50 mg/mL. Using any of the aqueous solvents, tonicity agents, or pH controlling agents taught in US934 would have been an obvious part of routine optimization for preparing a pharmaceutical composition comprising the ASO. Using any of the pHs within the range taught in US934 would have been an obvious part of routine optimization for preparing a pharmaceutical composition comprising the ASO. US934 does not teach that the ASO is in the pharmaceutical composition at a concentration of 50 mg/mL (Claim 23 and claims depending therefrom). US934 does not explicitly teach that the pharmaceutical composition comprises sodium chloride (NaCl) in a concentration of 8 mg/mL inclusive to 10 mg/mL inclusive (Claim 24). However, Sarepta, drawn to the package insert for a different exon skipping ASO drug, EXONDYS 51, teaches (p. 1 §Dosage forms and strengths and §3 Dosage forms and strengths) the EXONDYS 51 ASO comes in a 50 mg/mL solution in a single-dose vial. Sarepta additionally teaches (§11 Description ¶1) EXONDYS 51 is formulated as an isotonic, phosphate buffered saline solution with… a pH of 7.5. Therefore Sarepta teaches that pH 7.5 is a suitable pH for a pharmaceutical composition. Regarding Claim 24: Sarepta teaches (§2.2 Preparation Instructions ¶e) the withdrawn EXONDYS 51 is diluted in a 0.9% NaCl injection to make a total volume of 100 mL. An artisan would readily recognize that 0.9% NaCl solution is 0.9 g/100 mL and that equals 900 mg/100 mL which equals 9 mg/mL. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the pharmaceutical composition comprising Viltolarsen and the instructions for preparing it in a pharmaceutical composition of US934 with the 50 mg/mL concentration of Sarepta for the benefit of preparing a similar exon skipping ASO at a concentration known to be effective for preparing ASOs and packaging them for patients to administer. One would have been motivated to do so with a reasonable expectation of success because both Sarepta’s EXONDYS 51 and Viltolarsen are ASO drugs for exon skipping that are used to treat the same disease and because artisans expect to modify a drug’s concentration or dose to maximize therapeutic effects and doing so is part of routine optimization. Furthermore, an artisan seeking to optimize the concentration of ASO in a pharmaceutical composition would have started with what was known in the art to be effective. Since Sarepta’s 50 mg/mL was already being used as the concentration for an FDA-approved exon skipping ASO for treating DMD, it would have been obvious to start by formulating Viltolarsen at the same 50 mg/mL concentration. Preparing a composition comprising the oligo and the aqueous solvent distilled water (as disclosed by US934 at Col 26 L45-60 would have produced a pharmaceutical composition comprising the oligo and no buffer at all, including without any phosphate buffer. Modifying the pharmaceutical composition comprising Viltolarsen and the instructions for preparing it in a pharmaceutical composition of US934 with the 50 mg/mL concentration of Sarepta would have produced the limitations of Claims 23, 26-27, and 29-31. It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the pharmaceutical composition comprising Viltolarsen at a 50 mg/mL concentration and the instructions for preparing it in a pharmaceutical composition of US934 and Sarepta with the 0.9% NaCl concentration of Sarepta for the benefit of easily injecting the composition to a patient. As discussed above, a 0.9% NaCl solution is equivalent to a 9 mg/mL concentration. One would have been motivated to do so with a reasonable expectation of success because Sarepta teaches mixing their ASO with 0.9% NaCl solution to make it injectable and because US934 teaches (Col 25 L45-56) their ASO can be administered in various ways, including via injection; (Col 26 L45-60) formulating their composition for injection, and (Col 27 L10-20) reconstituting their ASOs in water, saline, or other infusion fluids. An artisan would have used Sarepta’s method of injection at a 9 mg/mL concentration because it was proven effective for injecting an FDA-approved exon skipping ASO for treating DMD. Modifying the pharmaceutical composition comprising Viltolarsen at a 50 mg/mL concentration and the instructions for preparing it in a pharmaceutical composition of US934 and Sarepta with the 0.9% NaCl concentration of Sarepta would have produced the limitations of Claim 24. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 23-24 and 26-31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-7 of U.S. Patent No. 9079934 (“US934”, of record on IDS filed 22 January 2024) in view of United States Patent Application Publication No. 2013/0211062 (published 15 August 2013, “App062”) and Sarepta (2016. EXONDYS 51 Full Prescribing Information Package Insert, “Sarepta”). This rejection is maintained but updated in response to the claim amendments. The instant claims are drawn to a pharmaceutical composition for treating a human patient with Duchenne muscular dystrophy (DMD) comprising an ASO, a pharmaceutically acceptable salt thereof, or a hydrate thereof in a concentration of 50 mg/ml, wherein the ASO is Viltolarsen, which consists of a sequence that corresponds to a sequence complementary to nts 36-56 from the 5’terminus of exon 53 of wild-type human dystrophin gene, and wherein the pharmaceutical composition is an aqueous solution having a pH between 7.0 and 7.5. The claims are directed to various modifications to the composition of the pharmaceutical composition, including an NaCl concentration between 8-10 mg/mL, the composition lacking a phosphate or citrate buffer or any buffer; and wherein the composition comprises certain tonicity or pH adjusting agents, or wherein the solvent is water. As discussed in §Claim interpretation, Viltolarsen is interpreted as a phosphorodiamidate morpholino oligomer (PMO) ASO consisting of SEQ ID NO 3 and wherein the 5'-terminus thereof is -OH. The patented US934 claims are directed to an ASO compound that causes skipping of the 53rd exon in the human dystrophin gene, wherein the ASO consists of SEQ ID NO 35, a pharmaceutically acceptable salt or hydrate thereof, is a PMO ASO, and has -OH at the 5’end, and a pharmaceutical composition comprising as an active ingredient the ASO. Both claim sets are directed to a PMO ASO that have the exact same nt sequence and are Viltolarsen. The patented US934 claims do not recite the specific features of the instantly claimed pharmaceutical composition: that the pharmaceutical composition is an aqueous solution having a pH between 7.0 and 7.5, or that it includes an NaCl concentration between 8-10 mg/mL, the composition lacking a phosphate or citrate buffer or any buffer; and wherein the composition comprises certain tonicity or pH adjusting agents, or wherein the solvent is water. However, App062, drawn to the exact subject matter of US934, teaches most of those features: (¶76) the pH of 7.4, (¶171) the aqueous solution comprised of injectable distilled water, (¶170) the isotonizing or pH controlling agents (which are simply different words to describe the same concept as a tonicity agent or pH adjuster). App062 was clearly aware of the existence of different buffers and mentions (¶187) a citrate buffer and (¶197) a phosphate buffer but still allowed for a pharmaceutical composition comprising just the ASO and distilled water (therefore lacking any buffer). Using any of the pHs within the range taught in App062 would have been an obvious part of routine optimization for preparing a pharmaceutical composition comprising the ASO. The US934 claims and App062 do not teach formulating the pharmaceutical composition at a 50 mg/mL concentration or that the composition comprises NaCl in a concentration between 8-10 mg/mL. However, Sarepta, drawn to the package insert for a different exon skipping drug, EXONDYS 51, teaches (p. 1 §Dosage forms and strengths and §3 Dosage forms and strengths) the EXONDYS 51 ASO comes in a 50 mg/mL solution in a single-dose vial. Sarepta additionally teaches (§11 Description ¶1) EXONDYS 51 is formulated as an isotonic, phosphate buffered saline solution with… a pH of 7.5. Therefore Sarepta teaches that pH 7.5 is a suitable pH for a pharmaceutical composition. Regarding instant Claim 24: Sarepta teaches (§2.2 Preparation Instructions ¶e) the withdrawn EXONDYS 51 is diluted in a 0.9% NaCl injection to make a total volume of 100 mL. An artisan would readily recognize that 0.9% NaCl solution is 0.9 g/100 mL and that equals 900 mg/100 mL which equals 9 mg/mL. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the pharmaceutical composition comprising the ASO of the US934 claims at 50 mg/mL concentration in an aqueous solution with different tonicity agents, pH conditions, pH adjusters or without any buffer, and NaCl concentrations and optimize these conditions following the instructions for preparing a pharmaceutical composition of App062 and Sarepta for the benefit of preparing a similar exon skipping ASO at a concentration known to be effective for preparing ASOs and packaging them for patients to administer. One would have been motivated to do so with a reasonable expectation of success because both Sarepta’s EXONDYS 51 and the ASO of the US934 claims are ASO drugs for exon skipping that are used to treat the same disease and because artisans expect to modify a drug’s concentration or dose to maximize therapeutic effects and doing so is part of routine optimization. Furthermore, an artisan seeking to optimize the concentration of ASO in a pharmaceutical composition would have started with what was known in the art to be effective. Since Sarepta’s 50 mg/mL was already being used as the concentration for an FDA-approved exon skipping ASO for treating DMD, it would have been obvious to start by formulating Viltolarsen at the same 50 mg/mL concentration. Furthermore, the US934 claims are silent to any buffer indicating that it is not required for their pharmaceutical composition. Modifying the ASO of the US934 claims with the instructions for preparing it in a pharmaceutical composition of App062 with the 50 mg/mL concentration of Sarepta would have produced a pharmaceutical composition with all the limitations of Claims 23-24 and 26-31. Claims 23-24 and 26-31 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-8 of U.S. Patent No. 10870676 (“US676”) in view of United States Patent Application Publication No. 2013/0211062 (published 15 August 2013, “App062”) and Sarepta (2016. EXONDYS 51 Full Prescribing Information Package Insert, “Sarepta”). This rejection is maintained but updated in response to the claim amendments. The instant claims are drawn to a pharmaceutical composition for treating a human patient with Duchenne muscular dystrophy (DMD) comprising an ASO, a pharmaceutically acceptable salt thereof, or a hydrate thereof in a concentration of 50 mg/ml, wherein the ASO is Viltolarsen, which consists of a sequence that corresponds to a sequence complementary to nts 36-56 from the 5’terminus of exon 53 of wild-type human dystrophin gene, and wherein the pharmaceutical composition is an aqueous solution having a pH between 7.0 and 7.5. The claims are directed to various modifications to the composition of the pharmaceutical composition, including an NaCl concentration between 8-10 mg/mL, the composition lacking a phosphate or citrate buffer or any buffer; and wherein the composition comprises certain tonicity or pH adjusting agents, or wherein the solvent is water. As discussed in §Claim interpretation, Viltolarsen is interpreted as a phosphorodiamidate morpholino oligomer (PMO) ASO consisting of SEQ ID NO 3 and wherein the 5'-terminus thereof is -OH. The patented US676 claims are directed to a method of using an ASO compound that causes skipping of the 53rd exon in the human dystrophin gene to treat DMD, or a pharmaceutically composition comprising as an active ingredient the ASO, including administering the ASO via intravenous injection, wherein the ASO consists of the nts at positions 36-56 from the 5’end of exon 53 in human DMD, which corresponds to their SEQ ID NO 1, to a pharmaceutically acceptable salt or hydrate thereof, wherein the ASO is a PMO ASO, and can have -OH at the 5’end. Both claim sets are directed to a PMO ASO that have the exact same nt sequence and are, therefore, Viltolarsen. The patented US676 claims do not recite the specific features of the instantly claimed pharmaceutical composition: that the pharmaceutical composition is an aqueous solution having a pH between 7.0 and 7.5, or that it can include an NaCl concentration between 8-10 mg/mL, the composition lacking a phosphate or citrate buffer or any buffer; and wherein the composition can comprise certain tonicity or pH adjusting agents, or wherein the solvent can be water. However, App062, drawn to very similar subject matter as US676 , teaches most of those features: (¶76) the pH of 7.4, (¶171) the aqueous solution comprised of injectable distilled water, (¶170) the isotonizing or pH controlling agents (which are simply different words to describe the same concept as a tonicity agent or pH adjuster). App062 was clearly aware of the existence of different buffers and mentions (¶187) a citrate buffer and (¶197) a phosphate buffer but still allowed for a pharmaceutical composition comprising just the ASO and distilled water (therefore lacking any buffer). Using any of the pHs within the range taught in App062 would have been an obvious part of routine optimization for preparing a pharmaceutical composition comprising the ASO. The US676 claims and App062 do not teach formulating the pharmaceutical composition at a 50 mg/mL concentration or that the composition comprises NaCl in a concentration between 8-10 mg/mL. However, Sarepta, drawn to the package insert for a different exon skipping drug, EXONDYS 51, which is also intravenously injected, teaches (p. 1 §Dosage forms and strengths and §3 Dosage forms and strengths) the EXONDYS 51 ASO comes in a 50 mg/mL solution in a single-dose vial. Sarepta additionally teaches (§11 Description ¶1) EXONDYS 51 is formulated as an isotonic, phosphate buffered saline solution with… a pH of 7.5. Therefore Sarepta teaches that pH 7.5 is a suitable pH for a pharmaceutical composition. Regarding instant Claim 24: Sarepta teaches (§2.2 Preparation Instructions ¶e) the withdrawn EXONDYS 51 is diluted in a 0.9% NaCl injection to make a total volume of 100 mL. An artisan would readily recognize that 0.9% NaCl solution is 0.9 g/100 mL and that equals 900 mg/100 mL which equals 9 mg/mL. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the pharmaceutical composition comprising the ASO of the patented US676 claims at 50 mg/mL concentration in an aqueous solution with different tonicity agents, pH conditions, pH adjusters or without any buffer, and NaCl concentrations, and optimize these conditions following the instructions for preparing a pharmaceutical composition of App062 and Sarepta for the benefit of preparing a similar exon skipping ASO at a concentration known to be effective for preparing ASOs and packaging them for patients to administer. One would have been motivated to do so with a reasonable expectation of success because both Sarepta’s EXONDYS 51 and the ASO of the patented US676 claims are ASO drugs for exon skipping that are used to treat the same disease and because artisans expect to modify a drug’s concentration or dose to maximize therapeutic effects and doing so is part of routine optimization. Furthermore, an artisan seeking to optimize the concentration of ASO in a pharmaceutical composition would have started with what was known in the art to be effective. Since Sarepta’s 50 mg/mL was already being used as the concentration for an FDA-approved exon skipping ASO for treating DMD, it would have been obvious to start by formulating Viltolarsen at the same 50 mg/mL concentration. Furthermore, the US676 claims are silent to any buffer indicating that it is not required for their pharmaceutical composition or methods. Modifying the ASO of the US676 claims with the instructions for preparing it in a pharmaceutical composition of App062 with the 50 mg/mL concentration of Sarepta would have produced a pharmaceutical composition with all the limitations of Claims 23-24 and 26-31. Altogether, it would not be possible to use the claimed pharmaceutical composition without using a method that would have been obvious in view of the US676 claims, App062, and Sarepta. Claims 23-24 and 26-31 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-8 and 12-14 of copending Application No. 18774442 (Pub. No. US 20250042933, “App442”) in view of United States Patent Application Publication No. 2013/0211062 (published 15 August 2013, “App062”) and Sarepta (2016. EXONDYS 51 Full Prescribing Information Package Insert, “Sarepta”). This rejection is maintained but updated in response to the claim amendments. The instant claims are drawn to a pharmaceutical composition for treating a human patient with Duchenne muscular dystrophy (DMD) comprising an ASO, a pharmaceutically acceptable salt thereof, or a hydrate thereof in a concentration of 50 mg/ml, wherein the ASO is Viltolarsen, which consists of a sequence that corresponds to a sequence complementary to nts 36-56 from the 5’terminus of exon 53 of wild-type human dystrophin gene, and wherein the pharmaceutical composition is an aqueous solution having a pH between 7.0 and 7.5. The claims are directed to various modifications to the composition of the pharmaceutical composition, including an NaCl concentration between 8-10 mg/mL, the composition lacking a phosphate or citrate buffer or any buffer; and wherein the composition comprises certain tonicity or pH adjusting agents, or wherein the solvent is water. As discussed in §Claim interpretation, Viltolarsen is interpreted as a phosphorodiamidate morpholino oligomer (PMO) ASO consisting of SEQ ID NO 3 and wherein the 5'-terminus thereof is -OH. The copending App442 claims are directed to an ASO compound that causes skipping of the 53rd exon in the human dystrophin gene, wherein the ASO consists of a nt sequence complementary to the 36th to 56th nts from the 5’end of exon 53 in the human dystrophin gene, wherein the ASO can be a PMO ASO; wherein the ASO can consist of SEQ ID NO 35, and wherein it can have -OH at the 5’end, and a pharmaceutical composition comprising as an active ingredient the ASO. Both claim sets are directed to a PMO ASO that have the exact same nt sequence and are Viltolarsen. The copending App442 claims do not recite the specific features of the instantly claimed pharmaceutical composition: that the pharmaceutical composition is an aqueous solution having a pH between 7.0 and 7.5, or that it includes an NaCl concentration between 8-10 mg/mL, the composition lacking a phosphate or citrate buffer or any buffer; and wherein the composition comprises certain tonicity or pH adjusting agents, or wherein the solvent is water. However, App062, drawn to ASO compounds for exon skipping, whose sequence is complementary to nts 36-56 from the 5’end of exon 53 of the human dystrophin gene, teaches most of those features: (¶76) the pH of 7.4, (¶171) the aqueous solution comprised of injectable distilled water, (¶170) the isotonizing or pH controlling agents (which are simply different words to describe the same concept as a tonicity agent or pH adjuster). App062 was clearly aware of the existence of different buffers and mentions (¶187) a citrate buffer and (¶197) a phosphate buffer but still allowed for a pharmaceutical composition comprising just the ASO and distilled water (therefore lacking any buffer). Using any of the pHs within the range taught in App062 would have been an obvious part of routine optimization for preparing a pharmaceutical composition comprising the ASO. The copending App442 claims and App062 do not teach formulating the pharmaceutical composition at a 50 mg/mL concentration or that the composition can comprise NaCl in a concentration between 8-10 mg/mL. However, Sarepta, drawn to the package insert for a different exon skipping drug, EXONDYS 51, teaches (p. 1 §Dosage forms and strengths and §3 Dosage forms and strengths) the EXONDYS 51 ASO comes in a 50 mg/mL solution in a single-dose vial. Sarepta additionally teaches (§11 Description ¶1) EXONDYS 51 is formulated as an isotonic, phosphate buffered saline solution with… a pH of 7.5. Therefore Sarepta teaches that pH 7.5 is a suitable pH for a pharmaceutical composition. Regarding instant Claim 24: Sarepta teaches (§2.2 Preparation Instructions ¶e) the withdrawn EXONDYS 51 is diluted in a 0.9% NaCl injection to make a total volume of 100 mL. An artisan would readily recognize that 0.9% NaCl solution is 0.9 g/100 mL and that equals 900 mg/100 mL which equals 9 mg/mL. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the pharmaceutical composition comprising the ASO of the copending App442 claims at 50 mg/mL concentration in an aqueous solution with different tonicity agents, pH conditions, pH adjusters or without any buffer, and NaCl concentrations, and optimize these conditions following the instructions for preparing a pharmaceutical composition of App062 and Sarepta for the benefit of preparing a similar exon skipping ASO at a concentration known to be effective for preparing ASOs and packaging them for patients to administer. One would have been motivated to do so with a reasonable expectation of success because both Sarepta’s EXONDYS 51 and the ASO of the copending App442 claims are ASO drugs for exon skipping that are used to treat the same disease and because artisans expect to modify a drug’s concentration or dose to maximize therapeutic effects and doing so is part of routine optimization. Furthermore, an artisan seeking to optimize the concentration of ASO in a pharmaceutical composition would have started with what was known in the art to be effective. Since Sarepta’s 50 mg/mL was already being used as the concentration for an FDA-approved exon skipping ASO for treating DMD, it would have been obvious to start by formulating Viltolarsen at the same 50 mg/mL concentration. Furthermore, the App442 claims are silent to any buffer indicating that it is not required for their pharmaceutical composition. Modifying the ASO of the copending App442 claims with the instructions for preparing it in a pharmaceutical composition of App062 with the 50 mg/mL concentration of Sarepta would have produced a pharmaceutical composition with all the limitations of Claims 23-24 and 26-31. This is a provisional nonstatutory double patenting rejection. Claims 23-24 and 26-31 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following copending applications in view of United States Patent Application Publication No. 2013/0211062 (published 15 August 2013, “App062”) and Sarepta (2016. EXONDYS 51 Full Prescribing Information Package Insert, “Sarepta”). This rejection is maintained but updated in response to the claim amendments. Copending Application # Claims Abbreviation Claimed SEQ ID NO(s) 18577133 Pub. No. US20240316093 1-17 App133 Comprises SEQ ID NOs 10 and 12 18577142 Pub. No. US20240285770 1-17 App142 Comprises SEQ ID NOs 10 and 12 18577111 Pub. No. US20240285547 1-12 and 15-17 App111 Comprises SEQ ID NO 10 The instant claims are drawn to a pharmaceutical composition for treating a human patient with Duchenne muscular dystrophy (DMD) comprising an ASO, a pharmaceutically acceptable salt thereof, or a hydrate thereof in a concentration of 50 mg/ml, wherein the ASO is Viltolarsen, which consists of a sequence that corresponds to a sequence complementary to nts 36-56 from the 5’terminus of exon 53 of wild-type human dystrophin gene, and wherein the pharmaceutical composition is an aqueous solution having a pH between 7.0 and 7.5. The claims are directed to various modifications to the composition of the pharmaceutical composition, including an NaCl concentration between 8-10 mg/mL, the composition lacking a phosphate or citrate buffer or any buffer; and wherein the composition comprises certain tonicity agents (including potassium chloride, glucose, fructose, maltose, sucrose, lactose, mannitol, sorbitol, xylitol, trehalose, and glycerin) or pH adjusting agents, or wherein the solvent is water. As discussed in §Claim interpretation, Viltolarsen is interpreted as a phosphorodiamidate morpholino oligomer (PMO) ASO consisting of SEQ ID NO 3 and wherein the 5'-terminus thereof is -OH. The copending App133, App142, and App111 claims are directed to nephrotoxicity reducing or precipitation suppressing agents for pharmaceutical compositions comprising an ASO that can be a PMO ASO, a sugar (that can be sucrose or trehalose) or sugar alcohol (that can be sorbitol or mannitol), wherein the pharmaceutical composition comprises specific concentration of ingredients, and wherein the ASO compound can comprise SEQ ID NO 10 or 12, and wherein the PMO ASO has -OH at the 5’end. The claimed and all copending claim sets are directed to a PMO ASO that has the exact same nt sequence of Viltolarsen or which comprises its sequence. Although the copending App133, App142, and App111 claims recite that the agent has certain properties (i.e., nephrotoxicity reduction or precipitation suppression) those properties are inherent to the structure of the compound. Since the compounds’ active ingredients are all the same, they all possess those functions. The sequences recited in the copending claims are identical to the nt sequence of Viltolarsen (which comprises instant SEQ ID NO 3), or comprise that sequence. The copending App133, App142, and App111 claims do not recite the specific features of the instantly claimed pharmaceutical composition: that the pharmaceutical composition is an aqueous solution having a pH between 7.0 and 7.5, or that it includes an NaCl concentration between 8-10 mg/mL, the composition lacking a phosphate or citrate buffer or any buffer; and wherein the composition comprises certain pH adjusters, or wherein the solvent is water. However, App062, drawn to ASOs that are Viltolarsen in all but name, teaches most of those features: (¶76) the pH of 7.4, (¶171) the aqueous solution comprised of injectable distilled water, (¶170) the pH controlling agents (which are simply different words to describe the same concept as a pH adjuster). App062 was clearly aware of the existence of different buffers and mentions (¶187) a citrate buffer and (¶197) a phosphate buffer but still allowed for a pharmaceutical composition comprising just the ASO and distilled water (therefore lacking any buffer). Using any of the pHs within the range taught in App062 would have been an obvious part of routine optimization for preparing a pharmaceutical composition comprising the ASO. The copending App133, App142, and App111 claims and App062 do not teach formulating the pharmaceutical composition at a 50 mg/mL concentration or that the composition comprises NaCl in a concentration between 8-10 mg/mL. However, Sarepta, drawn to the package insert for a different exon skipping drug, EXONDYS 51, teaches (p. 1 §Dosage forms and strengths and §3 Dosage forms and strengths) the EXONDYS 51 ASO comes in a 50 mg/mL solution in a single-dose vial. Sarepta additionally teaches (§11 Description ¶1) EXONDYS 51 is formulated as an isotonic, phosphate buffered saline solution with… a pH of 7.5. Therefore Sarepta teaches that pH 7.5 is a suitable pH for a pharmaceutical composition. Regarding instant Claim 24: Sarepta teaches (§2.2 Preparation Instructions ¶e) the withdrawn EXONDYS 51 is diluted in a 0.9% NaCl injection to make a total volume of 100 mL. An artisan would readily recognize that 0.9% NaCl solution is 0.9 g/100 mL and that equals 900 mg/100 mL which equals 9 mg/mL. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the pharmaceutical composition comprising the ASO of the copending App133, App142, and App111 claims at 50 mg/mL concentration in an aqueous solution with different tonicity agents, pH conditions, pH adjusters or without any buffer, and NaCl concentrations, and optimize these conditions following the instructions for preparing a pharmaceutical composition of App062 and Sarepta for the benefit of preparing a similar exon skipping ASO at a concentration known to be effective for preparing ASOs and packaging them for patients to administer. One would have been motivated to do so with a reasonable expectation of success because both Sarepta’s EXONDYS 51 and the ASO of the copending App133, App142, and App111 claims are ASO drugs for exon skipping that are used to treat the same disease and because artisans expect to modify a drug’s concentration or dose to maximize therapeutic effects and doing so is part of routine optimization. Furthermore, an artisan seeking to optimize the concentration of ASO in a pharmaceutical composition would have started with what was known in the art to be effective. Since Sarepta’s 50 mg/mL was already being used as the concentration for an FDA-approved exon skipping ASO for treating DMD, it would have been obvious to start by formulating Viltolarsen at the same 50 mg/mL concentration. Furthermore, the copending claims are silent to any buffer indicating that it is not required for their pharmaceutical composition. Modifying the ASO of the copending App133, App142, and App111 claims with the instructions for preparing it in a pharmaceutical composition of App062 with the 50 mg/mL concentration of Sarepta would have produced a pharmaceutical composition with all the limitations of Claims 23-24 and 26-31. It would not be possible to use the methods of the copending App133 (i.e., Claims 15-16), App142 (i.e., Claims 15-16), and App111 claims (i.e., Claims 15-16) without the compounds of the instant claims, App062, and Sarepta. This is a provisional nonstatutory double patenting rejection. Response to Arguments Applicant's arguments filed 23 June 2025 have been fully considered but they are not persuasive. Each argument is addressed below. Arguments that are no longer relevant are not addressed. Claim objections The objection to Claim 23 is maintained because although the sequence and structure of Viltolarsen are publicly available, when possible, claims should be complete in themselves, which requires reciting a SEQ ID NO. 103 rejections Since Applicant has amended the independent claim, the scope of all claims has been changed. Applicant argues that (pp. 6-7) the Office must provide a rationale for modifying the pharmaceutical composition to lack any buffer. That is not found persuasive because the US934 reference teaches (Col 26 L49-60, which is the same portion reproduced in Applicant’s arguments) adding an aqueous solvent to the oligomer and that any pharmaceutically acceptable aqueous solvent is acceptable. The sentence then provides examples of pharmaceutically acceptable aqueous solvents: injectable water or injectable distilled water and physiological saline. No motivation to modify has been provided because the reference itself discloses the exact formulation of the claimed invention. A pharmaceutical composition comprising the ASO Viltolarsen and distilled water is encompassed by the teachings of US934. Furthermore, other teachings in the reference indicate the formulation without any buffer is disclosed. The preceding ¶ (Col 26 L34-48) teaches that pharmaceutically acceptable additives may also be optionally formulated in the composition of the present invention. Examples of such additives are … pH controlling agents. The plain meaning of may also be optionally formulated [emphasis added] is that those additives are optional and not required. In addition, both of the cited ¶ are under the heading (see Col 25 L1) 2. Pharmaceutical Composition which indicates the content of that entire § describes components and formulations of pharmaceutical compositions. As discussed in the rejection, US934 was clearly aware of the existence of different buffers and mentions (Col 30 L1, Col 33 L3) citrate and phosphate buffers. Yet, the § instructing how to produce a pharmaceutical composition clearly states that such buffers are merely optional. The § clearly states producing a composition comprising the ASO and distilled water. Note also that the same § (Col 25 L10-19) discloses: PNG media_image2.png 143 562 media_image2.png Greyscale That passage indicates that the phrase “the composition of the present invention” means “the pharmaceutical composition for treatment of DMD, comprising the oligo or a pharmaceutically acceptable salt or hydrate thereof”. Then, the passage cited by Applicant states: (starts at Col 26 L49) the composition of the present invention can be prepared by adding the oligomer of the present invention to a carrier dispersion and adequately stirring the mixture. Additives may be added at an appropriate step… An aqueous solvent that can be used in adding the oligomer of the present invention is not particularly limited as far as it is pharmaceutically acceptable, and examples are injectable water or injectable distilled water, electrolyte fluid such as physiological saline, etc.… Altogether, the teachings of US934 indicate that the pharmaceutical composition of the present invention can be prepared by adding the oligo to a carrier dispersion and adequately stirring and that the aqueous solvent can be pharmaceutically acceptable injectable water or distilled water. US934 teaches that any additives such as buffers are optional, not a required part of a pharmaceutical composition. In addition, US934 teaches (Col 27 L9-20) reconstituting a lyophilized preparation of the composition using injectable water. Altogether, US934 teaches formulating pharmaceutical compositions with just the oligomer plus an aqueous solution that can be distilled water. Applicant argues on §2 (p. 8) that US934 does not teach a Viltolarsen-containing pharmaceutical composition having the claimed pH. That is not found persuasive because the cited passages discussed above disclose that a pharmaceutically acceptable aqueous solvent can be physiological saline and that a person skilled in the art can appropriately choose conditions for pH and temperature for such matter. Elsewhere in the document, what comprises physiological conditions is discussed, albeit in context of binding between the oligo and the transcript of a human DMD gene. That § (Col 11 L1-10) discloses physiological conditions refers to conditions set to mimic the in vivo environment in terms of pH, salt composition, and temperature, and goes on to explicitly disclose the “preferabl[e]” pH of 7.4. A person of ordinary skill would have readily understood that physiological saline and appropriate pH “for such matter” would encompass the pH of 7.4 since that pH was previously discussed to mimic the in vivo environment and physiological conditions. The rejection has not taken that content out of context; the rejection merely uses the term physiological conditions to encompass what the reference says it encompasses: conditions set to mimic the in vivo environment in terms of pH, salt composition and temperature, wherein the pH is preferably pH 7.4. In addition, it is noted that the secondary reference, Sarepta, teaches pH 7.5 is a suitable pH fo
Read full office action

Prosecution Timeline

Nov 08, 2023
Application Filed
Mar 19, 2025
Non-Final Rejection — §103, §DP
Jun 23, 2025
Response Filed
Sep 09, 2025
Final Rejection — §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12594349
COMPOSITIONS AND METHODS FOR THE TARGETING OF PCSK9
2y 5m to grant Granted Apr 07, 2026
Patent 12584134
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 24, 2026
Patent 12540324
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Feb 03, 2026
Patent 12540326
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Feb 03, 2026
Patent 12534728
RNAi Agents for Inhibiting Expression of 17beta-HSD Type 13 (HSD17B13), Compositions Thereof, and Methods of Use
2y 5m to grant Granted Jan 27, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
46%
Grant Probability
99%
With Interview (+72.7%)
2y 7m
Median Time to Grant
Moderate
PTA Risk
Based on 81 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month