DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 5/5/26 has been entered.
Applicant’s election without traverse of group II, ocular hypertension, and SEQ ID NOs: 5555 and 5556, and prednisone in the reply filed on 10/29/24 is acknowledged. The four sequences in claim 177 have been searched and examined.
Claims 141, 142, 149, 153, 154, 164, 166, 167, 169, and 172 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/29/24.
The instant method is free of the prior art with respect to administration of SEQ ID NOs: 5555, 5556, 5533, and 5534, as recited in cancelled claim 151.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed application, Application Nos. 63171218 and 63154576, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. The applications do not disclose delivery of the ANGPTL7 inhibitor to the limbal ring tissue of an eye of the subject.
Should applicant disagree, applicants are encouraged to point out with particularity by page and line number where such support might exist. Therefore, the effective filing date of the instant claims is considered, for purposes of prior art, to be 10/1/21, which is the filing date of application 63251175.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 152 and 173 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 152 recites various species for the glucocorticoid-induced ophthalmic condition of claim 150, although claim 150 already requires for the condition to be glaucoma. Claim 152 recites glaucoma in the alternative although glaucoma is the recited condition of claim 150 and therefore claim 152 fails to further limit the base claim. Claim 173 is rejected because it depends from claim 152. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 150, 152, 165, 168, 173, and 176-178 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.’
The claims are directed to a method of administering any siRNA that is an inhibitor of ANGPTL7. The specification does not adequately describe the structure required for the function of inhibiting the expression of any ANGPTL7 sequence.
The claims encompass a method of introducing any siRNA for inhibiting the expression of any ANGPTL7 sequence, as well as encompass any ANGPTL7 homolog or allele from any species known or yet to be discovered of ANGPTL7, as well as DNA genomic fragments, spliced variants or fragment that retains ANGPTL7-like activity.
Although the specification discloses siRNAs targeted to a ANGPTL7 sequence, the specification does not describe such agents directed to any other species of ANGPTL7 to describe the instantly claimed genus of any ANGPTL7. Each of the instantly disclosed siRNAs is targeted to a single sequence, although the claims are drawn to any ANGPTL7. One of ordinary skill in the art could not make such agents to any ANGPTL7 without knowledge of the sequence.
Additionally, the claims do not require any specific structural relationship between the siRNA and any specific target sequence. The claims encompass siRNAs that are targeted to any target that has the secondary effect of inhibiting ANGPTL7, a genus of siRNAs that has not been adequately described in the instant specification.
The specification discloses siRNAs with an antisense strand that is complementary to a specific ANGPTL7 sequence, which is not representative of any siRNA for inhibiting expression of any ANGPTL7.
The MPEP states that for a generic claim, the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. See MPEP § 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP § 2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad genus. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618. Additionally, in Carnegie Mellon University v. Hoffman-La Roche Inc., Nos. 07-1266, -1267 (Fed. Cir. Sept. 8, 2008), the Federal Circuit affirmed that a claim to a genus described in functional terms was not supported by the specification’s disclosure of species that were not representative of the entire genus. Furthermore, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated:
"A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials." Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398.
The claims are rejected under the written description requirement for failing to disclose adequate species to represent the claimed genus, the genus being siRNAs that function as ANGPTL7 inhibitors.
The Guidelines for Examination of Patent Applications under the 35 USC § 112, first paragraph, “Written Description” Requirement”, published at Federal Register, Vol. 66, No. 4, pp. 1099-1111 outline the method of analysis of claims to determine whether adequate written description is present. The first step is to determine what the claim as a whole covers, i.e., discussion of the full scope of the claim. Second, the application should be fully reviewed to understand how applicant provides support for the claimed invention including each element and/or step, i.e., compare the scope of the claim with the scope of the description. Third, determine whether the applicant was in possession of the claimed invention as a whole at the time of filing.
To achieve the desired function, it appears that the structure is required to be an siRNA having an antisense strand that is fully complementary to a specific ANGPTL7 sequence. For example, Elbashir et al. (The EMBO Journal, Vol. 20, No. 23, pages 6877-6888, 2001) teaches that duplexes of 21-23 nt RNAs are the sequence specific mediators of RNAi and that even single mismatches between the siRNA duplex and the target mRNA abolish interference (abstract and page 6888).
Therefore, the scope of the claimed invention is broad and the skilled artisan would not be able to envisage the entire genus claimed of siRNAs that are for inhibiting the expression of any ANGPTL7 such that the skilled artisan would recognize that the applicant was in possession of the claimed genus at the time of filing.
Response to Arguments
Applicant argues that the specification of the present application discloses thousands of pairs of sense and antisense siRNA molecules (see, Applicant's specification at Table 4 (disclosing 1,147 such pairs); see also, Applicant's specification at Table 5 (disclosing 286 pairs of sense and antisense siRNA molecules); see also, Applicant's specification at Table 6 (disclosing 301 such pairs)). In this regard, Applicant submits that a skilled artisan would have been able to identify more pairs of sense and antisense siRNA molecules by employing common tools (see, https://web.archive.org/web/20200717024733/ http://www.invivogen.com/simawizard/design.php (reporting the Internet page of the "siRNA Wizard Software 3.1" package as of July 17, 2020) (last visited March 3, 2026); see also, Ajinomoto Co. v. Int'l Trade Comm'n, 932 F.3d 1342, 1359 (Fed. Cir. 2019) (quoting with approval "the Commission's finding that 'enhancing promoter activity was well-known' and that a skilled artisan 'would have been able to identify more potent promoters by employing common tools for measuring RNA transcription"' (emphasis added)). Because a skilled artisan would have been able to identify even more pairs of sense and antisense siRNA molecules by employing common tools, there was no need for Applicant's specification to disclose more siRNA molecules than the 1,734 that such specification already discloses.
The rejection is not based upon the need for any particular quantity of pairs of sequences, but rather a sufficient description of the structure required for the function. Not any siRNA designed by the tools argued by applicant results in an inhibitory siRNA to the target and the specification does not disclose the activity level of each. For example, McIninch et al. (WO 2023/056478 A1) disclose various ANGPTL7 siRNAs wherein some do not result in target inhibition (see Table 9).
Additionally, as set forth in the rejection above, the siRNA is not even required to have any specific relationship with any specific target sequence, but can rather be targeted to any other target that has the secondary effect of inhibiting ANPTL7, a genus of siRNAs that have not been adequately described in the specification.
It is noted that claim 177 would not be subject to the rejection if the claim limited the siRNAs to the recited sequences, but the claim utilizes negative limitations to exclude the recited sequences and therefore is directed to the genus set forth in the rejection that has not been adequately described in the specification.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 150, 152, 165, 168, 173, and 176-178 is/are rejected under 35 U.S.C. 103 as being unpatentable over Nair et al. (US 2024/0409927 A1), in view of Gottesman et al. (US 2020/0399640 A1), and Kersey et al. (Eye, 2006, 20, 407-416).
Nair et al. teach RNAi agents for targeted delivery to the eye and methods of treating subjects having an ocular disease using such agents (abstract), wherein the target gene is ANGPTL7 [0029] and the ocular disease is glaucoma [0033], wherein the subject is human [0032], and wherein the ocular target tissue is the limbal ring ([0030] and [0056])(instant claims 150 and 152). The siRNA is delivered via intraocular injection [0121].
Nair et al. teaches incorporation of modifications for improving the pharmacokinetic properties of the RNAi agent, wherein the modification can be 2’-F ([0205]-[0206])(instant claim 176).
Nair et al. teaches siRNAs targeting ANGPTL7 that are not the sequences of instant claim 177.
Nair et al. does not teach that the glaucoma is glucocorticoid induced.
Gottesman et al. teach oligonucleotide compositions that inhibit ANGPTL7 and reduce intraocular pressure when administered to an eye. The oligonucleotide compositions contain nucleoside modifications (abstract).
Gottesman et al. teach: [0008] In one aspect, provided is a composition comprising an inhibitor or modulator of ANGPTL7 that is efficacious in treating glaucoma and ocular hypertension (instant claim 152). In some embodiments, the inhibitor or modulator of ANGPTL7 is an RNAi. In some embodiments, the RNAi is siRNA (instant claim 150).
Gottesman et al. teach: [0062] ANGPTL7 is overexpressed in the aqueous humor of patients with glaucoma and is upregulated by glaucomatous conditions such as TGFβ and dexamethasone exposure. Therefore, it would have been obvious to inhibit ANGPTL7 with a siRNA targeting ANGPTL7, as taught by Nair et al. and Gottesman et al., wherein the condition is glaucoma and is upregulated by dexamethasone exposure, a glucocorticoid (instant claims 150, 168, and 173).
Although Gottesman et al. teach that ANGPTL7 is upregulated by dexamethasone rather than the condition being dexamethasone-induced, it was known to treat glaucoma with an ANGPTL7 siRNA in a subject that has been subjected to dexamethasone exposure. The condition meets the limitation of being dexamethasone-induced because the upregulated state of ANGPTL7 in the species of glaucoma of Gottesman et al. is dexamethasone-induced.
Therefore, it would have been obvious to practice the method of Nair et al. and Gottesman et al. in a glucocorticoid-induced ophthalmic condition, more specifically dexamethasone-induced glaucoma with a reasonable expectation of success of treatment of the glaucoma via delivery to the limbal ring.
Gottesman et al. teaches detecting loss-of-function mutants ([0010], [0011], [0042], [0043], Table 3, [1170]) (instant claim 165).
The instant specification does not clearly set forth a definition for a subject to be ANGPTL7 reference (instant claim 165). However, Gottesman et al. teaches loss-of-function mutations and utilizing gRNAs for such. Therefore, it is considered obvious for the individual to have been genotyped and be a ANGPTL7 reference because it would have been an obvious parameter in selecting a suitable patient for treatment.
Gottesman et al. teach treating a human subject [0099] and teaches incorporation of 2’-fluoro modifications into the siRNA [0021](instant claim 176).
Additionally, Kersey et al. teach that a corticosteroid-induced IOP rise has been shown to occur with various methods of steroid administration (see Methods of administration), but is most commonly identified as a complication of topical corticosteroid application with drugs such as dexamethasone or prednisolone (instant claim 178).
Therefore, it was known to inhibit ANGPTL7 with siRNA targeting a specific ANGPTL7 sequence via intraocular injection to the limbal ring, as taught by Nair et al. It was also known that glucocorticoids including dexamethasone or prednisolone can cause the IOP increase in glaucoma, as taught by Kersey et al. It would have been obvious to treat the patient with glaucoma (either caused by the glucocorticoid or not) via the method of Nair et al. with a reasonable expectation of success.
It would have also been obvious to practice the method of Nair et al. in the subject with the glucocorticoid-induced glaucoma because these are patients in need of a different treatment other than the glucocorticoid. Kersey et al.t each that cessation of corticosteroid therapy is the ideal course of action (page 413).
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 150, 152, 165, 168, 173, and 176-179 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3 of U.S. Patent No. 11,865,134 B2, in view of Nair et al. (US 2024/0409927 A1), in view of Gottesman et al. (US 2020/0399640 A1), and Kersey et al. (Eye, 2006, 20, 407-416).
Although the claims at issue are not identical, they are not patentably distinct from each other because US ‘134 B2 recites: A method of decreasing a glucocorticoid-induced ophthalmic condition in a subject treated with a glucocorticoid, the method comprising administering an Angiopoietin-Like 7 (ANGPTL7) inhibitor to the subject, wherein: the ANGPTL7 inhibitor is a double stranded ribonucleic acid (dsRNA) inhibitory nucleic acid molecule for inhibiting expression of ANGPTL7; and the dsRNA inhibitory nucleic acid molecule comprises a sense strand and an antisense strand forming a double stranded region; and the sense strand comprises a nucleotide sequence comprising AGACAGUAUAAGCAAGGGUUA (SEQ ID NO:5555) and wherein the antisense strand comprises a nucleotide sequence comprising UAACCCUUGCUUAUACUGUCUCC (SEQ ID NO:5556); and/or the sense strand comprises a nucleotide sequence comprising ACACUUCCUUGUGUCUAUAGA (SEQ ID NO:5533) and wherein the antisense strand comprises a nucleotide sequence comprising UCUAUAGACACAAGGAAGUGUCG (SEQ ID NO:5534). The species of US ‘134 B2 anticipates the instant genus. The instant claims are directed to the treatment of glaucoma, which is ophthalmic inflammation, with the same compounds. The specification of US ‘134 B2 defines the glucocorticoid as including the instantly recited glucocorticoids.
Instant claims 168 and 173 recite various glucocorticoids that fall within the genus of US ’134 B2, wherein the specifications are identical to define the inventions.
Nair et al. teach RNAi agents for targeted delivery to the eye and methods of treating subjects having an ocular disease using such agents (abstract), wherein the target gene is ANGPTL7 [0029] and the ocular disease is glaucoma [0033], wherein the subject is human [0032], and wherein the ocular target tissue is the limbal ring ([0030] and [0056])(instant claims 150 and 152). The siRNA is delivered via intraocular injection [0121].
Nair et al. teaches incorporation of modifications for improving the pharmacokinetic properties of the RNAi agent, wherein the modification can be 2’-F ([0205]-[0206])(instant claim 176). Therefore, it would have been obvious to incorporate a 2’ F modification with a reasonable expectation of the benefits taught by Nair et al.
It would have been obvious for the sequences not to be the sequences of claim 177 because Nair et al. teaches siRNAs targeting ANGPTL7 that inhibit ANGPTL7 that are not the sequences of instant claim 177.
Gottesman et al. teach oligonucleotide compositions that inhibit ANGPTL7 and reduce intraocular pressure when administered to an eye. The oligonucleotide compositions contain nucleoside modifications (abstract).
Gottesman et al. teach: [0008] In one aspect, provided is a composition comprising an inhibitor or modulator of ANGPTL7 that is efficacious in treating glaucoma and ocular hypertension (instant claim 152). In some embodiments, the inhibitor or modulator of ANGPTL7 is an RNAi. In some embodiments, the RNAi is siRNA (instant claim 150).
Gottesman et al. teach: [0062] ANGPTL7 is overexpressed in the aqueous humor of patients with glaucoma and is upregulated by glaucomatous conditions such as TGFβ and dexamethasone exposure. Therefore, it would have been obvious to inhibit ANGPTL7 with a siRNA targeting ANGPTL7, as taught by Nair et al. and Gottesman et al., wherein the condition is glaucoma and is upregulated by dexamethasone exposure, a glucocorticoid (instant claims 150, 168, and 173).
Although Gottesman et al. teach that ANGPTL7 is upregulated by dexamethasone rather than the condition being dexamethasone-induced, it was known to treat glaucoma with an ANGPTL7 siRNA in a subject that has been subjected to dexamethasone exposure. The condition meets the limitation of being dexamethasone-induced because the upregulated state of ANGPTL7 in the species of glaucoma of Gottesman et al. is dexamethasone-induced.
Therefore, it would have been obvious to practice the method of Nair et al. and Gottesman et al. in a glucocorticoid-induced ophthalmic condition, more specifically dexamethasone-induced glaucoma with a reasonable expectation of success of treatment of the glaucoma via delivery to the limbal ring.
Gottesman et al. teaches detecting loss-of-function mutants ([0010], [0011], [0042], [0043], Table 3, [1170]) (instant claim 165).
The instant specification does not clearly set forth a definition for a subject to be ANGPTL7 reference (instant claim 165). However, Gottesman et al. teaches loss-of-function mutations and utilizing gRNAs for such. Therefore, it is considered obvious for the individual to have been genotyped and be a ANGPTL7 reference because it would have been an obvious parameter in selecting a suitable patient for treatment.
Gottesman et al. teach treating a human subject [0099] and teaches incorporation of 2’-fluoro modifications into the siRNA [0021](instant claim 176).
Additionally, Kersey et al. teach that a corticosteroid-induced IOP rise has been shown to occur with various methods of steroid administration (see Methods of administration), but is most commonly identified as a complication of topical corticosteroid application with drugs such as dexamethasone or prednisolone (instant claim 178).
Therefore, it was known to inhibit ANGPTL7 with siRNA targeting a specific ANGPTL7 sequence via intraocular injection to the limbal ring, as taught by Nair et al. It was also known that glucocorticoids including dexamethasone or prednisolone can cause the IOP increase in glaucoma, as taught by Kersey et al. It would have been obvious to treat the patient with glaucoma (either caused by the glucocorticoid or not) via the method of Nair et al. with a reasonable expectation of success.
It would have also been obvious to practice the method of Nair et al. in the subject with the glucocorticoid-induced glaucoma because these are patients in need of a different treatment other than the glucocorticoid. Kersey et al.t each that cessation of corticosteroid therapy is the ideal course of action (page 413).
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/Primary Examiner, Art Unit 1636