Prosecution Insights
Last updated: October 04, 2026
Application No. 18/515,118

BASE EDITING OF TRANSTHYRETIN GENE

Non-Final OA §102§103§DP
Filed
Nov 20, 2023
Priority
May 21, 2021 — provisional 63/191,458 +2 more
Examiner
HIBBERT, CATHERINE S
Art Unit
1658
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Beam Therapeutics Inc.
OA Round
1 (Non-Final)
59%
Grant Probability
Moderate
1-2
OA Rounds
11m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allowance Rate
477 granted / 810 resolved
-1.1% vs TC avg
Strong +49% interview lift
Without
With
+48.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
44 currently pending
Career history
847
Total Applications
across all art units

Statute-Specific Performance

§101
8.7%
-31.3% vs TC avg
§103
29.4%
-10.6% vs TC avg
§102
14.3%
-25.7% vs TC avg
§112
32.5%
-7.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 810 resolved cases

Office Action

§102 §103 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . This is the First Office Action on the Merits of US18/515,118 filed on 11/20/2023 which is a CON of PCT/US2022/030359 filed on 05/20/2022 which claims US priority benefit of US Provisionals 63/322,182 filed on 03/21/2022 and 63/191,458 filed on 05/21/2021. Claims 1-20 are pending. Claims 14-20 are withdrawn to non-elected invention group. Claims 1-13 are under examination. Election/Restrictions Applicant’s election without traverse of invention Group I (e.g., claims 1-13) in the reply filed on July 17, 2026 is acknowledged. Claim14-20 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention Group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on July 17, 2026. Information Disclosure Statement Each of the five IDS statements filed on July 17, 2026 and each of the IDS statements filed on 11/20/2023, 09/07/2024, and 12/23/2025 have been considered by the examiner. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-6, and 11-13 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Cowan et al (WO2017-077386 published May 11, 2017; IDS of 09/07/2024 ref #34). Claim interpretation: Functional limitations in the claims are not being interpreted as requiring an active method step. As such, the limitations “serving as a guide polynucleotide to direct a base editor system to effect a nucleobase alternation in the TTR gene” (claim 1) and “wherein the nucleobase alternation effected in the TTR gene comprises disruption of a start codon or disruption of an intron exon splice site” (claim 3) are not interpreted to change the structure of isolated polynucleotide or nucleic acid encoding same. Regarding claims 1, 4, and 5-6, Cowen et al teach a composition comprising a Cas9 guide RNA sequence that is 100% identical to instant SEQ ID NO: 1 (see reference SEQ ID NO:52002) which meets the limitation of an isolated polynucleotide or a nucleic acid encoding same, the polynucleotide comprising a 5'- spacer sequence comprising about 17 to about 23 nucleotides that is homologous to a targeted protospacer sequence within a gene encoding Transthyretin (TTR) adjacent to a NGG protospacer-adjacent motif (PAM) sequence within the genome. The Cowen et al guide sequence is construed to meet the functional limitation of capable of serving as a guide polynucleotide to direct a base editor system to effect a nucleobase alteration in the TTR gene. Regarding claim 2, Cowen et al disclose that their reference SEQ ID NO: 52002 comprises TTR exon 1-2. Reference SEQ ID NO: 52002 is GCCATCCTGCCAAGAATGAG. Note that reference 52002 is 100% identical to instant SEQ ID NO: 1 (5'-GCCAUCCUGCCAAGAAUGAG-3' (GA457). Regarding claim 3, based on the Cowen et al reference SEQ ID NO: 52002 comprising TTR exon 1-2, the sequence of Cowen et al is construed to meet the functional limitation wherein the nucleobase alteration effected in the TTR gene comprises disruption of an intron exon splice site. Regarding claim 4, Cowen et al disclose reference SEQ ID NO: 52002 which is 100% identical to instant SEQ ID NO: 1 (shown just above) which meets the limitation of a spacer sequence at least about 75% identical to: 5'-GCCAUCCUGCCAAGAAUGAG-3' (SEQ ID NO: 1) (GA457). Regarding claim 11, Cowen et al disclose that guide RNAs of their invention are formulated with pharmaceutically acceptable excipients such as carriers, solvents, stabilizers, adjuvants, diluents, etc., depending upon the particular mode of administration and dosage form. (See para 00589-00590.) Regarding claims 12-13, Cowen et al disclose a pharmaceutical comprising a lipid nanoparticle (LNP) comprising the guide RNAs of their invention. (See para 0052.) Thus, Cowen et al anticipates claims 1-6, and 11-13. Claims 1-6 and 11-13 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Bogorad et al (WO2018-007871 published January 11, 2018; IDS of 12/23/2025 ref # 36). Regarding claims 1-4, and 5-6, Bogorad et al teach a composition comprising a Cas9 guide RNA sequence that is 100% identical to instant SEQ ID NO: 3 (see reference SEQ ID NO:2888) which meets the limitation of an isolated polynucleotide or a nucleic acid encoding same, the polynucleotide comprising a 5'- spacer sequence comprising about 17 to about 23 nucleotides that is homologous to a targeted protospacer sequence within a gene encoding Transthyretin (TTR) adjacent to a NGG protospacer-adjacent motif (PAM) sequence within the genome. (See para 00590). The Bogorad et al guide sequence is construed to meet the functional limitation of capable of serving as a guide polynucleotide to direct a base editor system to effect a nucleobase alteration in the TTR gene. Regarding claim 2, Bogorad et al disclose that their reference SEQ ID NO: 2888 comprises TTR exon 1-2. Regarding claim 3, based on the Bogorad et al reference SEQ ID NO: 2888 comprising TTR exon 1-2, the sequence of Bogorad et al is construed to meet the functional limitation wherein the nucleobase alteration effected in the TTR gene comprises disruption of an intron exon splice site. Regarding claim 4, Bogorad et al teach a guide sequence that is 100% identical to instant SEQ ID NO:3: 5'-GCAACUUACCCAGAGGCAAA-3' (GA459). Bogorad et al reference SEQ ID NO: 2888 inherently meets the limitation of instant claims 2-3. Regarding claims 11-13, Bogorad et al disclose pharmaceutical compositions comprising lipid nanoparticles comprising Cas9 or Cpf1 mRNA and gRNA of their invention. (See para 00388; 00390; 00406). Thus, Bogorad et al anticipates claims 1-6, and 11-13. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-13 are rejected under 35 U.S.C. 103 as being unpatentable over Bogorad et al (above) or Cowan et al (above), in further view of Peranteau et al (US 20230340486 A1 with priority to US Provisional 63/056,954 filed on July 27, 2020). All citations are to the ‘954 Provisional. Claims 1-6, and 11-13 are anticipated by each of the references of Bogorad et al and Cowan et al for reasons provided above. However, regarding claims 7-10, Bogorad et al or Cowan et al do not disclose a deaminase fused to the Cas9. Regarding claim 7, Peranteau et al discloses a Cas9/sgRNA gene editing system comprising a Cas9-fused to either an adenine deaminase or a cytosine deaminase. Peranteau et al disclose that the Cas9 protein of such gene editing system is catalytically impaired so as to not perform double-strand breaks in the DNA. (See ref claim 1 of the ‘954 Provisional). Peranteau et al disclose that Cas9/gRNA/ABE complex may be delivered to vivo to a subject by a pharmaceutical lipid nanoparticle composition comprising the complex. Regarding instant claims 8-9, Peranteau et al disclose a gene-editing system comprising a catalytically impaired Cas9 protein fused to a cytosine deaminase. (See page 26, lines 11-20). Such construct is used to correct a disease-causing G to A mutation. Further, Peranteau et al disclose an ABE (adenine base editor) complex for use in a Cas9/sgRNA gene editing system where the Cas9 protein is catalytically impaired. (ref claim 1). Peranteau et al disclose their system is for conversion of adenine in a mutation to inosine, thereby catalyzing an A-T to G-C transition following DNA replication and to correct a disease-causing G to A mutation. Regarding instant claim 10, Peranteau et al disclose ABE8.8-m and ABE8.8-d as preferred types of adenine base editors (See Ref claim 2). The level of skill in the art was high before the effective filing date of the presently claimed invention. One of ordinary skill in the art would have been motivated to add the elements of a deaminase base editor to the Cas9/gRNA TTR-specific gene editing systems of Bogorad et al or Cowan et al for the rationale of conversion of adenine in a mutation to inosine, thereby catalyzing an A-T to G-C transition and to correct a disease-causing G to A mutation as suggested by Peranteau et al. The addition of a catalytically inactive Cas9 complexed with a deaminase to the gene-editing systems of Bogorad et al or Cowan et al would have been obvious to one of ordinary skill in the art because the cited references are in the same field of correcting disease mutations using a CRISPR/Cas9/gRNA gene-editing systems. In view of the high skill level in the art before the effective filing date of the presently claimed invention it is considered that one of ordinary skill in the art having the cited references would have had a reasonable expectation of success to combine the elements of the cited references to arrive at the presently claimed invention. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-13 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-19 of copending Application No. 19/204,091 ('091) (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because copending claims anticipate the instant claims. For example, regarding instant claims 1 and 5, copending claims 1-19 of '091 recite a base editor system for modifying a target Transthyretin (TTR) gene comprising a guide RNA, comprising a sequence defined by mGmC*mC*AUCCUGCCAAGAAUGAGmGUUUUAGmAmGmCnUAGmA mAmAmUmAmGmCmAmAGUUmAAmAAmUAmAmGmGmCmUmAGUmC mCGUUAmUmCAAmCmUmUGmAmAmAmAmAmGmUmGGmCmAmCmC m Am Um Gm (GA521, SEQ ID NO:11) the guide RNA directing the base editor system to effect a nucleobase alteration in the TTR gene. Regarding instant claims 2-4, the AUCCUGCCAAGAAUGAG of reference SEQ ID NO:11 meets the limitation of instant claims 2-3 and 4 of a polynucleotide comprising a spacer sequence at least about 75% identical to instant SEQ ID Nos: 1 and 2. Further, regarding instant claim 7, claim 2 of '091 recites an engineered, non-naturally occurring base editing system for modifying a target Transthyretin (TTR) gene, comprising (a) a guide RNA molecule having a sequence defined by mG*mC*mC*AUCCUGCCAAGAAUGAGmGUUUUAGmAmGmCmUmAGmA mAmAmUmAmGmCmAmAGUUmAAmAAmUAmAmGmGmCmUmAGUmC mCGUUAmUmCAAmCmUmUGmAmAmAmAmAmGmUmGGmCmAmCmC m Am Gm Um Cm Gm U*m U*m U (SEQ ID NO: 11), and (b) a codon- optimized nucleic acid encoding a Cas9 protein fused to a deaminase, wherein the Cas9 protein fusion is capable of binding to the guide RNA and of editing the target TTR sequence complementary to the guide RNA. Further, regarding instant claims 8-10, copending claim 3 recites the deaminase comprises a cytosine deaminase or adenine deaminase, copending claim 5 recites nickase Cas9, and copending claim 7 recites the Cas9 is fused to ABE8.8. Regarding instant claims 6, and 11-13, copending claim 14 recites a pharmaceutical composition comprising a lipid nanoparticle comprising the system of copending claim 2. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 1-11 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-26 of copending Application No. 18/507,980 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the copending claims anticipate the instant claims. Regarding instant claims 1 and 5, copending claim 1 recites a method of using a gRNA to edit a TTR gene. Copending claim 10 recites gRNAs comprising a spacer (complementary region) of about 17 to 23 nucleotides. Regarding instant claims 2-4, copending claims 10, 17, and 24 recites a list of gRNAs which meet the limitation of about 75 % identical to instant SEQ ID Nos 1-5. For example, see reference sequence:5'-GCCAUCCUGCCAAGAAUGAG-3' (ref SEQ ID NO: 478; gRNA1772) which is 100% identical to instant SEQ ID NO: 1. Regarding instant claims 6-11, copending claims 22-27 recites a pharmaceutical composition comprising the gRNA and ABE8.8, This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 1-7, and 11-13 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-19 of copending Application No. 19/209,589 ('589) (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because claims 1-19 of '589 anticipate the instant claims. For example, regarding instant claims 1-6, and 11-13, copending claims 1 and 15, recite a pharmaceutical lipid nanoparticle composition comprising a gRNA of reference SEQ ID No: 473 which is GCCAUCCUGCCAAGAACGAG; see page 320 of copending claims, and which is 100% identical to instant gRNA SEQ ID NO:2 of instant claim 4 (5'-GCCAUCCUGCCAAGAACGAG-3" (SEQ ID NO: 2) (GA519)). Such gRNA inherently meets the limitations of instant claims 1-3 for targeting the TTR gene. Regarding instant claim 7, copending claim 13 recites a polynucleotide encoding a base editor comprising a nucleic acid programmable DNA binding protein and a deaminase domain. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion No claim is allowed. Related prior art which may be applied in a future office action if appropriate: Morrissey et al (WO-2017/173054 published October 5, 2017, 21 page IDS of 09/07/2024, ref # 40). Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE S HIBBERT whose telephone number is (571)270-3053. The examiner can normally be reached M-F 8:00-5:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Melissa Fisher can be reached at 571-270-7430. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. CATHERINE S. HIBBERT Primary Examiner Art Unit 1658 /CATHERINE S HIBBERT/Primary Examiner, Art Unit 1658
Read full office action

Prosecution Timeline

Nov 20, 2023
Application Filed
Sep 21, 2026
Non-Final Rejection mailed — §102, §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12747456
Multiplex RNA-Guided Genome Engineering
4y 3m to grant Granted Sep 29, 2026
Patent 12746274
USE OF BMP9 IN COMBINATION WITH NK CELL AND PD-L1 ANTIBODY IN PREPARING MEDICAMENT FOR TREATING LIVER CANCER
3y 4m to grant Granted Sep 29, 2026
Patent 12728152
GROWTH AND DIFFERENTIATION FACTOR 15 FOR TREATMENT OF PROLIFERATIVE VITREORETINOPATHY THERAPY
3y 3m to grant Granted Sep 08, 2026
Patent 12721881
ENDOSTATIN PEPTIDES FOR THE TREATMENT OF TUMORS, FIBROSIS AND ACUTE LUNG INJURY
6y 2m to grant Granted Sep 01, 2026
Patent 12721883
ANTIVIRAL AGENT FOR COMBINED THERAPY OF COVID-19 (SARS-COV-2)
3y 6m to grant Granted Sep 01, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+48.8%)
3y 10m (~11m remaining)
Median Time to Grant
Low
PTA Risk
Based on 810 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month