Prosecution Insights
Last updated: August 17, 2026
Application No. 18/511,486

Minimal Human-Derived Virus-Like Particles and Methods of Use Thereof for Delivery of Biomolecules

Non-Final OA §103§112
Filed
Nov 16, 2023
Priority
Nov 16, 2022 — provisional 63/425,900
Examiner
WANG, RUIXUE
Art Unit
1632
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
THE GENERAL HOSPITAL Corporation
OA Round
1 (Non-Final)
57%
Grant Probability
Moderate
1-2
OA Rounds
6m
Est. Remaining
80%
With Interview

Examiner Intelligence

Grants 57% of resolved cases
57%
Career Allowance Rate
62 granted / 108 resolved
-2.6% vs TC avg
Strong +22% interview lift
Without
With
+22.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 3m
Avg Prosecution
62 currently pending
Career history
169
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
40.4%
+0.4% vs TC avg
§102
16.4%
-23.6% vs TC avg
§112
35.6%
-4.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 108 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Acknowledgement is hereby made of receipt and entry of the communication filed on March, 30, 2026. Claims 8-27 and 37-41 are pending. Claims 8-18 and 37-41 are currently examined. Claims 19-27 are withdrawn. Election/Restrictions Applicant's election without traverse of Group IV (8-18), in the reply filed on March, 30, 2026, is acknowledged. The new added claims 37-41 are considered. Accordingly, claims 19-27 are withdrawn as being directed to a non-elected group. Claim Objections Claims 9-10, 16 and 18 is objected to because of the following informalities: Claim 9 recites abbreviation RBD without spelling it out the first time it appears in the claims set. This objection is also extended to “FN3, RGD, VHH, VNAR” in claim 10. Claims 16 and 18 recite a sequence by referring a table instead of using SEQ ID NOs. According MPEP 2173.05(s), where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience." Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted). Applicant is required to make proper corrections. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION. —The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 8-18 and 37-41 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The base claims 8 and 9 recite a term “disposed” that renders the claims indefinite. It is unclear what the exact position of the “disposed” represent for and how the cargo is connected to the VLP by “disposed”. The base claim 8 recites a term “a transmembrane domain” that renders the claim indefinite. It is unclear what this transmembrane domain is belong to, for example, it is not clear if ““a transmembrane domain” from the hENV. The claim 9 recites phrases “wherein the hENV comprises one, two, or all three of: a targeting domain at the N or C terminus, or inserted internally into the protein; a truncation of one to 50 amino acids from the C terminus; and/or one or more RBD mutations” that render the claim indefinite. It is unclear if the “a truncation of one to 50 amino acids from the C terminus” is for the hENV or the RBD. Also, it is not clear where the RBD is from and what the relation between the RBD and the “hENV” in the claim. Also, it is not clear if the “one or more RBD mutations” mean an amino acid mutation or the entire “RBD” mutation. In addition, the rejection is also extended to claim 37 at “a truncation of one to 50 amino acids from the C terminus and/or one or more RBD mutations”, where the “RBD” renders the claim indefinite. For purposes of compact prosecution and applying prior art, the “a truncation of one to 50 amino acids from the C terminus” was interpreted herein to encompass the deletion from either hENV or RBD. The claim 12 recites a term “C RBD mutations” renders the claim indefinite. It is not clear what the ““C RBD mutations” means. The claims 12 and 40 are indefinite because they lack a reference sequence for the cited deletion of 123 to 163 amino acids following amino acid 18 from the C RBD (claim 12), and an insertion corresponding to amino acid 18 or amino acid 114 of wild type HERV W (claim 40). Because the amino acid residues and positions vary in different RBD/HERV and there may have mutations in the same RBD/HERV including the wild type HERV W as well, one of ordinary skill in the art would not be reasonably apprised of the metes and bounds of the invention without a reference sequence. Therefore, a sequence of referred by SEQ ID NO: should be recited in the claims as a reference for the mutations cited the claims. The claim 13 recites a term “chemical” that renders the claim indefinite. It is unclear what the “chemical” is represented for. For example, the instant specification discloses that “including chemicals, e.g., small molecule compounds, and biomolecules, including DNA, RNA…” (See [0072]), however, for example, the NaCl (sodium chloride) can also be one of the chemicals. Thus, one of ordinary skill in the art will not know the metes and bounds of the claim. The claim 15 recites the term “variant” that renders the claim indefinite. It is unclear what exact the “variant” is. The instant specification also does not provide a clear definition for the ‘variant”. Thus, one of ordinary skill in the art will not know the metes and bounds of the claim. The claim 16 recites a protein listed in Tables 2-5. However, Table 3 lists the Nucleotide sequences. Regarding claim 18, the term " preferably" renders the claim indefinite because it is unclear whether the limitations following the phrase are parts of the claimed invention. It is noted any interpretation of the claims set forth above does not relieve Applicant of the responsibility of responding to this rejection. If the actual interpretation of the claims is different than that posited by the Examiner, additional rejections and art may be readily applied in a subsequent final Office action. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 8-18 and 37-41 are rejected under 35 U.S.C. 103 as being unpatentable over Keith et al. (WO2020252455A1, published on Dec. 17, 2020, hereinafter “Keith”) as evidenced by Cheynet et al. (Retrovirology. 2006 Jul 4; 3:41) and Lemaître et al. (J Virol. 2014 Dec;88(23):13626-37). The base claim 8 is directed to a targeted human endogenous virus-like particle (theVLP) comprising a human endogenous retroviral (HERV) envelope protein (hENV) and a targeting domain, The base claim 9 is directed to minimal human virus-like particle (mhVLP), comprising a membrane comprising a phospholipid bilayer and a human endogenous retroviral (HERV) envelope protein (hENV), wherein the hENV comprises one, two, or all three of: a targeting domain at the N or C terminus, or inserted internally into the protein; a truncation of one to 50 amino acids from the C terminus; and/or one or more RBD mutations; and a cargo disposed in the core of the mhVLP, wherein the mhVLP does not comprise an exogenous gag, pro and/or pol protein, and wherein the mhVLP further comprises a separate targeting domain. Keith teaches a human-derived virus-like particles (heVLPs), comprising a membrane comprising a phospholipid bilayer with one or more HERV-derived envelope proteins on the external side; one or more HERV-derived GAG proteins in the heVLP core, and a cargo molecule disposed in the core of the heVLP on the inside of the membrane, wherein the heVLP does not comprise a gag protein, and methods of use for delivery of the cargo molecule to cells (See Abstract). Although the name is different, where Keith uses “heVLP” and the instant claims 8 and 9 used “theVLP” and “mhVLP”, Keith teaches a VLP that is comparable to the VLP as claimed by disclosing a VLP comprising HERV envelope protein (hENV), phospholipid bilayer, a cargo. As for the “targeting domain” in claim 8, Keith teaches that in some embodiments, the HERV ENV can be truncated or fused to an scFv or other targeting polypeptides (See page 3, lines 16-17), where scFv can be a targeting domain and it is obvious that the scFv can be insert either inside the hENV or at the terminus end. Here the description also teaches the “…the hENV comprises one, two, or all three of: a targeting domain at the N or C terminus, or inserted internally into the protein…” as claimed in the claim 9, and also teaches claim 10. As for the “truncation of one to 50 amino acids from the C terminus; and/or one or more RBD mutations” claimed in the claim 9, Keith teaches that the HERV ENV can be truncated (See page 3, lines 16-17). Making gene mutation and truncation is well known in the art. So, one of ordinary skill in the art can make the truncation as claimed based on the routine experimental optimization. In addition, this can be evidenced by Cheynet and Lemaitre’s study. Cheynet teaches that using truncated HERV-W SU subunits, a region consisting of the N-terminal 124 amino acids of the mature SU glycoprotein was determined as the minimal receptor-binding domain (RBD) (See Abstract). Cheynet teaches a 117-144 deletion that is 27 amino acids from the C terminus of the RBD (See page 5, Figure 3). Lemaitre teaches the Herv-k human endogenous retrovirus envelope protein antagonizes tetherin antiviral activity (See Abstract) and HERV-K(HML2) Env-Rec mut1 corresponds to a C-terminal truncated version of the complete Env (41 aa deleted) (See Fig. 5, page 13623). Here the description also teaches the claims 12 and 37. As for the limitation of “mhVLP further comprises a separate targeting domain”, Keith teaches that the HERV ENV can be truncated or fused to an scFv or other targeting polypeptides (See page 3, lines 16-17), where other target polypeptides can be used as a separated targeting domain because Keith teaches that the domain can be dDZFl, dDZF2, DmrA, DmrB, DmrC, FKBP, FRB, GCN4 scFv, 10x/24x GCN4, GFP nanobody and GFP (See page 6, lines 14-16). Thus, the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. Regarding claims 11 and 40, Keith teaches that the HERV ENV can be truncated or fused to an scFv or other targeting polypeptides (See page 3, lines 16-17; page 6, lines 14-16). Although Keith does not explicitly point out the location of the scFv or other targeting domain that fused with the envelope protein, one of skilled in the art can fused the scFv or other targeting domain with the HERV ENV at the needed position for expression. This can also be evidenced by the Lemaitre’ study. Lemaitre teaches that Env mut2 of HERV-K (HML2) has a sequence encoding a glycophosphoinositol lipid-anchoring motif (GLA:CCAAATAAAGGAAGTGGAACCACTTCAGGTACTACCCGTCTTCTATCTGGGCACACGTGTTTCACGTTGACAGGTTTGCTTGGGACGCTAGTAACCATGGGCTTGCTGACT) inserted after aa 631 [nt 8344 of HERV-K(HML2) consensus provirus (See page 13627, right column, paragraph 3), were the motif is inside the HERN ENV gene and the insertion is after a signal sequences as well. Regarding claims 13 and 41, Keith teaches that the cargo is a therapeutic or diagnostic protein or nucleic acid encoding a therapeutic or diagnostic protein (See page 5, lines 1-2), and discloses that delivery of cargo such as proteins, nucleic acids, and/or chemicals into the cytosol of living cells has been a significant hurdle in the development of biological therapeutics (See page 1, lines 17-19). Regarding claims 14-15, Keith teaches that the biomolecule cargo is a gene editing reagent (See page 5, lines 9), where the gene editing reagent comprises a zinc finger (ZF), transcription activator-like effector (TALE) (See page 5, lines 10-15). Regarding claim 16, Keith teaches that Cargo designed for the purposes of epigenome modulation includes the CI CRISPR based nucleases, zinc fingers (ZFs) and TALEs fused to an epigenome modulator or combination of epigenome modulators or a functional derivative thereof 1 o connected together by one or more variable length polypeptide linkers (Tables 2 & 4) (See page 28, lines 7-10), where one of the epigenetic modulators is VP16 (See Table 4 and below) that teaches a cargo selected from instant Table 4 as claimed. PNG media_image1.png 258 503 media_image1.png Greyscale Regarding claim 17, Keith teaches that cargo is a gene editing reagent (See e.g., page 5, lines 9-15), where the genome editing reagents, especially CRISPR-CAS protein (See page 21, lines 17-20). Keith also teaches that the heVLP further comprises one or more guide RNAs that bind to and direct the CRISPR-based genome editing or modulating protein to a target sequence (See page 5, lines 18-21). Regarding claims 18 and 38-39, Keith teaches that the construct 1-1 corresponds to the human endogenous GAG or other phospholipid bilayer recruitment domain. 1-2 corresponds to the cargo. 2 corresponds to an optional guide RNA 1-0, 1-1 and 1-2 are translated in the cytosol where the fusion of 1-1 and 1-2 complexes with guide RNA before it is recruited to the phospholipid bilayer (See page 7, lines 9-21), which indicates that a cargo is fused to a phospholipid bilayer recruitment domain as claimed. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUIXUE WANG whose telephone number is (571)272-7960. The examiner can normally be reached Monday-Friday 8:00 am.. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J. Visone, can be reached on (571) 270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /RUIXUE WANG/Examiner, Art Unit 1672
Read full office action

Prosecution Timeline

Nov 16, 2023
Application Filed
May 11, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12685765
POLYPEPTIDES MIMICKING MPER AND V3-LOOP HIV-1 ENV GLYCOPROTEIN EPITOPES
2y 11m to grant Granted Jul 21, 2026
Patent 12668783
Preparation method and application of vesicle formed by erythrocyte membrane encapsulating Newcastle disease virus
3y 4m to grant Granted Jun 30, 2026
Patent 12662512
CHIMERIC POLYPEPTIDES AND USES THEREOF
4y 2m to grant Granted Jun 23, 2026
Patent 12637704
COMPOSITION AND METHOD FOR IMPROVING DETECTION OF BIOMOLECULES IN BIOFLUID SAMPLES
4y 2m to grant Granted May 26, 2026
Patent 12577589
VACCINES AND USES THEREOF TO INDUCE AN IMMUNE RESPONSE TO SARS-COV2
3y 7m to grant Granted Mar 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
57%
Grant Probability
80%
With Interview (+22.1%)
3y 3m (~6m remaining)
Median Time to Grant
Low
PTA Risk
Based on 108 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month