Prosecution Insights
Last updated: October 01, 2026
Application No. 18/507,432

NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES

Non-Final OA §102§103§112§DP
Filed
Nov 13, 2023
Priority
Jul 08, 2010 — provisional 61/362,526 +4 more
Examiner
ARON, KIMBERLY A
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Brigham and Women's Hospital Inc.
OA Round
1 (Non-Final)
54%
Grant Probability
Moderate
1-2
OA Rounds
7m
Est. Remaining
90%
With Interview

Examiner Intelligence

Grants 54% of resolved cases
54%
Career Allowance Rate
238 granted / 437 resolved
-5.5% vs TC avg
Strong +35% interview lift
Without
With
+35.2%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
15 currently pending
Career history
457
Total Applications
across all art units

Statute-Specific Performance

§101
4.2%
-35.8% vs TC avg
§103
40.5%
+0.5% vs TC avg
§102
12.1%
-27.9% vs TC avg
§112
26.8%
-13.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 437 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application is being examined under the pre-AIA first to invent provisions. Claims 1-22, of record 11/13/23 are pending. Prosecution on the merits begins for claims 1-22. PRIORITY The instant Application, filed 11/13/2023, is a CONTINUATION of US Application No. 16/577,857 (now abandoned), filed 09/20/2019, which is a CONTINUATION of US Patent No. 10,457,939 (US 15/590,344), filed 5/09/2017, which is a CONTINUATION of US Patent No. 9,676,810 (US 13/808,863), filed 03/29/2013, which claims priority to PCT/US2011/043400, filed 07/08/2011, which claims priority to US Provisional Application No. 61/362,526 filed 7/08/2010. Thus, the earliest possible priority for the instant application is 07/08/2010. Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date as follows: The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994). The disclosure of the prior-filed application, US Provisional Application No. 61/362,526, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. Instant independent claims 1 and 3 are directed to a neuroprotective molecule derived from a mature tRNA molecule, comprising a sequence of 25-35 contiguous nucleotides that is at least 80% identical to nucleotides 1 to 50 of a mature tRNA, a D-stem loop structure and at least 4 contiguous guanosine-containing 5’ nucleotides: PNG media_image1.png 200 400 media_image1.png Greyscale It is acknowledged that US Provisional Application No. 61/362,526 discloses tRNA fragment molecules. However, the Examiner is unable to identify any structural requirements of the instant claims disclosed within the provisional Application. The provisional Application does not disclose that the tRNA molecules therein are fragments of 25-35 contiguous nucleotides of a human mature tRNA, or that the molecules are 80% identical to a 25-35 contiguous sequence between nucleotide 1 and 50 of a mature tRNA, nor is there a disclosure therein that the tRNA requires 4 guanosine nucleotides at the 5’ end of the molecule. The provisional Application does not require that the tRNA fragments are neuroprotective. The provisional Application does not appear to disclose SEQ ID NOs 54, 5,8-11, 13-17, 32, 37 or 40-174. Given that US Provisional Application No. 61/362,526 does not disclose the basic structural requirements of the instant claims, the provisional Application does not appear to support the priority claim of the instant specification. Applicant should provide page and line numbers which clearly support the structural requirements of the instant claims, within Provisional Application NO. 61/362,526. As such, the instant claims are afforded priority to PCT/US2011/043400, filed 07/08/2011. CLAIMS Instant independent claims 1 and 3 are directed to a neuroprotective molecule derived from a mature tRNA molecule, comprising a sequence of 25-35 contiguous nucleotides that is at least 80% identical to nucleotides 1 to 50 of a mature tRNA, a D-stem loop structure and at least 4 contiguous guanosine-containing 5’ nucleotides. As noted above, the claims are directed to neuroprotective molecules, as recited in the preamble. The determination of whether a preamble limits a claim is made on a case-by-case basis in light of the facts in each case; there is no litmus test defining when a preamble limits the scope of a claim. Any terminology in the preamble that limits the structure of the claimed invention must be treated as a claim limitation. See, e.g., Corning Glass Works v. Sumitomo Elec. U.S.A., Inc., 868 F.2d 1251, 1257, 9 USPQ2d 1962, 1966 (Fed. Cir. 1989). If the body of a claim fully and intrinsically sets forth all of the limitations of the claimed invention, and the preamble merely states, for example, the purpose or intended use of the invention, rather than any distinct definition of any of the claimed invention’s limitations, then the preamble is not considered a limitation and is of no significance to claim construction. During examination, statements in the preamble reciting the purpose or intended use of the claimed invention must be evaluated to determine whether or not the recited purpose or intended use results in a structural difference (or, in the case of process claims, manipulative difference) between the claimed invention and the prior art. MPEP211.02 "Mature human tRNA" is "meant a human transfer RNA molecule in which the intron sequences have been removed" (paragraph [0021] the published specification). The "human" aspect of the claims is not defined in the specification, other than as the source for the original tRNA. All experiments comprising the claimed sequences were performed using synthetic tRNA sequences "since natural tiRNA preparations are contaminated with ribosomal and mRNA fragments, the synthetic tiRNAs used in this study were synthesized by Integrated DNA Technology..." (paragraph [0143]). Thus, absent evidence to the contrary as how human nucleotides are distinct from nucleotides from other sources, the "human" adjective is no given any patentable weight. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 13-22 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 13, 14, 15 and 20 each recite, “an isolated C-myc oligonucleotide comprising the sequence of GGGGAGGGTGGGGAGGGTGGGG (SEQ ID NO: 174)” (emphasis added). The claim is indefinite because SEQ ID NO: 174 contains a 21-nucleotide sequence with three guanosine nucleotides PNG media_image2.png 82 475 media_image2.png Greyscale at the 5’ end: However, the actual nucleic acid sequence recited in claims 13, 14, 15 and 20 is a 22-nucleotide sequence with four guanosine nucleotides at the 5’ end. It is unclear if Applicant is claiming SEQ ID NO: 174 as recited in the parentheticals, or if applicant is claiming the 22-nucleotide sequence recited in the text of the claim. Claims 16-19, 21-22 are included in the rejection because they depend from a rejected claim. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-22 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The MPEP states that the purpose of the written description requirement is to ensure that the inventor had possession, as of the filing date of the application, of the specific subject matter later claimed by him. The courts have stated: “To fulfill the written description requirement, a patent specification must describe an invention and do so in sufficient detail that one skilled in the art can clearly conclude that “the inventor invented the claimed invention.” Lockwood v. American Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997); In re Gostelli, 872 F.2d 1008, 1012, 10 USPQ2d 1614, 1618 (Fed. Cir. 1989) (“[T]he description must clearly allow persons of ordinary skill in the art to recognize that [the inventor] invented what is claimed.”). Thus, an applicant complies with the written description requirement “by describing the invention, with all its claimed limitations, not that which makes it obvious,” and by using “such descriptive means as words, structures, figures, diagrams, formulas, etc., that set forth the claimed invention.” Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966.” Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398.Further, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated: “A written description of an invention involving a chemical genus, like a description of a chemical species, ‘requires a precise definition, such as by structure, formula, [or] chemical name,’ of the claimed subject matter sufficient to distinguish it from other materials.” Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) (“In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus …”) Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398. The MPEP further states that if a biomolecule is described only by a functional characteristic, without any disclosed correlation between function and structure of the sequence, it is “not sufficient characteristic for written description purposes, even when accompanied by a method of obtaining the claimed sequence.” MPEP § 2163. The MPEP does state that for a generic claim the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. MPEP § 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP § 2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad generic. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618. The MPEP lists factors that can be used to determine if sufficient evidence of possession has been furnished in the disclosure of the Application. These include “level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention. Disclosure of any combination of such identifying characteristics that distinguish the claimed invention from other materials and would lead one of skill in the art to the conclusion that the applicant was in possession of the claimed species is sufficient.” MPEP § 2163. While all of the factors have been considered, a sufficient amount for a prima facie case are discussed below. In the instant case, claims 1 and 3 are drawn to a neuroprotective molecule comprising a sequence of 25-35 contiguous nucleotide that is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA; and at least four contiguous guanosine-containing nucleotides; wherein the sequence of 25-35 contiguous nucleotides comprises a D-loop stem structure, the at least four contiguous guanosine-containing nucleotides are located at the 5’ end of the neuroprotective molecule, and the neuroprotective molecule comprises at least one deoxyribonucleotide (claim 1 only). The present specification does not further define what specific nucleic acid sequences/base pairs/motifs or structures, other than the sequence is at a minimum, 25-35 contiguous nucleotides that are at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature tRNA, and must include the D-loop structure, and a GGGG motif, and include a deoxyribonucleotide which act as neuroprotective molecules. Paragraph [0066] of the published specification teaches: Neuroprotective molecules that are capable of inhibiting protein translation, inducing or increasing stress granule formation in a cell (e.g., a motor neuron), and decreasing stress-induced cell death (e.g., motor neuron death) have been discovered. These neuroprotective molecules are based, in part, on sequences present within mature human tRNAs. Some of these neuroprotective molecules have been shown to be taken up by motor neurons in the absence of transfection agents. The structural features of the neuroprotective molecules are described below, as well as their use in methods of inhibiting protein translation in a cell, inducing or increasing stress granule formation in a cell, reducing stress-induced cell death, and treating a neurological disorder associated with neuron death. Also provided herein are methods of identifying a candidate translation inhibitory nucleic acid. Paragraph [0110] of the published specification teaches: In various embodiments of these methods, the cell can be a neuron (e.g., a motor neuron), a fibroblast, an epithelial cell, an endothelial cell, or a muscle cell. In any of the methods described herein, the cell is a human cell. In some embodiments of these methods, the cell is in vitro (in tissue culture). In some embodiments of these methods, the cell is in vivo (in a human). In some embodiments, the cell is ex vivo (e.g., a primary human neuron or a primary rat neuron). Thus, the broadest reasonable interpretation in light of the specification of a “neuroprotective” molecule is a molecule comprising: a sequence of 25-35 contiguous nucleotides that is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA; wherein the sequence of 25-35 contiguous nucleotides comprises a D-loop stem structure; and and at least four contiguous guanosine-containing nucleotides; wherein the at least four contiguous guanosine-containing nucleotides are located at the 5' end of the neuroprotective molecule; wherein the molecule is capable of inhibiting protein translation, inducing or increasing stress granule formation in a cell, and decreasing stress-induced cell death. The specification does not identify what structure(s) of the claimed molecule confers the neuroprotection: tertiary structure? Nucleotide bases? Further, the claimed molecule is not limited to a length. Thus, claims 1 and 3 as written, can allow for a large amount of variability in order to reach the claims requirement of 25-35 contiguous nucleotides that are at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature tRNA, including deletion, insertions, substitutions, etc. The possible structural variations are immense, allowing for a substitution, insertion or deletion at every base pair from 1 to 60 of the mature tRNA, resulting in a claim that reads on hundreds, if not hundreds of thousands or millions of nucleic acids that are encompassed by the claims. The genus would require extensive trial and error. (1) Level of skill and knowledge in the art: One of skill in the art would know that even a single nucleic acid mutation in a tRNA can result in loss of tertiary structure and decreased stability (See, Phizicky et al. Roles of tRNA Modifications in tRNA Turnover. In Grosjean H. Ed., DNA and RNA Modification Enzymes: Structure, Mechanism, Function and Evolution. 2009. Pp 564-576, of record) Thus, the level of skill and knowledge, in determining which nucleotide to delete, substitute, invert, add and insert and still maintain 25-35 contiguous nucleotides that are at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature tRNA, and a D-loop structure, and a GGGG motif from the thousands to millions claimed possibilities, is high. (2) Partial structure: As mentioned above, the minimum structural requirements of a neuroprotective molecule encompassed by the claims are A) a sequence of 25-35 contiguous nucleotides that is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA; wherein the sequence of 25-35 contiguous nucleotides comprises a D-loop stem structure; and B) at least four contiguous guanosine-containing nucleotides; wherein the at least four contiguous guanosine-containing nucleotides are located at the 5' end of the neuroprotective molecule. The specification discloses tRNAala and tRNACys are the only human tRNAs with 4 to 5 consecutive guanines located at the 5’ end (paragraph [0166]). The specification shows the 5’ half of tRNAala (SEQ ID NO: 4) and tRNACys (SEQ ID NO: 10) comprise 25-35 contiguous nucleotides that are at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature tRNA, and a D-loop structure, and a GGGG motif. The specification teaches four contiguous guanines can be added to any human tRNA sequences disclosed (paragraphs [0023], [0026]). (3) Physical and/or chemical properties and (4) Functional characteristics: There is no disclosure regarding what nucleic acids, or corresponding tRNA structure, confers neuroprotective capability or what bases confer proper secondary/tertiary structure. The specification discloses tRNAala and tRNACys are the only human tRNAs with 4 to 5 consecutive guanines located at the 5’ end (paragraph [0166]). The specification shows the 5’ half of tRNAala (SEQ ID NO: 4) and tRNACys (SEQ ID NO: 10) comprise 25-35 contiguous nucleotides that are at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature tRNA, and a D-loop structure, and a GGGG motif. The specification teaches four contiguous guanines can be added to any human tRNA sequences disclosed (paragraphs [0023], [0026]). The specification demonstrates very few working examples of neuroprotective molecules that are encompassed by the claims, AND are shown as capable of inhibiting protein translation, inducing or increasing stress granule formation in a cell, and decreasing stress-induced cell death. The only demonstration of a molecule comprising all of the claimed structural requirements that demonstrates inhibition of protein translation, inducing or increasing stress granule formation, and decreasing stress-induced cell death is tiRNAala, as encoded by SEQ ID NO:4/SEQ ID NO:32, which both encode gggggtgtagctcagtggtagagcgcgtgc. (5) Method of making the claimed invention: The specification does not limit the method of making the tRNA. As stated supra, the MPEP states that written description for a genus can be achieved by a representative number of species within a broad generic. It is unquestionable that claims 1 and 3 are broad and generic, with respect to all possible compounds encompassed by the claims. The possible structural variations are nearly limitless, with any amount of additional changes, so long as the compound comprises 25-35 contiguous nucleotides that are at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature tRNA, and a D-loop structure, and a GGGG motif, and neuroprotective. This reads on hundreds, if not hundreds of thousands to millions of nucleic acids that are encompassed by the claims. Although the claims may recite some functional characteristics, to known, specific nucleic acid sequences (as encompassed by SEQ ID NO 4) the claims lack written description because there is no disclosure of a correlation between function and structure of the compounds beyond those compounds specifically disclosed in the examples in the specification. Moreover, the specification lacks sufficient variety of species to reflect this variance in the genus. While having written description of a neuroprotective molecule consisting of SEQ ID NO 4, and compounds identified in the specification tables and/or examples, which minimally meet the structural requirements of the claim, the specification does not provide sufficient descriptive support for the myriads of compounds embraced by the claims which demonstrate the functions associates with a neuroprotective molecule. Whether a few SPECIES are known in the art is not the issue; the cited claims are drawn to neuroprotective compositions, and methods comprising administering any neuroprotective compositions, including those known and those yet to be identified. Applicant provides no guidance for identifying additional neuroprotective compositions except by trial-and-error screening: The specification invites the skilled artisan to test candidate tRNA sequences for their ability to inhibit translation: paragraphs [0019], [0066], [0097], [0131]-[0135]. The specification invites the skilled artisan to test candidate tRNA sequences for their ability to induce or increase stress granule formation: [0029], [0066], [0030], [0097] The specification invites the skilled artisan to test candidate tRNA sequences for their ability to reduce stress-induced cell death: paragraphs [0034], [0066], [0097]. The cited claims are drawn in part to a method for “increasing stress granule formation”, “decreasing protein translation” “decreasing stress-induced cell death” or “treating a neurological disorder associated with neuron death” comprising administering a “neuroprotective molecule” to a cell or patient. In University of Rochester v. G.D. Searle & Co., 68 USPQ2d 1424 (W.D.N.Y. 2003), at issue was a patent directed to method for inhibiting prostaglandin (PGHS-2) synthesis in a patient using an unspecified compound. The District Court of Western New York evaluated the level of disclosure required to satisfy the written description. In their decision (which was later affirmed by the Court of Appeals for the Federal Circuit), the District Court wrote, “The real issue here is simply whether a written description of a claimed method of treatment is adequate where a compound that is necessary to practice that method is described only in terms of its function, and where the only means provided for finding such a compound is essentially a trial-and-error process.” The patent in Rochester does no more than describe the desired function of the compound called for, and it contains no information by which a person of ordinary skill in the art would understand that the inventors possessed the claimed invention. At best, it simply indicates that one should run tests on a wide spectrum of compounds in the hope that at least one of them will work. The specification of the patent in Rochester states that the invention comprises, inter alia, “assays for screening compounds, including peptides, polynucleotides, and small organic molecules to identify those that inhibit the expression or activity of the PGHS-2 gene product; and methods of treating diseases characterized by aberrant PGHS-2 activity using such compounds.” Nowhere, however, does it specify which “peptides, polynucleotides, and small organic molecules” have the desired characteristic of selectively inhibiting PGHS-2. The Rochester court cited the CAFC in Enzo Biochem, Inc. v. Gen-Probe Inc., 296 F.3d 1316 (63 U.S.P.Q.2d 1609), which adopted the standard set forth in the Patent and Trademark Office (“PTO”) Guidelines for Examination of Patent Applications Under the 35 U.S.C. 112, 1 “Written Description” Requirement (“Guidelines”), 66 Fed. Reg. 1099 (Jan. 5, 2001), which state that the written description requirement can be met by “showing that an invention is complete by disclosure of sufficiently detailed, relevant identifying characteristics,” including, inter alia, “functional characteristics when coupled with a known or disclosed correlation between function and structure ... .” Enzo, 296 F.3d at 1324-25 (quoting Guidelines, 66 Fed. Reg. at 1106 (emphasis added)). The description requirement of the patent statute requires a description of an invention, not an indication of a result that one might achieve if one made that invention. See In re Wilder, 736, F.2d 1516, 1521, 222 USPQ 369, 372-73 (Fed. Cir. 1984) (affirming rejection because the specification does “little more than outlin[e] goals appellants hope the claimed invention achieves and the problems the invention will hopefully ameliorate.”) There is only one exemplified compound which comprises the claimed structure and function, there is no structure-function relationship known or established, it is only through trial and error that additional species could be identified. Accordingly, it is deemed that the specification fails to provide adequate written description for the genus of the claims and does not reasonably convey to one skilled in the relevant art that the inventor(s), at the time the application was filed, had possession of the entire scope of the claimed invention. Claims 2 and 4-22 are included in the rejection because they depend from a rejected claim. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of pre-AIA 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (b) the invention was patented or described in a printed publication in this or a foreign country or in public use or on sale in this country, more than one year prior to the date of application for patent in the United States. Claims 1-5, 7-12, and 20-21 are rejected under pre-AIA 35 U.S.C. 102(b) as being anticipated by US Patent Application Publication No. 2006/0134748 to RajBhandary (of record, IDS of 4/15/24). The claims are directed to a neuroprotective molecule comprising a sequence of 25-35 contiguous nucleotide that is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA; and at least four contiguous guanosine-containing nucleotides; wherein the sequence of 25-35 contiguous nucleotides comprises a D-loop stem structure, the at least four contiguous guanosine-containing nucleotides are located at the 5’ end of the neuroprotective molecule, and the neuroprotective molecule comprises at least one deoxyribonucleotide. The term “neuroprotective molecule” is not defined in the instant specification. Thus, any molecule which meets the structural requirements of the claim meets the claim's requirement of a "neuroprotective." With regard to independent claims 1 and 3, RajBhandary discloses suppressor tRNA molecules that comprise a sequence of 25-35 contiguous nucleotide that is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA; and at least four contiguous guanosine-containing nucleotides; wherein the sequence of 25-35 contiguous nucleotides comprises a D-loop stem structure, the at least four contiguous guanosine-containing nucleotides are located at the 5’ end of the neuroprotective molecule, and comprises at least one deoxyribonucleotide (Abstract; FIG 7, 8, 11, Paragraphs [0211], [0058], [0060]; SEQ ID Nos. 7-16 show a 5’ GGGG motif (paragraph [0211]). RajBhandary discloses the suppressor tRNA can be aminoacylated with both natural and unnatural amino acids (paragraph [0094]). RajBhandary discloses the suppressor rTNA can be used to regulate a variety of different proteins, includes neurotransmitters paragraph [0127]) or used for gene therapy to treat the neuromuscular disease Duchenne muscular dystrophy ([0137]) which, in addition to the suppressor tRNA of RajBhandary meeting the structural limitations of the claim, arguably reads on a “neuroprotective molecule” absent evidence to the contrary. In light of the breadth of claims 2, 4, 5, it appears that one or more of SEQ ID NOs 7-16 of RajBhandary read on a sequence of 25-35 contiguous nucleotides at least 80% identical to a contiguous sequence between nucleotides 1 and 50 of SEQ ID NOs: 4, 5, 8-11, 13-17, 32, 37 and 40-173. It is noted that claims 2, 4 and 5 do not limit the neuroprotective molecule to consisting of the elected SEQ ID NO. But rather the claims read on a much larger genus. With regard to claim 7-9, RajBhandary discloses the suppressor tRNA molecules comprise at least one modified nucleotide, including a modified base or sugar, or comprise a modification in the phosphate backbone (paragraph [0058]). With regard to claim 10, RajBhandary discloses the suppressor tRNA molecules comprise end-caps, which read on a 5’ or 3’ protective group (paragraph [0059]). With regard to claim 11, SEQ ID Nos. 7 and 13 of RajBhandary are 52 and 56 nucleotides in length, respectively. With regard to claim 12, RajBhandary discloses the suppressor tRNA molecules are formulated in a viral vector for therapeutic use (paragraph [0068]) and delivered to cells in vivo to treat a disease (paragraphs [0005], [0040], [0066],[0137]-[0138]). Such vectors read on a pharmaceutical composition. With regard to claims 20-21, RajBhandary discloses the suppressor tRNA molecules can be used to for gene therapy to treat the neuromuscular disease Duchenne muscular dystrophy to alleviate disease symptoms (paragraphs [0040], [0066], [0068], [0137]). Claims 1-4, 10-12, and 14 are rejected under pre-AIA 35 U.S.C. 102(b) as being anticipated by WO2009/134443 to Anderson (of record, IDS of 4/15/24), publication date 11/05/2009. As noted above, the pending claims have an effective filing date of 7/08/2011. The applied Anderson reference has a common inventor with the instant application, but qualifies as a 102(b) dated reference, and cannot be overcome by any showings of declarations (MPEP 2146). The claims are directed to a neuroprotective molecule comprising a sequence of 25-35 contiguous nucleotide that is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA; and at least four contiguous guanosine-containing nucleotides; wherein the sequence of 25-35 contiguous nucleotides comprises a D-loop stem structure, the at least four contiguous guanosine-containing nucleotides are located at the 5’ end of the neuroprotective molecule, and the neuroprotective molecule comprises at least one deoxyribonucleotide.. The term “neuroprotective molecule” is not defined in the instant specification. Thus, any molecule which meets the structural requirements of the claim meets the claim's requirement of a "neuroprotective." With regard to claims 1 and 3, Anderson discloses tRNA molecules (tiRNA) that comprise a sequence of 25-35 contiguous nucleotide that is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA; and at least four contiguous guanosine-containing nucleotides; wherein the sequence of 25-35 contiguous nucleotides comprises a D-loop stem structure, the at least four contiguous guanosine-containing nucleotides are located at the 5’ end of the neuroprotective molecule, and comprises at least one deoxyribonucleotide (Abstract; pages 3-4; Table 1). Anderson’s SEQ ID NOs: 1-7, 9-16 (tRNAala), 19-23 (tRNACys), 52 (tRNAIle), 115-119 (tRNAVal) each meet the minimal structural requirements of claims 1 and 3. Thus, the tRNA of Anderson meet the structural limitations of the claim, and therefore reads on a “neuroprotective molecule” absent evidence to the contrary. M.P.E.P. § 2112 reads, “The claiming of a new use, new function or unknown property which is inherently present in the prior art does not necessarily make the claim patentable.” Something that is old does not become patentable upon the discovery of a new property, use, or application. In the instant case, the exact SEQ ID NOs elected by Applicant are known in the prior art. Simply because the prior art does not demonstrate a specific neuroprotective quality attributed in the present application does not that the molecules of Anderson do not have that property. M.P.E.P. § 2112.01 recites, "Products of identical chemical composition can not have mutually exclusive properties. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the properties applicant discloses and/or claims are necessarily present.” See In re Spada, 911 F.2d 705, 709, 15 USPQ2d 1655, 1658 (Fed. Cir. 1990). With regard to claims 2 and 4, Anderson’s SEQ ID NO: 4 is 100% identical to instant SEQ ID NO: 4: PNG media_image3.png 79 286 media_image3.png Greyscale PNG media_image4.png 80 297 media_image4.png Greyscale Anderson’s SEQ ID NO: 52 is 100% identical to instant SEQ ID NO: 91: PNG media_image5.png 83 303 media_image5.png Greyscale Anderson’s SEQ ID NO: 115 is 100% identical to instant SEQ ID NO: 154: In light of the breadth of claims 2 and 4, it appears that one or more of Anderson’s SEQ ID NOs 1-7, 9-16 (tRNAala), 19-23 (tRNACys), 52 (tRNAIle), 115-119 read on a sequence of 25-35 contiguous nucleotides at least 80% identical to a contiguous sequence between nucleotides 1 and 50 of SEQ ID NOs: 4, 5, 8-11, 13-17, 32, 37 and 40-173. It is noted that claims 2 and 4 do not limit the neuroprotective molecule to consisting of the elected SEQ ID NO. But rather the claims read on a much larger genus. With regard to claim 10, Anderson discloses the tiRNA molecules comprise a 5’ or 3’ protective group (page 10, line 1- page 11, line 10). With regard to claim 11, one or more of Anderson’s SEQ ID NOs 1-7, 9-16 (tRNAala), 19-23 (tRNACys), 52 (tRNAIle), 115-119 are between 39 and 60 nucleotides in length. With regard to claim 12, Anderson discloses the tiRNA molecules are formulated as a pharmaceutical composition (page 5). With regard to claim 14, Anderson discloses the tiRNA molecules can be administered to cells in vitro or in vivo to decrease protein translation (page 3, lines 2-26, page 6, lines 4-10, 25-32). Claim Rejections - 35 USC § 103 The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action: (a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under pre-AIA 35 U.S.C. 103(a) are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims under pre-AIA 35 U.S.C. 103(a), the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were made absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and invention dates of each claim that was not commonly owned at the time a later invention was made in order for the examiner to consider the applicability of pre-AIA 35 U.S.C. 103(c) and potential pre-AIA 35 U.S.C. 102(e), (f) or (g) prior art under pre-AIA 35 U.S.C. 103(a). Claims 6-9 and 13-19 are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over WO2009/134443 to Anderson (of record, IDS of 4/15/24) as applied to claims 1-4, 10-12, and 14 above, and further in view of Emara et al, Published 2/3/2010 (of record, IDS of 4/15/24). As noted above, the pending claims have an effective filing date of 7/08/2011. The applied Emara reference has a common inventor with the instant application, but qualifies as a 102(b) dated reference, published February 3, 2010, and cannot be overcome by any showings of declarations (MPEP 2146). Anderson is applied as in the 102 rejection above, the content of which is incorporated herein in its entirety. Anderson discloses tRNA molecules (tiRNA) that comprise a sequence of 25-35 contiguous nucleotide that is at least 80% identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human tRNA; and at least four contiguous guanosine-containing nucleotides; wherein the sequence of 25-35 contiguous nucleotides comprises a D-loop stem structure, the at least four contiguous guanosine-containing nucleotides are located at the 5’ end of the neuroprotective molecule, and comprises at least one deoxyribonucleotide according to claim 1. Anderson discloses the tiRNA molecules effective for inhibiting protein translation are the 5’-fragments of endogenous tRNA that are cleaved in response to cellular stress (page 3, page 10, lines 1-12, 28-31). Anderson discloses use of tiRNA molecules isolated from cells results in heterogeneous tiRNA populations (page 10, lines 29-32). Anderson generates synthetic tiRNA molecules to specific 5’- tRNA fragments in order to quantify protein translation inhibition by specific tRNAs (page 11, lines 1-10). Anderson suggests expression of the tiRNA in cells inhibits protein translation and induces apoptosis in a phospho-eIF2alpha-independent stress response pathway (page 3, lines 1-7, page 11, line 1- page 12, line 12). However, Anderson does not disclose wherein the tiRNA molecules comprise a 5’ monophosphate as required by instant claim 6. Emara further investigates the role tiRNAs play in a phospho-eIF2alpha-independent stress response pathway (abstract, page 10966). Emara shows expression of tiRNA molecules in cells inhibits protein expression and induces stress granules in a phospho-eIF2alpha-independent pathway. Emara further shows the induction of stress granules is increased when tiRNA molecules comprises a 5’-monophosphate (pages 10963-10964, FIGs 3a-f). Emara discloses stress response pathways in cells reprogram cells to down regulate house-keeping genes while increasing genes which aid in adapting to stress (10966). Emara suggests the combined effect of protein translation inhibition and stress granule formation following tiRNA expression in a stressed environment may be cytoprotective/neuroprotective. Emara suggests the 5’-monophosphate modification of the tiRNA, which augmented the protein translation inhibition and stress granule formation may be required for, or augment, the cytoprotective effects (page 10966, last paragraph - page 10967). Emara further suggests the specific function of tiRNA may be dependent upon the presence or absence of specific structures (page 10967). It would have been obvious to combine the disclosure of Anderson on tiRNA molecules further with the disclosure of Emara. A skilled artisan would have been motivated to include a 5’-monophosphate on the tiRNA of Anderson because Emara discloses its presence augments the tiRNA molecule’s ability to inhibit protein translation and induce stress granules. A skilled artisan would have had a reasonable expectation of success in practicing the claimed invention as including 5’-monophosphates on tiRNA molecules was known in the art at the time of the invention. With regard to claim 13, Anderson does not disclose wherein the tiRNA molecules are administered to a cell to induce or increase stress granules. Emara discloses methods of administering tiRNA molecules to cells to increase stress granules. Emara suggests such methods can be used to further delineate the role of tiRNA in stress response pathways (pages 10966-10967). Thus, it would have been obvious to use the tiRNA molecules in a method of inducing or increasing stress granules in a cell as claimed. MPEP2143(I)(A). With regard to claims 16-17, Anderson discloses methods of administering tiRNAs to cells in vitro or in vivo (page 3, lines 2-26, page 6, lines 4-10, 25-32). Thus, these claims are obvious for the same reasons as those stated for claim 13. With regard to claims 18-19, Emara discloses the cytoprotective effect of ANG has been shown in motor neurons (page 10966) and that tiRNAs are upregulated in response to ANG cleavage in stressed environments. Thus, these claims are obvious for the same reasons as those stated for claim 13. With regard to claim 15, Anderson does not disclose wherein the tiRNA molecules are administered to a cell to decrease stress-induced cell death. Emara discloses stress response pathways in cells reprogram cells to down regulate house-keeping genes while increasing genes which aid in adapting to stress (10966). Emara discloses the stress-response upregulation of Angiogenin (ANG) induces the endogenous production of tiRNA. Emara also discloses ANG is known to be neuroprotective, required for motor neuron survival in hypoxic conditions (page 10966). Emara discloses methods of administering tiRNA molecules to cells resulting in both translation inhibition and increase stress granules is cytoprotective (pages 10966-10967). Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-22 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-22 of U.S. Patent No. 10457,939. Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are anticipated by, or obvious variants of, the claims of the patent. The instant Application, is a CONTINUATION of US Application No. 16/577,857 (now abandoned), which is a CONTINUATION of US Patent No. 10,457,939. Independent claims 1, 9 and 15 of the ‘939 patent are directed to a neuroprotective molecule consisting of, at least, i) a sequence of 25-35 contiguous nucleotides that is identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human transfer ribonucleic acid (tRNA) having a sequence selected from the group consisting of SEQ ID NOs: 10 and 58-62 (claim 1), a human tRNACys (claim 9), or SEQ ID NO: 10 (claim 15), wherein a first nucleotide of the 25-35 contiguous nucleotides corresponds to nucleotide position 1 of the mature human tRNA sequence; at least part of the sequence of 25-35 contiguous nucleotides forms a D-loop stem structure; and wherein at least four contiguous nucleotides in (i) of the neuroprotective molecule at the 5'-end are guanosine deoxyribonucleotides. Independent claims 1 and 3 are anticipated by the patented claims. Dependent claims 2 comprises SEQ ID NOs, 10, 58-62. Thus, the instant claims are obvious over the patented claims. Instant claims 2, 4-22 are obvious variants of patented claims 2-8, 10-14, and 16-22. Claims 1-22 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-12 of U.S. Patent No. 9,676,810. Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are anticipated by, or obvious variants of, the claims of the patent. The instant Application, is a CONTINUATION of US Application No. 16/577,857 (now abandoned), which is a CONTINUATION of US Patent No. 10,457,939, which is a CONTINUATION of US Patent No. 9,676,810. Independent claims 1 and 7 of the ‘810 patent are directed to a neuroprotective molecule consisting of, at least, i) a sequence of 25-35 contiguous nucleotides that is identical to a contiguous sequence between nucleotide 1 and nucleotide 50 of a mature human transfer ribonucleic acid (tRNA) having a sequence selected from the group consisting of SEQ ID NOs: 32, 37, 40-46, 48-55 (claim 1) or a human tRNAala (claim 7), wherein a first nucleotide of the 25-35 contiguous nucleotides corresponds to nucleotide position 1 of the mature human tRNA sequence; at least part of the sequence of 25-35 contiguous nucleotides forms a D-loop stem structure; and wherein at least four contiguous nucleotides in (i) of the neuroprotective molecule at the 5'-end are guanosine deoxyribonucleotides. Independent claims 1 and 3 are anticipated by the patented claims. Dependent claim 2 comprises SEQ ID NOs: 32, 37, 40-46 and 48-55. Thus, the instant claims are obvious over the patented claims. Instant claims 2, 4-22 are obvious variants of patented claims 2-6, and 8-12. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KIMBERLY A ARON whose telephone number is (571)272-2789. The examiner can normally be reached Monday-Friday 9AM-5PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at 571-272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. KAA /CHRISTOPHER M BABIC/Supervisory Patent Examiner, Art Unit 1633
Read full office action

Prosecution Timeline

Nov 13, 2023
Application Filed
Jun 24, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12742152
DIVERSE ANTIGEN BINDING DOMAINS, NOVEL PLATFORMS AND OTHER ENHANCEMENTS FOR CELLULAR THERAPY
5y 9m to grant Granted Sep 22, 2026
Patent 12716051
TAURINE SUPPLEMENTED CELL CULTURE MEDIUM AND METHODS OF USE
1y 1m to grant Granted Aug 25, 2026
Patent 12655185
PEPTIDE INHIBITORS OF INTERLEUKIN-23 AND THEIR USE TO TREAT INFLAMMATORY DISEASES
7y 4m to grant Granted Jun 16, 2026
Patent 12636348
TREATMENT OF OCULAR NEOVASCULARIZATION USING ANTI-VEGF PROTEINS
5y 0m to grant Granted May 26, 2026
Patent 12637675
SUGAR CHAIN-RELATED GENE AND USE THEREOF
3y 11m to grant Granted May 26, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
54%
Grant Probability
90%
With Interview (+35.2%)
3y 6m (~7m remaining)
Median Time to Grant
Low
PTA Risk
Based on 437 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month