DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of a composition or kit comprising a mixture of a plurality of primers comprising nucleotide sequences defined by SEQ ID NOs: 1–8, 13–21, or 26–28, aligning to a portion of a reference genome corresponding to a spike protein gene of a virus of the family Coronaviridae in the reply filed on 07/22/2026 is acknowledged.
Claims 146–148 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Claim Status
Claims 1–133 and 135 are cancelled.
Claims 146–148 are withdrawn.
Claims 134, 136-–145, and 149–154 are under examination under the merits.
Priority
The U.S. effective filing date of the claims under examination above is set at 06/10/2021.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 06/07/2024 was filed before the mailing date of the first action on the merits. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Nucleotide and/or Amino Acid Sequence Disclosures
Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures
37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted:
1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying:
a. the name of the XML file
b. the date of creation; and
c. the size of the XML file in bytes; or
2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying:
a. the name of the XML file;
b. the date of creation; and
c. the size of the XML file in bytes.
SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS: None.
Specification
The title of the invention is not descriptive. A new title is required that is clearly indicative of the invention to which the claims are directed. The following title is suggested: Compositions and Kits for Detecting Coronaviridae Genomic Sequences.
The disclosure is objected to because of the following informalities:
Paras. [0004] and [0005] of the Brief Summary are nearly identical. Applicant is encouraged to delete paragraph [0004].
On p. 15, para. [0047], “gnome” should read “genome”.
Throughout (e.g., p. 14, para. [044], lines 3–5), , sequences are described by reference to NCBI Accession Nos., which are subject to change, rather than to sequences set forth in the specification. This is an improper incorporation by reference, since the information required to describe and enable the required sequences is found in the NCBI database, extraneous to the application. Furthermore, since the NCBI sequences are not irrevocably fixed but are corrected and updated as additional sequence information becomes available, the NCBI accession numbers may refer to sequences which change after the application filing date. Thus, the disclosure is objected to for this improper incorporation by reference.
Appropriate correction is required.
The use of the following terms, which are trade names or marks used in commerce, has been noted in this application:
GRIDION: p. 18, para. [0065], line 13
NEXTSEQ: p. 18, para. [0065], line 15
LASERGENE: p. 128, para. [0191], line 19; p. 128, para. [0191], line 3
PANELPLEX: p. 128, para. [0191], line 3; p. 128, para. [0191], line 4
ILLUMINA: p. 138, para. [0206], lines 2 and 8
PACIFIC BIOSCIENCES: p. 138, para. [0206] line 3
LIFE SCIENCES: p. 138, para. [0206], lines 3 and 5
ION TORRENT: p. 138, para. [0206] lines 4 and 9
PICOGREEN: p. 140, para. [0209], line 5
THERMO FISHER SCIENTIFIC: p. 167, Tables 2–3
SUPERSCRIPT: p. 167, Table 3
NEW ENGLAND BIOLABS: p. 168, Table 4
RNACLEAN: p. 168, para. [0261] lines 1 and 3
BECKMAN COULTER: p. 168, para. [0261], line 2
NANODROP: p. 168, para. [0261], line 12
OXFORD NANOPORE TECHNOLOGIES: p. 169, para. [0262] lines 1 and 5 and Table 6; p. 170, Table 7
FLONGLE: p. 169, para. [0262], line 3, 5, 7, 16, and 18; and Table 6
MINION: p. 169, para. [0262], lines 3, 5, 7, 16, and 18–19; p. 170, para. [0264], line 5 and Table 7
MINKNOW: p. 169, para. [0262], line 3; p. 170, para. [0264], line 1 and para. [0266], line 1
ATCC: p. 174, para. [0287], line 2
The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Objections
Claims 136–139, 140, 143, and 146 objected to because of the following informalities:
Claims 137–138 and 140 use ampersands (&) to pair primers. Applicant should instead spell out the word “and”.
Claim 139 is missing a comma between “18” and “27”.
Claim 143 describes a sequence by reference to a Genbank Accession No., which are subject to change, rather than to sequences set forth in the specification. This is an improper incorporation by reference, since the information required to describe and enable the required sequences is found in the NCBI database, extraneous to the application. Furthermore, since the NCBI sequences are not irrevocably fixed but are corrected and updated as additional sequence information becomes available, the NCBI accession numbers may refer to sequences which change after the application filing date. Thus, the claim is objected to for this improper incorporation by reference.
Claim 146 has an extra space between “Envelope” and “gene”.
In claim 146, “Orf3a” should read “Orf 3a” for consistency.
In claim 146, “san” should read “an”.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 136–141 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The recitation of a plurality of primers comprising “at least a nucleotide sequence of any one of SEQ ID NOs: X” (claim 136), “at least two nucleotide sequences of any one of SEQ ID NOs: X & X” (claims 137–138 and 140), and “nucleotide sequences of SEQ ID NOs: X” (claim 139 and 141) lend to multiple claim interpretations which render them indefinite. Said nucleotide sequences could be defined by the full sequence enumerated by its sequence identifier, or by truncations thereof as short as a dinucleotide. The presence of multiple structural interpretations renders the claims indefinite.
See Ex parte Miyazaki, 89 USPQ2d 1207 (BPAI 2008) (“[R]ather than requiring that the claims are insolubly ambiguous, we hold that if a claim is amenable to two or more plausible claim constructions, the USPTO is justified in requiring the applicant to more precisely define the metes and bounds of the claimed invention by holding the claim unpatentable under [35 U.S.C. 112(b)], as indefinite.”).
It is recommended that Applicant better define the metes and bounds of said plurality of primers by reciting “the nucleotide sequence of any one of SEQ ID NOs:X” (claim 136), “…of primers comprises a pair of primers selected from the group consisting of : (a)….” (claims 137–138 and 140), and “the nucleotide sequences of SEQ ID NOs:X” (claim 139 and 141).
Claims 136–141 recite genome coordinates comprising (at broadest) positions “21893–22232, 22589–22868, 22773–23133, 22986–23301, 23272–23477, 23559–23812, 24129–24204, or 24711–25285” of the spike protein gene of a Coronaviridae family virus. The claims are rendered indefinite as there is no sequence identifier enumerating the reference genome to which to anchor the genome coordinates, leading to multiple possible claim interpretations. The nucleotide identity of, e.g., position 21893 could be one of many various nucleotides in a spike protein gene depending on the species of Coronaviridae family virus, its strain, and its mutations, i.e., the nature of insertion or deletions throughout the reference genome.
Claim 143 recites a reference genome comprising “a sequence” of the SARS-CoV-2 isolate Wuhan-Hu-1 with NCBI accession number NC_045512.2. As described supra, the lack of a sequence identifier renders the limitation of “a sequence” indefinite due to multiple possible claim interpretations.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 142 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 134 recites a plurality of primers comprising DNA to generate substrate nucleic acids. As DNA primers cannot be used in amplification reactions to generate, e.g., RNA, claim 142 does not further limit claim 134. Applicant may cancel the claim, amend the claim to place the claim in proper dependent form, rewrite the claim in independent form, or present a sufficient showing that the dependent claim complies with the statutory requirements.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 134, 142–145, 149–150, and 153–154 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Li (U.S. Patent No. US 11,214,843 B2, published 01/04/2022 with priority to 02/18/2020).
Regarding claim 134, Li teaches multiple DNA primers with 100% sequence identity to genomic sequences of the Coronaviridae family virus SARS-CoV-2 (column 6, para. 3, lines 10–14). These DNA primers align to the reference genome to produce substrate nucleic acids of multiple SARS-CoV-2 genes, including but not limited to spike protein gene (SEQ ID NO:2, column 2, para. 1, lines 6–7). Sets of forward primers (SEQ ID NOs:4–257, column 7, para. 2, lines 1–4) and sets of reverse primers (SEQ ID NOs:267–510, column 7, para. 3, lines 1–4) are taught. In some embodiments, Li teaches that these primers can be used in multiplex form to generate a plurality of substrate nucleic acids using multiple forward primer sequences and multiple reverse primer sequences within the selected reaction vessel (column 11, para. 2, lines 1–5). Thus, they teach a composition comprising a mixture comprising a plurality of primers configured to generate DNA substrate nucleic acids from a plurality of template sequences or complement sequences thereof from a Coronaviridae family virus.
Regarding claim 142, Li teaches substrate nucleic acids comprising DNA. Specifically, Li teaches that in some embodiments, the amplification of an RNA viral genomes is achieved by performing reverse transcription to generate cDNA, followed by amplification of the cDNA reaction product (column 1, para. 3) to produce DNA substrate nucleic acids. Thus, the claim that the plurality of substrate nucleic acids comprises DNA is clearly anticipated.
Regarding claim 143, as described supra, Li teaches SEQ ID NO:2, which corresponds to the sequences of a Coronaviridae family virus spike protein gene. SEQ ID NO:2 was identified from a GENBANK® sequence deposit of the SARS CoV-2 isolate Wuhan-Hu-1 whole genome, accession number MN908947.3 (p. 26, column 2, para. 1, lines 1–9). NCBI BLAST® demonstrates 100% identity between GENBANK® reference sequence MN908947.3 and NCBI reference sequence NC_045512.2 of the instant case. The claim limitation requiring that the reference genome of said Coronaviridae family virus comprises the NC_045512.2 sequence reference is anticipated.
Regarding claims 144–145, as described supra, Li teaches multiplex amplification reactions comprising a plurality of primers further comprising two, three, four, or five primer pairs (column 11, para. 2, lines 1–5). Thus, the claims that the plurality of primers comprises at most 50 primer pairs (claim 144) or 10 primer pairs (claim 145) is clearly anticipated.
Regarding claims 149–150 and 153–154, Li teaches that substrate nucleic acids can be detected from samples that may comprise veterinary sample, a clinical sample, a food sample, a forensic sample, an environmental sample (including air and water), or any other biological sample (Abstract and column 8, para. 1, lines 1–9). Claim 149 is therefore clearly anticipated by Li. These teachings further anticipate each of the following dependent claims. Claims 150–152 are anticipated by the teaching that samples can be environmental samples, including but not limited to include water, sewage, and food processing and manufacturing surfaces (column 8, para. 1, lines 6–9). Claims 153 is anticipated by the teaching that samples can be clinical, e.g., from a symptomatic or asymptomatic human (column 8, para. 1, lines 5–6), and claim 154 is anticipated by the teaching that samples can be veterinary, forensic, clinical, or any other biological sample, including nasal or other swabs (column 8, paras. 1–3).
Li clearly anticipates the claims above which are rejected here.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 136–138 and 140 are rejected under 35 U.S.C. 103 as being unpatentable over Li (U.S. Patent No. US 11,214,843 B2, published 01/04/2022 with priority to 02/18/2020) in light of Starlz (US 2021/0347858 A1, published 11/11/2021 with priority to 03/09/2021), Wohlstadter (US 2022/0003766 A1, published 01/06/2022 with priority to 04/30/2021), Springer (WIPO Publication No. WO 2021/195023 A2, published 09/30/2021 with priority to 05/28/2020), Rychlik (Nucleic Acids Res 17:21, 8543–8551, 1989), and Buck (Biotechniques 27: 528–536, 1999).
Li teaches multiple DNA primers with 100% sequence identity to genomic sequences of the Coronaviridae family virus SARS-CoV-2 (column 7, para. 1, lines 1–6). These DNA primers align to the reference genome to produce substrate nucleic acids of multiple SARS-CoV-2 genes, including but not limited to spike protein gene (SEQ ID NO:2, column 2, para. 1, lines 6–7). Sets of forward primers (SEQ ID NOs:4–257, column 7, para. 2, lines 1–4) and sets of reverse primers (SEQ ID NOs:267–510, column 7, para. 3, lines 1–4) are taught. Li teaches that these primers can be used in multiplex amplification reactions to generate a plurality of substrate nucleic acids using multiple forward primer sequences and multiple reverse primer sequences within the selected reaction vessel (column 11, para. 2, lines 1–5). Thus, they teach a composition comprising a mixture comprising a plurality of primers configured to generate DNA substrate nucleic acids from a plurality of template sequences or complement sequences thereof from a Coronaviridae family virus.
Li does not teach the specific plurality of DNA primers identified in the instant case to generate amplification products from a plurality of spike protein gene sequences.
Starlz teaches the spike protein gene DNA forward primer comprising the sequence of SEQ ID NO:58 (p. 49, para. [0534] and Table 2, p. 50), which is aligned with SEQ ID NO:1 in the instant case:
InstCase 1 GTGATGAAGTCAGACAAATCGC 22 SEQ ID NO:1 ||||||||||||||||||||||Starlz 2 GTGATGAAGTCAGACAAATCGC 23 SEQ ID NO:58
Wohlstadter teaches the spike protein gene DNA reverse primer for use in multiplex amplification reaction embodiments comprising the sequence of SEQ ID NO:478 (p. 66, para. [0473], lines 1–16 and p. 223), which is aligned with SEQ ID NO:2 in the instant case:
InstCase 1 ACAGTTGCTGGTGCATGTAGA 21 SEQ ID NO:2
|||||||||||||||||||||
Wohlstadter 2 ACAGTTGCTGGTGCATGTAGA 22 SEQ ID NO:478
Springer teaches the spike protein gene DNA forward primer comprising the sequence of SEQ ID NO:91 (p. 36, para. [00194], lines 7–9 and Table 6, p. 42), which is aligned with SEQ ID NO:3 in the instant case:
InstCase 1 CCGGTAGCACACCTTGTAATG 21 SEQ ID NO:3
|||||||||||||||||||||
Springer 4 CCGGTAGCACACCTTGTAATG 24 SEQ ID NO:91
Each of these sequence identifiers comprise sequences that align with 100% identity to SEQ ID NO:2 as taught by Li, comprising the spike protein gene of SARS-CoV-2 isolate Wuhan-Hu-1 (p. 26, column 2, para. 1, lines 6–7).
With respect to SEQ ID NO:19 in the instant case, Rychlik teaches it is routine and predictable to make primers for DNA amplification wherein primers are designed to a known oligonucleotide sequence. Rychlik teaches criteria to design and choose suitable primers for DNA amplification (see whole document and Abstract). Further, Buck expressly provides evidence of the equivalence of primers. Specifically, Buck invited primer submissions from 39 labs (p. 532, column 3), with 69 different primers being submitted (p. 530, column 1). Buck also tested 95 primers spaced at three-nucleotide intervals along the entire test sequence at issue, thereby testing more than one-third of all possible 18mer primers on the 300-bp test sequence (p. 530, column 1). When Buck tested each of the primers selected by the methods of the different labs, Buck found that every single primer worked (p. 533, column 1). Further, every single control primer functioned as well (p. 533, column 1). Buck expressly states, “The results of the empirical sequencing analysis were surprising in that nearly all of the primers yielded data
PNG
media_image1.png
1112
1427
media_image1.png
Greyscale
of extremely high quality” (p. 535, column 2). Buck thus provides direct evidence that all primers would be expected to function, and in particular, all primers selected according to ordinary criteria (see Buck, Table 1, provided above).
It would have been obvious to one of ordinary skill in the art to utilize the ordinary criteria of Buck to design a reverse primer that pairs with the forward primer SEQ ID NO:91 of Springer to generate a ~300-base pair amplification product desirable for the method of Li. According to the teachings of Buck, all reverse complements of 15–40-nt length in the region 275–325 base pairs downstream of the SEQ ID NO:19 docking site on the spike protein gene would predictably function as a reverse primer (Table 1) to generate a ~300-base pair amplification product. It would therefore have been obvious to a person having ordinary skill in the art to design SEQ ID NO:19 of the instant case, a 20-nt reverse primer (within the optimal 18–29-nt primer length range as defined by Buck), pair it with SEQ ID NO:19 of Springer such that they generate a 315-bp amplification product, thus forming a composition to be used for the very same purpose of the composition of Li.
Claims 139 and 141 are rejected under 35 U.S.C. 103 as being unpatentable over Li, Starlz, Wohlstadter, Springer, Rychlik, and Buck as applied to claims 136–138 and 141 above, and further in view of multiple valid structural interpretations of said claims.
Li, Starlz, Wohlstadter, Springer, Rychlik, and Buck render claims 136–138 and 140 obvious for the reasons supra all incorporated here. They however fail to teach a composition comprising the distinct set of a plurality of primers comprising SEQ ID NOs:1–2, 6–7, 16, 18, and 27–28, aligning to genome coordinates 21893–22232, 22773–23133, 23272–23477, and 23272–23477 of the instant claim; and of SEQ ID NOs:3, 5, 8, 13–14, 17, 19, and 26, aligning to genome coordinates 22589–22868, 22986–23301, 23559–23812, and 24711–25285 of the instant claim. They do not teach the distinct sets of separate portions of the spike protein gene to which these distinct sets of a plurality of primers align.
As described supra, claims 139 and 141 have multiple structural interpretations and as such, each of the recited primers could reasonably be defined by truncations of their sequence identifiers as short as one dinucleotide (see Claim Rejections - 35 USC § 112). That is, as defined by the instant claims, any oligonucleotide known at the time of filing that aligns to at least one dinucleotide of the enumerated sequences of the instant claims constitutes prior art. Indeed, each of the primers recited by claims 139 and 141 contain at least one dinucleotide that aligns with the oligonucleotides identified as prior art (SEQ ID NO:58 of Starlz, SEQ ID NO:478 of Wohlstadter, and SEQ ID NO:91 of Springer). Further, each primer of the instant claims adheres to the ordinary criteria of primer design as described by Rychlik and Buck, supra, and so a practitioner with ordinary skill would have had a reasonable expectation of their success when used in the compositions of Li.
Li also teaches forward primers (SEQ ID NOs:4–257, column 7, para. 2, lines 1–4) and reverse primers (SEQ ID NOs:267–510, column 7, para. 3, lines 1–4) for use in multiplex amplification reactions of SARS-CoV-2 genes (column 11, para. 2, lines 1–5), including spike gene protein (SEQ ID NO:2, column 2, para. 1, lines 6–7). The primers identified by Li, in spanning the SARS-CoV-2 spike protein gene, overlap with the separate genome coordinates of claims 139 and 141.
Therefore, it would have been obvious to a person having ordinary skill in the art at the time of filing to perform a multiplex amplification reaction with a plurality of primers aligned to separate portions of a Coronaviridae family virus spike protein gene. This inventions is taught by Li. Inventions It would have been obvious to a person having ordinary skill in the art to include primers of the instant claims discussed supra since they would predictably function in such a multiplex assay, achieving the goal of Li.
The combined teachings supra clearly show that every primer combination in the instant case would have been obvious to a person having ordinary skill in the art before filing of the instant application, and said practitioner would have had a reasonable expectation of success in carrying out the method of Li therewith. Therefore, it would have been obvious to one of ordinary skill at the time of filing to take the primers of Li and add their primers to the ones as claimed in the instant case. Since all the sequences of the claimed primers are present or meet primer design criteria, they are obvious primers that will function in the composition of Li to yield predictable results.
Claims 151–152 are rejected under 35 U.S.C. 103 as being unpatentable over Li (U.S. Patent No. US 11,214,843 B2, published 01/04/2022 with priority to 02/18/2020)in light of Rota (U.S. Patent No. US 7,220,852 B1, published 05/22/2007) and Hung (US 2022/0243264 A1, published 11/23/2021 with priority to 11/23/2020).
Li teaches that substrate nucleic acids can be detected from samples that may comprise a veterinary (i.e., animal) sample, a clinical sample, a food sample, a forensic sample, an environmental sample (i.e., water), or any other biological sample (Abstract and column 8, para. 1, lines 1–9).
Li does not teach that samples can be isolated from the surface of an indoor compartment, food packaging material, a mask, medical equipment, furniture; or from the surface of metal, wood, plastic, paper, glass, ceramic, fabric, or a shoe.
Rota teaches a method of detecting the presence of SARS-CoV-1 nucleic acids in a sample (column 3, para. 1, lines 1–4). They teach that environmental samples include inanimate objects within indoor environments, including furniture (column 13, para. 5, lines 2–5). Hung teaches a method for amplifying viral RNA sequences from samples. They teach that environmental samples may include a paper surface, a fabric surface, a metal surface, a wood surface, and a plastic surface (p. 40, para. [0336], lines 4–5).
Given that Coronaviridae family viruses utilize surfaces as a route of transmission (i.e., fomite transmission), a person having ordinary skill in the art at the time of filing would be motivated by the need to test surfaces for contamination in order to evaluate environmental sanitation or to ascertain whether or not an infected person has been shedding the virus nearby. It would therefore have been prima facie obvious to adapt the sample of Li by replacing their environmental samples with those of Rota or Hung and thus testing the surface of fabric covered furniture for example for the virus for the advantage above..
Taken all together, the combined teachings supra render all claims supra obvious.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Michael J.A. Bellecourt whose telephone number is 571-270-5356. The examiner can normally be reached Monday through Thursday, 8:00 a.m. to 3:00 p.m. ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO-supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Michael Allen can be reached at 571-270-3497. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/MICHAEL J.A. BELLECOURT/Examiner, Art Unit 1671 /Michael Allen/Supervisory Patent Examiner, Art Unit 1671
Prosecution Insights