DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s election without traverse of group II, ocular hypertension, and SEQ ID NOs: 5555 and 5556, and prednisone in the reply filed on 10/29/24 is acknowledged. The four sequences in claim 151 have been searched and examined.
Claims 141, 142, 149, 153, 154, 164, 166, 167, 169, and 172 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/29/24.
The instant method is free of the prior art with respect to SEQ ID NOs: 5555, 5556, 5533, and 5534, as recited in cancelled claim 151. The remainder of the sequences have not been searched, as explained in the Improper Markush rejection, below.
Improper Markush Rejection
Claim 175 is rejected on the judicially-created basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). The improper Markush grouping includes species of the claimed invention that do not share both a substantial structural feature and a common use that flows from the substantial structural feature. The members of the improper Markush grouping do not share a substantial feature and/or a common use that flows from the substantial structural feature for the following reasons: The claims are directed to a large multitude of siRNA sequences that have no common searchable core. The large genus of nucleotide sequences each have a different sequence, wherein the activity of the siRNA is dependent upon the specific order of nucleotides. One cannot be substituted for another with expectation of identical activity.
In response to this rejection, Applicant should either amend the claim(s) to recite only individual species or grouping of species that share a substantial structural feature as well as a common use that flows from the substantial structural feature, or present a sufficient showing that the species recited in the alternative of the claims(s) in fact share a substantial structural feature as well as a common use that flows from the substantial structural feature. This is a rejection on the merits and may be appealed to the Board of Patent Appeals and Interferences in accordance with 35 U.S.C. 134 and 37 CFR 41.31(a)(1).
When the Markush grouping is for alternatives of chemical compounds, they shall be regarded as being of a similar nature where the following criteria are fulfilled:
(A) All alternatives have a common property or activity; and
(B) (1) A common structure is present, i.e., a significant structural element is shared by all of the alternatives; or
(B) (2) In cases where the common structure cannot be the unifying criteria, all alternatives belong to a recognized class of chemical compounds in the art to which the invention pertains.
In paragraph (B)(1), above, the words “significant structural element is shared by all of the alternatives” refer to cases where the compounds share a common chemical structure which occupies a large portion of their structures, or in case the compounds have in common only a small portion of their structures, the commonly shared structure constitutes a structurally distinctive portion in view of existing prior art, and the common structure is essential to the common property or activity. The structural element may be a single component or a combination of individual components linked together.
In paragraph (B)(2), above, the words “recognized class of chemical compounds” mean that there is an expectation from the knowledge in the art that members of the class will behave in the same way in the context of the claimed invention. In other words, each member could be substituted one for the other, with the expectation that the same intended result would be achieved.
In order for the members of the Markush group to belong to “recognized class of chemical compounds” there must be an expectation that the members of the class will behave in the same way in the context of the claimed invention. In other words, each member of the class could be substituted one for the other with the expectation that the same intended result would be achieved. In the instant case, activity of any specific siRNA is dependent upon the specific sequence of nucleotides. There is no expectation that any one of the nucleotide sequences as claimed can be substituted for any of the other with a completely different sequence with the expectation of the same activity.
Being a siRNA is not sufficient to meet the criteria of a single structural similarity. Certainly not every single possible siRNA could be examined in the same application. According to MPEP 2117, “Members of a Markush group share a "single structural similarity" when they belong to the same recognized physical or chemical class or to the same art-recognized class. A recognized physical class, a recognized chemical class, or an art-recognized class is a class wherein there is an expectation from the knowledge in the art that members of the class will behave in the same way in the context of the claimed invention.” The instant siRNAs are not functionally equivalent and would not be expected to have identical activity and behave in the same way. Each has a different sequence and the specific activity is dependent upon the specific order of nucleotides.
As set forth in MPEP2117, “Note that where a Markush group includes only materials from a recognized scientific class of equivalent materials or from an art-recognized class, "the mere existence of such a group in an application tend[s] to prove the equivalence of its members and when one of them [is] anticipated the group [is] therefore rendered unpatentable, in the absence of some convincing evidence of some degree of non-equivalency of one or more of the remaining members." In re Ruff, 256 F.2d 590, 598-99, 118 USPQ 340, 348 (CCPA 1958)("[A]ctual equivalence is not enough to justify refusal of a patent on one member of a group when another member is in the prior art. The equivalence must be disclosed in the prior art or be obvious within the terms of Section 103." Id. at 599, 118 USPQ at 348).”
In the instant case, art against any one siRNA would not be evidence against any of the remaining members that have completely different sequences and do not have identical activity.
For example, in Ex Parte CHETTIER (Appeal 2016-003639), the Board affirmed an improper Markush grouping of various sequences because: “The sequences shown in Table 1 do not share any common sequence, and therefore do not share a common structure. For example, the first two sequences shown in Table 1 are ggtgattctgaagacc[A/G]ctgctatatgtcatct
and taaaggatgggaactg[A/C]aactagaagaccgtca. (Spec. 57.4) Although both sequences, like all DNA sequences, are made up of the same four bases, they do not share any significant similarity in the order in which those bases are arranged. Thus, the structures of the DNA molecules represented by the sequences are different. We therefore agree with the Examiner that the 133 DNA sequences shown in the Specification’s Table 1 do not make up a proper Markush group.” (page 4). The Board set forth that although the sequences share a common property of being SNPs, the sequences include a position where the specific base varies. The property therefore is not a structural similarity that is shared by the sequences and there is variation due to location at different loci throughout the genome (page 5).
Response to Arguments
Applicant argues that the siRNAs comprise sense and corresponding antisense strands recited in claim 175 belong to an art recognized class of polyribonucleotides and points to Narva, wherein the Board found that the agents hybridized into dsRNA molecules and encode ROP proteins. Applicant argues that the siRNAs share a common use of inhibiting ANGPTL7. Applicant argues that two siRNAs targeted to different regions of ANGPTL7 had similar activity and draws the conclusion that they are therefore functionally equivalent.
The two siRNAs compared by applicant are not representative of the differing activities of the thousands of claimed siRNAs. Even with those having similar inhibitory activities, this does not equate to being functionally equivalent. Each of the siRNAs have different activity levels wherein the activity is dependent upon the specific order of nucleotides.
The instant claims are not the same as those considered in Narva, wherein the sequences encoded the same protein. The instant siRNAs each have different activities that are dependent upon the specific order of nucleotides.
Regarding Chettier, applicant argues that the sequences were found throughout the genome rather than in a single gene. This does not negate the fact that the Board affirmed an improper Markush grouping of various sequences because: “The sequences shown in Table 1 do not share any common sequence, and therefore do not share a common structure.” The instant siRNAs do not share a common sequence. “Although both sequences, like all DNA sequences, are made up of the same four bases, they do not share any significant similarity in the order in which those bases are arranged. Thus, the structures of the DNA molecules represented by the sequences are different. We therefore agree with the Examiner that the 133 DNA sequences shown in the Specification’s Table 1 do not make up a proper Markush group.” (page 4). This is the same situation as the instant siRNAs that share the same four bases but do not share any significant similarity in the order in which the bases are arranged. The Board set forth that although the sequences share a common property of being SNPs, the sequences include a position where the specific base varies.
Applicant argues that Chettier does not require identical activity. The examiner did not assert that Chettier requires such. The rejection set forth that according to MPEP 2117, “Members of a Markush group share a "single structural similarity" when they belong to the same recognized physical or chemical class or to the same art-recognized class. A recognized physical class, a recognized chemical class, or an art-recognized class is a class wherein there is an expectation from the knowledge in the art that members of the class will behave in the same way in the context of the claimed invention.” The siRNAs would not be expected to behave in the same way, or have identical activity, in the context of the claimed invention. Each has a different activity that is dependent upon the order of nucleotides.
Additionally, each member could be substituted one for the other, with the expectation that the same intended result would be achieved. Applicant’s arguments (Table 3) demonstrate that each does not have the same intended result. The siRNAs do not have identical activity and the activity is dependent upon the specific order of nucleotides.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 150, 152, 165, 168, 171, 173, 174, and 176 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.’
The claims are directed to a method of administering any siRNA “for inhibiting expression of ANGPTL7”. The specification does not adequately describe the structure required for the function of inhibiting the expression of any ANGPTL7 sequence.
The claims encompass a method of introducing any siRNA for inhibiting the expression of any ANGPTL7 sequence, as well as encompass any ANGPTL7 homolog or allele from any species known or yet to be discovered of ANGPTL7, as well as DNA genomic fragments, spliced variants or fragment that retains ANGPTL7-like activity.
Although the specification discloses siRNAs targeted to a ANGPTL7 sequence, the specification does not describe such agents directed to any other species of ANGPTL7 to describe the instantly claimed genus of any ANGPTL7. Each of the instantly disclosed siRNAs is targeted to a single sequence, although the claims are drawn to any ANGPTL7. One of ordinary skill in the art could not make such agents to any ANGPTL7 without knowledge of the sequence.
Additionally, the claims do not require any specific structural relationship between the siRNA and any specific target sequence. The claims encompass siRNAs that are targeted to any target that has the secondary effect of inhibiting ANGPTL7, a genus of siRNAs that has not been adequately described in the instant specification.
The specification discloses siRNAs with an antisense strand that is complementary to a specific ANGPTL7 sequence, which is not representative of any siRNA for inhibiting expression of any ANGPTL7.
The MPEP states that for a generic claim, the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. See MPEP § 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP § 2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad genus. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618. Additionally, in Carnegie Mellon University v. Hoffman-La Roche Inc., Nos. 07-1266, -1267 (Fed. Cir. Sept. 8, 2008), the Federal Circuit affirmed that a claim to a genus described in functional terms was not supported by the specification’s disclosure of species that were not representative of the entire genus. Furthermore, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated:
"A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials." Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398.
The claims are rejected under the written description requirement for failing to disclose adequate species to represent the claimed genus, the genus being siRNAs for inhibiting the expression of ANGPTL7.
The Guidelines for Examination of Patent Applications under the 35 USC § 112, first paragraph, “Written Description” Requirement”, published at Federal Register, Vol. 66, No. 4, pp. 1099-1111 outline the method of analysis of claims to determine whether adequate written description is present. The first step is to determine what the claim as a whole covers, i.e., discussion of the full scope of the claim. Second, the application should be fully reviewed to understand how applicant provides support for the claimed invention including each element and/or step, i.e., compare the scope of the claim with the scope of the description. Third, determine whether the applicant was in possession of the claimed invention as a whole at the time of filing.
To achieve the desired function, it appears that the structure is required to be an siRNA having an antisense strand that is fully complementary to a specific ANGPTL7 sequence. For example, Elbashir et al. (The EMBO Journal, Vol. 20, No. 23, pages 6877-6888, 2001) teaches that duplexes of 21-23 nt RNAs are the sequence specific mediators of RNAi and that even single mismatches between the siRNA duplex and the target mRNA abolish interference (abstract and page 6888).
Therefore, the scope of the claimed invention is broad and the skilled artisan would not be able to envisage the entire genus claimed of siRNAs that are for inhibiting the expression of any ANGPTL7 such that the skilled artisan would recognize that the applicant was in possession of the claimed genus at the time of filing.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 150, 152, 165, 168, 171, 173, 174, and 176 is/are rejected under 35 U.S.C. 103 as being unpatentable over Gottesman et al. (US 2020/0399640 A1), in view of Lo et al. (IOVS, February 2003, Vol. 44, No. 2, 473-485).
Gottesman et al. teach oligonucleotide compositions that inhibit ANGPTL7 and reduce intraocular pressure when administered to an eye. The oligonucleotide compositions contain nucleoside modifications (abstract).
Gottesman et al. teach: [0008] In one aspect, provided is a composition comprising an inhibitor or modulator of ANGPTL7 that is efficacious in treating glaucoma and ocular hypertension (instant claim 152). In some embodiments, the inhibitor or modulator of ANGPTL7 is an RNAi. In some embodiments, the RNAi is siRNA (instant claim 150).
Gottesman et al. teach: [0062] ANGPTL7 is overexpressed in the aqueous humor of patients with glaucoma and is upregulated by glaucomatous conditions such as TGFβ and dexamethasone exposure. Therefore, it would have been obvious to inhibit ANGPTL7 with a siRNA targeting ANGPTL7, as taught by Gottesman et al., wherein the condition is glaucoma and is upregulated by dexamethasone exposure, a glucocorticoid (instant claims 150, 152, 168, and 173).
Although Gottesman et al. teach that ANGPTL7 is upregulated by dexamethasone rather than the condition being dexamethasone-induced, it was known to treat glaucoma with an ANGPTL7 siRNA in a subject that has been subjected to dexamethasone exposure.
Additionally, Lo et al. teach that dexamethasone induces TIGR/MYOC only in HTM cells, which is linked to glaucoma (page 473) and is integral to glaucoma pathophysiology (page 474). Lo et al. teach that glaucoma develops in patients with mutated TIGR/MYOC (page 482).
Lo et al. teaches: TIGR/MYOC was first identified as a gene upregulated in HTM cells with long-term steroid treatment in culture. The initial excitement surrounding this discovery was the prospect that this gene could be responsible for steroid-induced glaucoma. Establishing the connection between TIGR/MYOC function and pressure regulation has been difficult and remains the object of intense research and controversy. Our data show that in the cell types studied, TIGR/MYOC was significantly induced by DEX in HTM only. By comparing expression profiles, we have identified additional genes that share this tissue-specific induction. This set of genes, though far from complete, confirms at the molecular level the primacy of the role of the ECM in the development of steroid-induced glaucoma. Most important, these genes reveal the presence of new, potentially protective mechanisms that may also become activated in the cells of the HTM after treatment with DEX (page 483).
Therefore, it would have been obvious to practice the method of Gottesman et al. in a glucocorticoid-induced ophthalmic condition, more specifically dexamethasone-induced glaucoma.
Gottesman et al. teaches detecting loss-of-function mutants ([0010], [0011], [0042], [0043], Table 3, [1170]) (instant claim 171).
The instant specification does not clearly set forth a definition for a subject to be ANGPTL7 reference (instant claim 165). However, Gottesman et al. teaches loss-of-function mutations and utilizing gRNAs for such. Therefore, it is considered obvious for the individual to have been genotyped and be a ANGPTL7 reference because it would have been an obvious parameter in selecting a suitable patient for treatment.
Gottesman et al. teach treating a human subject [0099] (instant claim 174); and teaches incorporation of 2’-fluoro modifications into the siRNA [0021](instant claim 176).
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 150, 152, 165, 168, 171, and 173-176 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim 2 of U.S. Patent No. 11,865,134 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because US ‘134 B2 recites: A method of decreasing a glucocorticoid-induced ophthalmic condition in a subject treated with a glucocorticoid, the method comprising administering an Angiopoietin-Like 7 (ANGPTL7) inhibitor to the subject, wherein: the ANGPTL7 inhibitor is a double stranded ribonucleic acid (dsRNA) inhibitory nucleic acid molecule for inhibiting expression of ANGPTL7; and the dsRNA inhibitory nucleic acid molecule comprises a sense strand and an antisense strand forming a double stranded region; and the sense strand comprises a nucleotide sequence comprising AGACAGUAUAAGCAAGGGUUA (SEQ ID NO:5555) and wherein the antisense strand comprises a nucleotide sequence comprising UAACCCUUGCUUAUACUGUCUCC (SEQ ID NO:5556); and/or the sense strand comprises a nucleotide sequence comprising ACACUUCCUUGUGUCUAUAGA (SEQ ID NO:5533) and wherein the antisense strand comprises a nucleotide sequence comprising UCUAUAGACACAAGGAAGUGUCG (SEQ ID NO:5534). The species of US ‘134 B2 anticipates the instant genus. Instant claim 152 recites conditions that fall within the genus of claim 2 of US ’134 B2; and instant claim 168 recites various glucocorticoids that fall within the genus of claim 2 of US ’134 B2, wherein the specifications are identical to define the inventions.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/Primary Examiner, Art Unit 1636