Prosecution Insights
Last updated: July 17, 2026
Application No. 18/519,500

FOOD AND PHARMACEUTICAL COMPOSITION FOR DETOXIFYING ENDOGENOUS ALDEHYDES

Non-Final OA §101§102§112§DP
Filed
Nov 27, 2023
Priority
Dec 01, 2022 — RE 10-2022-0165794 +1 more
Examiner
JONES-FOSTER, ERICA NICOLE
Art Unit
1632
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Picoentech Co. Ltd.
OA Round
1 (Non-Final)
49%
Grant Probability
Moderate
1-2
OA Rounds
9m
Est. Remaining
96%
With Interview

Examiner Intelligence

Grants 49% of resolved cases
49%
Career Allowance Rate
37 granted / 75 resolved
-10.7% vs TC avg
Strong +47% interview lift
Without
With
+46.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 4m
Avg Prosecution
50 currently pending
Career history
149
Total Applications
across all art units

Statute-Specific Performance

§101
7.4%
-32.6% vs TC avg
§103
60.7%
+20.7% vs TC avg
§102
10.3%
-29.7% vs TC avg
§112
4.6%
-35.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 75 resolved cases

Office Action

§101 §102 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicants’ amendment to the claims filed on 4/20/2026 is acknowledged. This listing of claims replaces all prior listings of claims in the application. The Art Unit location of your application in the USPTO has changed. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Art Unit 1656 and Examiner Erica Jones-Foster. Claims 1-14 are pending. Election/Restrictions Applicant’s election without traverse of Group I (claims 1-6) in the reply filed on 4/20/2026 is acknowledged. Upon further consideration, the restriction requirement between Groups I-IV have been reconsidered. The restriction requirement between Groups I-IV, as set forth in the Office action mailed on 2/19/2026 has been reconsidered and is hereby withdrawn. In view of the above noted withdrawal of the restriction requirement, applicant is advised that if any claim presented in a divisional application is anticipated by, or includes all the limitations of, a claim that is allowable in the present application, such claim may be subject to provisional statutory and/or nonstatutory double patenting rejections over the claims of the instant application. Once a restriction requirement is withdrawn, the provisions of 35 U.S.C. 121 are no longer applicable. See In re Ziegler, 443 F.2d 1211, 1215, 170 USPQ 129, 131-32 (CCPA 1971). See also MPEP § 804.01. Claim 1-14 are pending and examined on the merits. Claim Rejections - 35 USC § 112 Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 2-6, 12-14 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. MPEP 2163.II.A.2.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”. For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Claims 2-6 are drawn to the composition for promoting decomposition of endogenous aldehyde decomposition of claim 1, wherein the composition contains an aldehyde dehydrogenase enzyme encoded by the gene of SEQ ID NO: 1 including SEQ ID NO: 2. The structure of an aldehyde dehydrogenase enzyme encoded by the gene of SEQ ID NO: 1 including SEQ ID NO: 2 is unclear. Furthermore, SEQ ID NO: 2 is a sequence of 42 oligonucleotides, it is unclear what “including” means and what the relationship of SEQ ID NO:2 to SEQ ID NO:1 is in the context of the claimed gene, as it could be within the internal 5’ to 3’ region of the nucleotide sequence of SEQ ID NO:1 or on the 5’ end or 3’ end of said sequence. In addition, SEQ ID NO: 2 is just a DNA fragment of 42 nucleotides. Therefore, it is unclear how said sequence can encode a full length enzyme. Claim 12 is drawn to mutant Saccharomyces cerevisiae KCTC14983BP. The structure and function of said microbe encompasses a large number of sequences, since said mutant strain is not clearly defined in the instant application claims. Claims 13 is drawn to mutant Saccharomyces cerevisiae KCTC14984BP. The structure and function of said microbe encompasses a large number of sequences, since said mutant strain is not clearly defined in the instant application claims. Claim 14 is drawn to mutant Saccharomyces cerevisiae KCTC14985BP. The function of said microbe encompasses a large number of functionalities. The structure and function of said microbe encompasses a large number of sequences, since said mutant strain is not clearly defined in the instant application claims. In this case, the specification discloses the following representative species of aldehyde dehydrogenase enzyme encoded by the gene of SEQ ID NO: 1 including SEQ ID NO: 2. as encompassed by the claims (i.e. an aldehyde dehydrogenase encoded by the gene SEQ ID NO: 1 which is characterized in that it contains SEQ ID NO: 2). Furthermore, the specification discloses mutant Saccharomyces cerevisiae KCTC14983BP, mutant Saccharomyces cerevisiae KCTC14984BP and mutant Saccharomyces cerevisiae KCTC14985BP as promoting the decomposition of endogenous aldehyde. Other than the above disclosed species, there is no prior-art or disclosed teaching as to the large number of variations upon which SSEQ ID NO: 1 can contain SEQ ID NO: 2. Furthermore, other than the disclosed species, there is no prior-art or disclosed teaching as to the large number of structures and functions upon which mutant Saccharomyces cerevisiae KCTC14983BP, mutant Saccharomyces cerevisiae KCTC14984BP and mutant Saccharomyces cerevisiae KCTC14985BP poses. The breadth of the claims encompass any variation upon which SEQ ID NO: 1 is including SEQ ID NO: 2 and any structure/function of mutant Saccharomyces cerevisiae KCTC14983BP, mutant Saccharomyces cerevisiae KCTC14984BP and mutant Saccharomyces cerevisiae KCTC14985BP. An adequate written description of a chemical invention also requires a precise definition, such as by structure, formula, chemical name, or physical properties, and not merely a wish or plan for obtaining the chemical invention claimed. See, e.g., Univ. of Rochester v. G.D. Searle & Co., 358 F.3d 916, 927, 69 USPQ2d 1886, 1894-95 (Fed. Cir. 2004). Here, the disclosure fails to teach where SEQ ID NO: 2 is included within SEQ ID NO: 1 out of the numerous possibilities for promoting the decomposition of endogenous aldehyde. Furthermore, the disclosure fails to teach the structure and function of mutant Saccharomyces cerevisiae KCTC14983BP, mutant Saccharomyces cerevisiae KCTC14984BP and mutant Saccharomyces cerevisiae KCTC14985BP out of the numerous possibilities. Accordingly, one of skill in the art would not accept the disclosure of SEQ ID NO: 1 including SEQ ID NO: 2 as being representative of all variations upon which SEQ ID NO: 2 can be included as encompassed by the claims. Furthermore, one would not accept the disclosure of mutant Saccharomyces cerevisiae KCTC14983BP, mutant Saccharomyces cerevisiae KCTC14984BP and mutant Saccharomyces cerevisiae KCTC14985BP are representative of all mutant Saccharomyces cerevisiae for the decomposition of endogenous aldehyde. As such, the specification, taken with the pre-existing knowledge in the art of aldehyde dehydrogenase, fails to satisfy the written description requirement of 35 U.S.C. 112, first paragraph. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 7-14 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The invention appears to employ novel genetically engineered Saccharomyces cerevisiae, KCT13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP. Since the deposited Saccharomyces cerevisiae strains: KCT13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP are essential to the claimed invention, they must be obtainable by a repeatable method set forth in the specification or otherwise be readily available to the public. The Saccharomyces cerevisiae strains, KCT13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP are not fully disclosed, nor have all the sequences required for their construction been shown to be publicly known and freely available. The enablement requirements of 35 U.S.C. 112 may be satisfied by a deposit of the Saccharomyces cerevisiae strains, KCT13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP. The specification does not disclose a repeatable process to obtain the vectors and it is not apparent if the DNA sequences are readily available to the public. Accordingly, it is deemed that a deposit of the Saccharomyces cerevisiae strains, KCT13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP should have been made in accordance with 37 CFR 1.801-1.809. If a deposit was made under the terms of the Budapest Treaty, then an affidavit or declaration by applicants, or a statement by an attorney of record over his or her signature and registration number, stating that the specific strain has been deposited under the Budapest Treaty and that the strain will be available to the public under the conditions specified in 37 CFR 1.808, would satisfy the deposit requirement made herein. If the deposit has not been made under the Budapest treaty, then in order to certify that the deposit meets the criteria set forth in 37 CFR 1.801-1.809, applicants may provide assurance or compliance by an affidavit or declaration, or by a statement by an attorney of record over his or her signature and registration number, showing that: 1. during the pendency of this application , access to the invention will be afforded to the Commissioner upon request; 2. upon granting of the patent the strain will be available to the public under the conditions specified in 37 CFR 1.808; 3. the deposit will be maintained in a public repository for a period of 30 years or 5 years after the last request or for the effective life of the patent, whichever is longer; and 4. the deposit will be replaced if it should ever become inviable. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 2-6, 12-14 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. With regards to claim 2 (claims 3 -6 dependent thereof), the claim recites the term “gene” that renders the claim indefinite because the scope of the term “gene of SEQ ID NO:1” is unclear because a gene can be understood to include polynucleotide sequences such as the promoter, introns and exons, untranslated sequences, or other sequences. It is unclear if “the gene of SEQ ID NO:1,” encompasses that nucleic acid sequence of SEQ ID NO: 1 or additional nucleic acid sequences such as promoters or other regulatory elements, including SEQ ID NO: 2. Appropriate correction is suggested. With regards to claim 2 (claims 3-6 dependent thereof), the claim recites “an aldehyde dehydrogenase encoded by the gene of SEQ ID NO: 1 including SEQ ID NO:2.” As SEQ ID NO: 2 is a sequence of 42 oligonucleotides, it is unclear what “including” means and what the relationship of SEQ ID NO:2 to SEQ ID NO:1 is in the context of the claimed gene, as it could be within the internal 5’ to 3’ region of the nucleotide sequence of SEQ ID NO:1 or on the 5’ end or 3’ end of the sequence. In addition, SEQ ID NO: 2 is just a DNA fragment of 42 nucleotides. Therefore, it is unclear how said sequence can encode a full length enzyme. As such, the claim is indefinite. Appropriate correction is suggested. Claims 12-14 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being incomplete for omitting essential structural cooperative relationships of elements, such omission amounting to a gap between the necessary structural connections. See MPEP § 2172.01. The omitted structural cooperative relationships are: the function of mutant Saccharomyces cerevisiae KCTC14983BP, mutant Saccharomyces cerevisiae KCTC14984BP and mutant Saccharomyces cerevisiae KCTC14985BP. Applicant has not disclosed the function of said mutants out of the infinite possibilities. Additionally, Applicant has not disclosed how said strains are ‘mutants.’ Appropriate correction is suggested. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Claims 1-11 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claims do not fall within at least one of the four categories of patent eligible subject matter because the claimed invention is a naturally occurring microorganism. Step 1: Is the claim to a process, machine, manufacture or composition of matter? Yes, the claim is drawn to a composition of matter, which is one of the four statutory categories. Step 2, Prong One: Does the claim recite an abstract idea, law of nature, or natural phenomenon? Yes, the claim is directed to a natural phenomenon (product of nature). Said natural phenomenon is Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP. Claims 1-6 are directed towards a composition for promoting decomposition of endogenous aldehyde, containing an aldehyde dehydrogenase, wherein the aldehyde dehydrogenase is encoded by the polynucleotide comprising the nucleic acid sequence set forth in SEQ ID NO: 1. In the broadest reasonable interpretation of the claim, said yeast is genetically unmodified and naturally occurring. The claim includes a nature-based product that does not exhibit markedly different characteristics from its naturally occurring counterpart in its natural state, the claim recites a "product of nature," which is a judicial exception. Claim 7 is directed towards composition for promoting endogenous aldehyde decomposition, contained in lysate of any one, or a mixture of, one or more microorganisms selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP, Saccharomvces cerevisiae KCTC14122BP, Saccharomyces cerevisiae KCTC14123BP, Saccharomyces cerevisiae KCTC14983BP, Saccharomyces cerevisiae KCTC14984BP, and Saccharomyces cerevisiae KCTC14985BP. In the broadest reasonable interpretation of the claim, said yeast is genetically unmodified and naturally occurring. The claim includes a nature-based product that does not exhibit markedly different characteristics from its naturally occurring counterpart in its natural state, the claim recites a "product of nature," which is a judicial exception. Claim 8 is directed towards a food composition for suppressing oxidative stress, containing any one or a mixture thereof selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP. In the broadest reasonable interpretation of the claim, said yeast is genetically unmodified and naturally occurring. The claim includes a nature-based product that does not exhibit markedly different characteristics from its naturally occurring counterpart in its natural state, the claim recites a "product of nature," which is a judicial exception. Claim 9 is directed towards a pharmaceutical composition for suppressing oxidative stress, containing any one or a mixture thereof selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC 14985BP. In the broadest reasonable interpretation of the claim, said yeast is genetically unmodified and naturally occurring. The claim includes a nature-based product that does not exhibit markedly different characteristics from its naturally occurring counterpart in its natural state, the claim recites a "product of nature," which is a judicial exception. Claim 10 is directed towards a food composition for suppressing auto-brewery symptom, containing any one or a mixture thereof selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC 14985BP. In the broadest reasonable interpretation of the claim, said yeast is genetically unmodified and naturally occurring. The claim includes a nature-based product that does not exhibit markedly different characteristics from its naturally occurring counterpart in its natural state, the claim recites a "product of nature," which is a judicial exception. Claim 11 is directed towards a pharmaceutical composition for suppressing auto-brewery symptom, containing any one or a mixture thereof selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP. In the broadest reasonable interpretation of the claim, said yeast is genetically unmodified and naturally occurring. The claim includes a nature-based product that does not exhibit markedly different characteristics from its naturally occurring counterpart in its natural state, the claim recites a "product of nature," which is a judicial exception. Step 2, Prong Two: Does the claim recite additional elements that integrate the judicial exception into a practical application? Claims 1-2 includes the additional elements of aldehyde dehydrogenase encoded by the polynucleotide comprising the nucleic acid sequence set forth in the gene SEQ ID NO: 1 (claim 1) and said gene SEQ ID NO: 1 including SEQ ID NO: 2 (claim 2). However, the additional element (SEQ ID NO: 1; appendix A) is directed to a naturally occurring enzyme and its subsequent function. Furthermore, SEQ ID NO: 1 is a genomic sequence of yeast that encodes this enzyme (appendix A) and there is nothing in the claim that clearly states how this enzyme is different (if any) from a natural enzyme. The fact that is ‘includes’ SEQ ID NO: 2 does not make it markedly different from the naturally occurring enzyme as it is unclear where SEQ ID NO: 2 is ‘included’ within SEQ ID NO: 1. As such, said functionalities are not sufficient to integrate into a practical application (MPEP 2106.05(f)-(g)). Claim 6 merely recites the composition as consisting of Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP. Applicant has not disclosed how the strains are ‘markedly different’ from their natural counterparts. Step 2B: Does the claim recite additional elements that amount to significantly more than the judicial exception? No. The judicial exception is recited without additional limitations amounting to significantly more than the exception. All of the signified additional elements to the judicial exception are considered to be native to the enzyme on which the judicial exception is to be performed as noted in Step 2A, Prong 2, and, therefore, do not amount to significantly more than the judicial exception that is claimed. As the instant claims recite judicial exceptions that are not integrated into practical application, and no elements that amount to significantly more than the judicial exception as recited, the claims were found not to be drawn to eligible subject matter under 35 U.S.C. 101. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-14 are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Kwon et al (US Patent Application No: US 2021/0254023 A1, Date Published: August 19, 2021, Examiner cited) {hereinafter Kwon ‘023} as evidenced by Accession No: NM_001182673 (GenBank, Date Published: 17-May-2010, Examiner cited) {herein NM_001182673} and LN907796.1 (GenBank, Date Published: 29-Sep-2017, Examiner cited) {herein LN907796.1}. See MPEP 2131.01 regarding multiple reference 102 rejections. The applied reference has a common inventor and assignee with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. Claims 1-6 are drawn to a composition for promoting decomposition of endogenous aldehyde, containing an aldehyde dehydrogenase, wherein the aldehyde dehydrogenase is encoded by the polynucleotide comprising the nucleic acid sequence set forth in SEQ ID NO: 1. Claim 7 is drawn to composition for promoting endogenous aldehyde decomposition, contained in lysate of any one, or a mixture of, one or more microorganisms selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP, Saccharomvces cerevisiae KCTC14122BP, Saccharomyces cerevisiae KCTC14123BP, Saccharomyces cerevisiae KCTC14983BP, Saccharomyces cerevisiae KCTC14984BP, and Saccharomyces cerevisiae KCTC14985BP. Claim 8 is drawn to a food composition for suppressing oxidative stress, containing any one or a mixture thereof selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP. Claim 9 is drawn to a pharmaceutical composition for suppressing oxidative stress, containing any one or a mixture thereof selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC 14985BP. Claims 10 is drawn to a food composition for suppressing auto-brewery symptom, containing any one or a mixture thereof selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC 14985BP. Claim 11 is drawn to a pharmaceutical composition for suppressing auto-brewery symptom, containing any one or a mixture thereof selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP. Claim 12 is drawn to mutant Saccharomyces cerevisiae KCTC14983BP. Claims 13 is drawn to mutant Saccharomyces cerevisiae KCTC14984BP. Claim 14 is drawn to mutant Saccharomyces cerevisiae KCTC14985BP With respect to claims 1--6, Kwon teaches yeast strains Saccharomyces cerevisiae Kwon P-1 KCTC13925BP, Saccharomyces cerevisiae Kwon P-2 KCTC14122BP, and Saccharomyces cerevisiae Kwon P-3 KCTC14123BP, which over produce aldehyde dehydrogenase (para 0001 and 0037) for reducing the toxicity of alcohol (para 0013). Since said yeast cells were obtained by treating wildtype Saccharomyces cerevisiae with ethyl methane sulfonate (table 1), which is the same method at which the instant application isolated the strains recited in the instant application claim 6 (Instant application claim 6 and instant application specification para 161), it is the Examiner’s position that yeast strains Saccharomyces cerevisiae Kwon P-1 KCTC13925BP, Saccharomyces cerevisiae Kwon P-2 KCTC14122BP, and Saccharomyces cerevisiae Kwon P-3 KCTC14123BP, taught by Kwon, are the same as the instant application yeast strains Saccharomyces cerevisiae KCTC13925BP, Saccharomyces cerevisiae KCTC14122BP, and Saccharomyces cerevisiae KCTC14123BP. Furthermore, Kwon teaches alcohol dehydrogenase within said yeast cells first oxidizes alcohol into acetaldehyde (oxidized alcohol) and then acetaldehyde is again decomposed into acetic acid by acetaldehyde dehydrogenase (para 0014). In addition, Kwon teaches that aldehyde dehydrogenase is used in the metabolism of not only acetaldehyde but also aldehydes such as aliphatic aldehydes, aromatic aldehydes, and polycyclic aldehydes to remove toxic substances from the body and further discloses that aldehyde dehydrogenase serves to remove 4-hydroxy-2-nonenal (4-HNE) and malondialdehyde (MDA) which are oxidized aldehydes generated from oxidative stress (endogenous aldehydes) (para 0016-0017). Although Kwon does not disclose the sequence of the aldehyde dehydrogenase (instant application SEQ ID NO: 1 and SEQ ID NO: 1, including SEQ ID NO: 2) in the yeast strains Saccharomyces cerevisiae KTCTC14123BP, Saccharomyces cerevisiae KCTC14122BP, and Saccharomyces cerevisiae KCTC14123PB. Absent evidence otherwise, it is the Examiner’s position that the polynucleotide sequence of the instant application (SEQ ID NO: 1 and SEQ ID NO: 1, including SEQ ID NO: 2) are inherent to the polynucleotide sequence that encodes the aldehyde dehydrogenase in yeast strains Saccharomyces cerevisiae Kwon-P1 KTCTC14123BP, Saccharomyces cerevisiae Kwon P-2, KCTC14122BP, and Saccharomyces cerevisiae Kwon P-3 KCTC14123PB (para 0001). Supporting the Examiner position is the evidentiary references of NM_001182673.1 (appendix A) and LN907796.1 (appendix B) which provides evidence that NM_001182673.1 is 100% identical to the instant application SEQ ID NO: 1 (appendix A) and LN907796.1 is 100% identical to the instant application SEQ ID NO: 2 (appendix B; see above rejection under 112b) of which are sequences within Saccharomyces cerevisiae (para 0001). Furthermore, said sequence would inherently have the characteristic of promoting the decomposition of endogenous amine compounds such as dopamine, norepinephrine, serotonin and GABA, as recited in the instant application claim 4. With respect to claim 7, Kwon teaches an enzyme reaction solution that includes a lysate of microorganisms to be measured (pharmaceutical composition selected from the group of Saccharomyces cerevisiae strains) for aldehyde dehydrogenase activity (Para 0085). With respect to claims 8-11, Kwon teaches that the mutant Saccharomyces cerevisiae strains that overproduce glutathione and aldehyde dehydrogenase have been reported to be recognized as safe in the use of food, health food (food compositions), cosmetics, and medicines (pharmaceutical composition) (para 0034-0035). Absent evidence otherwise, it is the Examiner’s position that said food composition would necessarily suppress auto-brewery symptoms as Kwon teaches a composition containing any one of Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP (para 0001 and 0037) and as Applicant has not disclosed any additional features that would result in a structural difference between the claimed composition (claims 9-11) and that of which is taught by Kwon. With respect to claim 12-14, although Kwon does not disclose the sequence of the aldehyde dehydrogenase in the yeast strains Saccharomyces cerevisiae KCTC14983BP, Saccharomyces cerevisiae KCTC14984BP, and Saccharomyces cerevisiae KCTC14985BP, it is the Examiner’s position that the polynucleotide sequence of these strains is inherent to the polynucleotide sequence that encodes the aldehyde dehydrogenase in the yeast strains Saccharomyces cerevisiae Kwon-P1 KCTC13925BP, Saccharomyces cerevisiae Kwon P-2, KCTC14122BP, and Saccharomyces cerevisiae Kwon P-3 KCTC14123PB as evidenced by Accession No: NM_001182673 (appendix A) and LN907796.1 (appendix B). For the reasons stated herein, the teachings of Kwon anticipate claims 1-14. Non-Statutory Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-6 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1- 6 of U.S. Patent No. US 11618889 B2 to Kwon, hereinafter referred to as ’889, which are commonly owned and have common inventors and filed before the instant application. Although the claims at issue are not identical, they are not patentably distinct from each other because claims 1- 6 of ‘889, drawn to Saccharomyces cerevisiae yeast having an enhanced ability to produce aldehyde dehydrogenase and glutathione concurrently, the Saccharomyces cerevisiae yeast is selected from the group consisting of Saccharomyces cerevisiae Kwon P-1 KCTC13925BP, Saccharomyces cerevisiae Kwon P-2 KCTC14122BP, and Saccharomyces cerevisiae Kwon P-3 KCTC14123BP, wherein the Saccharomyces cerevisiae yeast is obtained by a process comprising: a first step for treating a Saccharomyces cerevisiae yeast with ethylmethanesulfonate or nitrosoguanidine to induce mutation, a second step for treating the induced mutant yeast obtained in the first step with methylglyoxal to select a methylglyoxal-adapted mutant yeast from the induced mutant yeast, and a third step for treating the methylglyoxal-adapted mutant yeast selected in the second step with lysine to select a lysine-adapted mutant yeast from the methylglyoxal-adapted mutant yeast selected in the second step, anticipate and/or make obvious instant claims 1-6 drawn to a composition for promoting decomposition of endogenous aldehyde, containing an aldehyde dehydrogenase, wherein the aldehyde dehydrogenase is encoded by the polynucleotide comprising the nucleic acid sequence set forth in SEQ ID NO: 1. Claims 1-6 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over copending claims 1-5 of copending Application No. 18/519,482 (Kwon), hereinafter referred to as ‘482, which are commonly owned and have common inventors and filed before the instant application. Although the claims at issue are not identical, they are not patentably distinct from each other because copending claims 1-5 of ‘482, drawn to a composition for alleviating endoplasmic reticulum stress, containing any one or a mixture thereof selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP,KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCT1l4985BP, anticipate and/or make obvious instant claims 1-6 drawn to a composition for promoting decomposition of endogenous aldehyde, containing an aldehyde dehydrogenase, wherein the aldehyde dehydrogenase is encoded by the polynucleotide comprising the nucleic acid sequence set forth in SEQ ID NO: 1. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 1-6 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-11 of copending Application No. 18/519,569 (Kwon), hereinafter referred to as ’569, which are commonly owned and have common inventors and filed before the instant application. Although the claims at issue are not identical, they are not patentably distinct from each other because copending claims 1-11 of ‘569, drawn to a food composition that suppresses or improves symptoms of tremor or movement disorder, containing an aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1, anticipate and/or make obvious instant claims 1-6 drawn to a composition for promoting decomposition of endogenous aldehyde, containing an aldehyde dehydrogenase, wherein the aldehyde dehydrogenase is encoded by the polynucleotide comprising the nucleic acid sequence set forth in SEQ ID NO: 1. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 1-6 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-16 of copending Application No. 18/519,546 (Kwon), hereinafter referred to as ’546, which are commonly owned and have common inventors and filed before the instant application. Although the claims at issue are not identical, they are not patentably distinct from each other because copending claims 1-16 of ‘546, drawn to a food/pharmaceutical composition for improving memory and cognitive function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1 and a food composition for improving memory and cognitive function, comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTC13925BP, KCTC14122BP, KCTC14123BP KCTC14983BP, KCTC14984BP and KCTC14985BP, anticipate and/or make obvious instant claims 1-6 drawn to a food/pharmaceutical composition that suppresses or improves symptoms of tremor or movement disorder, containing an aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 1-6 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-7 of copending Application No. 18/954,826 (Kwon), hereinafter referred to as ’826, which are commonly owned and have common inventors and filed before the instant application. Although the claims at issue are not identical, they are not patentably distinct from each other because copending claims 1-7 of ‘826, drawn to a food composition for improving behavioral and motor function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1 and a food composition for improving behavior and motor function, further comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTC13925BP, KCTC14122BP, KCTC14123BP KCTC14983BP, KCTC14984BP and KCTC14985BP, anticipate and/or make obvious instant claims 1-6 drawn to a food/pharmaceutical composition that suppresses or improves symptoms of tremor or movement disorder, containing an aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented Conclusion Status of Claims Claims 7-14 stands withdrawn pursuant to 37 CFR 1.142(b). Claims 1-6 are pending and examined on the merits. Claims 1-6 are rejected. No claims are in condition for allowance. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ERICA NICOLE JONES-FOSTER whose telephone number is (571)270-0360. The examiner can normally be reached mf 7:30a - 4:30p. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Manjunath Rao can be reached at 571-272-0939. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ERICA NICOLE JONES-FOSTER/Examiner, Art Unit 1656 /MANJUNATH N RAO/Supervisory Patent Examiner, Art Unit 1656 Appendix A Accession No: GenBank: NM_001182673.1 (BLAST search with 100% identty to instant application SEQ ID NO: 1) Query 1534 ATGCCTACCTTGTATACTGATATCGAAATCCCACAATTGAAAATCTCTTTAAAGCAACCG 1593 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 ATGCCTACCTTGTATACTGATATCGAAATCCCACAATTGAAAATCTCTTTAAAGCAACCG 60 Query 1594 CTAGGGTTGTTTATCAACAATGAGTTTTGTCCATCATCAGATGGAAAGACCATCGAAACT 1653 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 CTAGGGTTGTTTATCAACAATGAGTTTTGTCCATCATCAGATGGAAAGACCATCGAAACT 120 Query 1654 GTGAACCCAGCTACTGGCGAACCGATAACATCCTTCCAAGCAGCTAACGAAAAGGATGTA 1713 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 GTGAACCCAGCTACTGGCGAACCGATAACATCCTTCCAAGCAGCTAACGAAAAGGATGTA 180 Query 1714 GACAAAGCTGTGAAAGCTGCCAGGGCTGCTTTTGATAACGTTTGGTCGAAGACATCTTCT 1773 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 GACAAAGCTGTGAAAGCTGCCAGGGCTGCTTTTGATAACGTTTGGTCGAAGACATCTTCT 240 Query 1774 GAGCAACGTGGTATTTATCTTTCAAACTTATTAAAACTTATTGAGGAGGAGCAAGACACA 1833 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 GAGCAACGTGGTATTTATCTTTCAAACTTATTAAAACTTATTGAGGAGGAGCAAGACACA 300 Query 1834 CTTGCCGCATTAGAGACTTTAGACGCTGGTAAGCCTTTCCATTCCAATGCTAAACAAGAC 1893 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 CTTGCCGCATTAGAGACTTTAGACGCTGGTAAGCCTTTCCATTCCAATGCTAAACAAGAC 360 Query 1894 TTAGCCCAGATTATAGAACTTACAAGATACTATGCGGGGGCGGTCGACAAGTTCAATATG 1953 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 TTAGCCCAGATTATAGAACTTACAAGATACTATGCGGGGGCGGTCGACAAGTTCAATATG 420 Query 1954 GGTGAAACCATTCCATTGACTTTTAACAAGTTTGCATATACTCTAAAAGTTCCTTTTGGC 2013 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 GGTGAAACCATTCCATTGACTTTTAACAAGTTTGCATATACTCTAAAAGTTCCTTTTGGC 480 Query 2014 GTTGTTGCTCAAATCGTTCCATGGAATTATCCTCTAGCTATGGCTTGTAGAAAAATGCAA 2073 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 GTTGTTGCTCAAATCGTTCCATGGAATTATCCTCTAGCTATGGCTTGTAGAAAAATGCAA 540 Query 2074 GGTGCCTTAGCGGCCGGTAACACGGTTATCATCAAACCTGCTGAAAATACCTCTCTATCT 2133 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 GGTGCCTTAGCGGCCGGTAACACGGTTATCATCAAACCTGCTGAAAATACCTCTCTATCT 600 Query 2134 CTACTTTATTTTGCTACTTTAATTAAAAAAGCAGGTTTTCCACCTGGTGTTGTCAATGTC 2193 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 CTACTTTATTTTGCTACTTTAATTAAAAAAGCAGGTTTTCCACCTGGTGTTGTCAATGTC 660 Query 2194 ATTCCTGGTTATGGTTCCGTTGTGGGGAAAGCTTTAGGAACCCACATGGATATCGACAAA 2253 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 ATTCCTGGTTATGGTTCCGTTGTGGGGAAAGCTTTAGGAACCCACATGGATATCGACAAA 720 Query 2254 ATATCTTTTACGGGAAGTACTAAGGTTGGCGGCTCAGTATTGGAAGCTTCCGGCCAATCG 2313 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 721 ATATCTTTTACGGGAAGTACTAAGGTTGGCGGCTCAGTATTGGAAGCTTCCGGCCAATCG 780 Query 2314 AACCTTAAGGATATCACACTAGAATGCGGTGGTAAGTCTCCTGCTCTTGTATTTGAAGAT 2373 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 AACCTTAAGGATATCACACTAGAATGCGGTGGTAAGTCTCCTGCTCTTGTATTTGAAGAT 840 Query 2374 GCAGACCTTGATAAGGCTATAGAATGGGTAGCAAATGGTAttttttttAATTCGGGACAG 2433 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 GCAGACCTTGATAAGGCTATAGAATGGGTAGCAAATGGTATTTTTTTTAATTCGGGACAG 900 Query 2434 ATCTGCACTGCAAACTCAAGAGTTTATGTTCAAAGTTCGATCTACGACAAGTTTGTTGAA 2493 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 ATCTGCACTGCAAACTCAAGAGTTTATGTTCAAAGTTCGATCTACGACAAGTTTGTTGAA 960 Query 2494 AAGTTTAAAGAAACTGCAAAGAAGGAGTGGGATGTTGCAGGAAAATTTGATCCGTTTGAT 2553 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 AAGTTTAAAGAAACTGCAAAGAAGGAGTGGGATGTTGCAGGAAAATTTGATCCGTTTGAT 1020 Query 2554 GAGAAATGCATCGTTGGTCCAGTTATATCAAGTACACAGTATGACCGCATCAAAAGTTAC 2613 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 GAGAAATGCATCGTTGGTCCAGTTATATCAAGTACACAGTATGACCGCATCAAAAGTTAC 1080 Query 2614 ATAGAACGTGGTAAAAAGGAGGAAAAGTTGGACATGTTCCAGACCTCTGAATTTCCTATT 2673 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1081 ATAGAACGTGGTAAAAAGGAGGAAAAGTTGGACATGTTCCAGACCTCTGAATTTCCTATT 1140 Query 2674 GGTGGAGCTAAAGGCTACTTCATTCCCCCAACCATCTTCACTGATGTACCAGAAACATCT 2733 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1141 GGTGGAGCTAAAGGCTACTTCATTCCCCCAACCATCTTCACTGATGTACCAGAAACATCT 1200 Query 2734 AAGTTGCTGCGTGATGAAATATTTGGCCCGGTTGTGGTTGTTAGCAAGTTCACAAATTAT 2793 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1201 AAGTTGCTGCGTGATGAAATATTTGGCCCGGTTGTGGTTGTTAGCAAGTTCACAAATTAT 1260 Query 2794 GATGACGCTCTGAAGCTGGCTAATGATACTTGCTACGGGCTCGCCTCTGCGGTCTTCACC 2853 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1261 GATGACGCTCTGAAGCTGGCTAATGATACTTGCTACGGGCTCGCCTCTGCGGTCTTCACC 1320 Query 2854 AAAGATGTCAAGAAAGCGCACATGTTTGCTCGCGATATTAAAGCAGGAACTGTTTGGATC 2913 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1321 AAAGATGTCAAGAAAGCGCACATGTTTGCTCGCGATATTAAAGCAGGAACTGTTTGGATC 1380 Query 2914 AATCAAACCAATCAAGAAGAAGCTAAAGTTCCTTTTGGCGGATTTAAGATGAGTGGTATT 2973 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1381 AATCAAACCAATCAAGAAGAAGCTAAAGTTCCTTTTGGCGGATTTAAGATGAGTGGTATT 1440 Query 2974 GGTAGAGAATCAGGCGACACCGGCGTTGATAACTATTTACAAATAAAATCAGTCCATGTG 3033 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1441 GGTAGAGAATCAGGCGACACCGGCGTTGATAACTATTTACAAATAAAATCAGTCCATGTG 1500 Query 3034 GATCTTTCATTGGATAAATAA 3054 ||||||||||||||||||||| Sbjct 1501 GATCTTTCATTGGATAAATAA 1521 Appendix B GenBank LN907796.1 is 100% identical to the instant application SEQ ID NO: 2 Saccharomyces cerevisiae N85 chromosome XIII, complete genome Sequence ID: LN907796.1 Length: 895281 Number of Matches: 1 Range 1: 317317 to 317358 GenBank GraRhics l\lnvf _Malet!_ .. PreVIQUS Mc1tch Score 78.7 bits(42) Expect 2e-11 Identities 42/42(100%) Gaps 0/42(0%) Strand Plus/Plus Query 1 AGATATAGATTATACACATTTAGAAAATTAGCCAAAAGAAAA 42 111111111111111 I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 317317 AGATATAGATTATACACATTTAGAAAATTAGCCAAAAGAAAA 317358
Read full office action

Prosecution Timeline

Nov 27, 2023
Application Filed
May 31, 2024
Response after Non-Final Action
May 18, 2026
Non-Final Rejection mailed — §101, §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12643927
ENGINEERED SPIDER SILK PROTEINS AND USES THEREOF
3y 9m to grant Granted Jun 02, 2026
Patent 12600761
METHODS AND COMPOSITIONS FOR PURIFICATION OF TRIMERIC FUSION PROTEINS
3y 1m to grant Granted Apr 14, 2026
Patent 12594308
METHODS OF PREPARING A POSTBIOTIC COMPOSITION
1y 6m to grant Granted Apr 07, 2026
Patent 12590291
METHOD OF INDUCING EXPRESSION OF CALCIUM CHANNEL AND/OR CALCIUM PUMP, AND APPARATUS THEREFOR
3y 11m to grant Granted Mar 31, 2026
Patent 12583886
SLIDING CLAMP-BASED AFFINITY PURIFICATION SYSTEMS, METHODS OF MAKING AND USE THEREOF
4y 9m to grant Granted Mar 24, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
49%
Grant Probability
96%
With Interview (+46.8%)
3y 4m (~9m remaining)
Median Time to Grant
Low
PTA Risk
Based on 75 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month