DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicants’ amendment to the claims filed on 11/27/2023 is acknowledged. This listing of claims replaces all prior listings of claims in the application.
Claims 1-16 are pending.
Priority
Acknowledgement is made of this continuation application of Non-provisional Application No. 18/519,546, filed on 11/27/2023, which claims foreign priority under 35 U.S.C. 119(a)-(d) to Republic of Korea Patent Application No. KR10-2022-0165816, filing date 12/1/2022 and Republic of Korea Patent Application No. KR10-2023-0153059, filing date 11/7/2023. The certified copies have been filed in the instant application, filed on 4/3/2024.
Drawings
The drawings filed on 11/27/2023 are acknowledged and accepted by the Examiner.
Claim Objections
Claim 14 is objected to because of the following informalities: the recitation ‘hexanal (hexanal)’ appears to be a repeat of itself. Furthermore, the claim numbers of the instant application are objected to as the claims are enclosed in square brackets, which is not the proper way to depict the claim in US practice. Appropriate correction is suggested.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 1-16 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claims do not fall within at least one of the four categories of patent eligible subject matter because the claimed invention is a naturally occurring microorganism.
Step 1: Is the claim to a process, machine, manufacture or composition of matter?
Yes, the claim is drawn to a composition of matter, which is one of the four statutory categories.
Step 2, Prong One: Does the claim recite an abstract idea, law of nature, or natural phenomenon?
Yes, the claim is directed to a natural phenomenon (product of nature). Said natural phenomenon is Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP.
Claims 1-7 are directed towards a food composition for improving memory and cognitive function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1. In the broadest reasonable interpretation of the claim, said yeast is genetically unmodified and naturally occurring. The claim includes a nature-based product that does not exhibit markedly different characteristics from its naturally occurring counterpart in its natural state, the claim recites a "product of nature," which is a judicial exception.
Claim 7 is directed towards composition for promoting endogenous aldehyde decomposition, contained in lysate of any one, or a mixture of, one or more microorganisms selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP, Saccharomvces cerevisiae KCTC14122BP, Saccharomyces cerevisiae KCTC14123BP, Saccharomyces cerevisiae KCTC14983BP, Saccharomyces cerevisiae KCTC14984BP, and Saccharomyces cerevisiae KCTC14985BP. In the broadest reasonable interpretation of the claim, said yeast is genetically unmodified and naturally occurring. The claim includes a nature-based product that does not exhibit markedly different characteristics from its naturally occurring counterpart in its natural state, the claim recites a "product of nature," which is a judicial exception.
Claim 8 is directed towards a food composition for improving memory and cognitive function, comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTCl13925BP, KCTC 141 22BP, KCTC 141 23BP KCTC 14983BP, KCTC14984BP and KCTC14985BP. In the broadest reasonable interpretation of the claim, said yeast is genetically unmodified and naturally occurring. The claim includes a nature-based product that does not exhibit markedly different characteristics from its naturally occurring counterpart in its natural state, the claim recites a "product of nature," which is a judicial exception.
Claims 9-15 are directed towards a pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia, containing aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1. In the broadest reasonable interpretation of the claim, said yeast is genetically unmodified and naturally occurring. The claim includes a nature-based product that does not exhibit markedly different characteristics from its naturally occurring counterpart in its natural state, the claim recites a "product of nature," which is a judicial exception.
Claim 15 is directed the pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia of claim 10, wherein the aldehyde dehydrogenase is contained in lysate of any one or a mixture thereof selected from the group consisting of KCTC13925BP, KCTC14122BP, KCTC14123BP KCTCl4983BP, KCTCl4984BP and KCTC14985BP. In the broadest reasonable interpretation of the claim, said yeast is genetically unmodified and naturally occurring. The claim includes a nature-based product that does not exhibit markedly different characteristics from its naturally occurring counterpart in its natural state, the claim recites a "product of nature," which is a judicial exception.
Claim 16 is directed towards the pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia, comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTCl3925BP, KCTC14122BP, KCTC 14123BP KCTC 14983BP, KCTC 14984BP and KCTC 14985BP. In the broadest reasonable interpretation of the claim, said yeast is genetically unmodified and naturally occurring. The claim includes a nature-based product that does not exhibit markedly different characteristics from its naturally occurring counterpart in its natural state, the claim recites a "product of nature," which is a judicial exception.
Step 2, Prong Two: Does the claim recite additional elements that integrate the judicial exception into a practical application?
Claims 1-2, 9-10 includes the additional elements of aldehyde dehydrogenase encoded by the polynucleotide comprising the nucleic acid sequence set forth in the gene SEQ ID NO: 1 (claims 1, 9) and said gene SEQ ID NO: 1 including SEQ ID NO: 2 (claims 2, 10). However, the additional element (SEQ ID NO: 1; appendix A) is directed to a naturally occurring enzyme and its subsequent function. Furthermore, SEQ ID NO: 1 is a genomic sequence of yeast that encodes this enzyme (appendix A) and there is nothing in the claim that clearly states how this enzyme is different (if any) from a natural enzyme. The fact that is ‘includes’ SEQ ID NO: 2 does not make it markedly different from the naturally occurring enzyme as it is unclear where SEQ ID NO: 2 is ‘included’ within SEQ ID NO: 1. As such, said functionalities are not sufficient to integrate into a practical application (MPEP 2106.05(f)-(g)).
Claims 7-8, 15-16 merely recites the composition as consisting of Saccharomyces cerevisiae KCTC13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP. Applicant has not disclosed how the strains are ‘markedly different’ from their natural counterparts.
Step 2B: Does the claim recite additional elements that amount to significantly more than the judicial exception?
No. The judicial exception is recited without additional limitations amounting to significantly more than the exception. All of the signified additional elements to the judicial exception are considered to be native to the enzyme on which the judicial exception is to be performed as noted in Step 2A, Prong 2, and, therefore, do not amount to significantly more than the judicial exception that is claimed.
As the instant claims recite judicial exceptions that are not integrated into practical application, and no elements that amount to significantly more than the judicial exception as recited, the claims were found not to be drawn to eligible subject matter under 35 U.S.C. 101.
Claim Rejections - 35 USC § 112
Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 2-7, 10-15 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.2.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
Claims 2-6 are drawn to the food composition for improving memory and cognitive function of claim 1, wherein the aldehyde dehydrogenase is an aldehyde dehydrogenase encoded by the gene of SEQ ID NO: 1 including SEQ ID NO: 2. The structure of an aldehyde dehydrogenase enzyme encoded by the gene of SEQ ID NO: 1 including SEQ ID NO: 2 is unclear. Furthermore, SEQ ID NO: 2 is a sequence of 42 oligonucleotides, it is unclear what “including” means and what the relationship of SEQ ID NO:2 to SEQ ID NO:1 is in the context of the claimed gene, as it could be within the internal 5’ to 3’ region of the nucleotide sequence of SEQ ID NO:1 or on the 5’ end or 3’ end of said sequence. In addition, SEQ ID NO: 2 is just a DNA fragment of 42 nucleotides. Therefore, it is unclear how said sequence can encode a full length enzyme.
Claims 10-15 are drawn to the pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia of claim 9, wherein the aldehyde dehydrogenase is an aldehyde dehydrogenase encoded by the gene of SEQ ID NO: 1 including SEQ ID NO: 2. The structure of an aldehyde dehydrogenase enzyme encoded by the gene of SEQ ID NO: 1 including SEQ ID NO: 2 is unclear. Furthermore, SEQ ID NO: 2 is a sequence of 42 oligonucleotides, it is unclear what “including” means and what the relationship of SEQ ID NO:2 to SEQ ID NO:1 is in the context of the claimed gene, as it could be within the internal 5’ to 3’ region of the nucleotide sequence of SEQ ID NO:1 or on the 5’ end or 3’ end of said sequence. In addition, SEQ ID NO: 2 is just a DNA fragment of 42 nucleotides. Therefore, it is unclear how said sequence can encode a full length enzyme.
In this case, the specification discloses the following representative species of aldehyde dehydrogenase enzyme encoded by the gene of SEQ ID NO: 1 including SEQ ID NO: 2. as encompassed by the claims (i.e. an aldehyde dehydrogenase encoded by the gene SEQ ID NO: 1 which is characterized in that it contains SEQ ID NO: 2). Furthermore, the specification discloses mutant Saccharomyces cerevisiae KCTC14983BP, mutant Saccharomyces cerevisiae KCTC14984BP and mutant Saccharomyces cerevisiae KCTC14985BP as promoting the decomposition of endogenous aldehyde. Other than the above disclosed species, there is no prior-art or disclosed teaching as to the large number of variations upon which SSEQ ID NO: 1 can contain SEQ ID NO: 2. Furthermore, other than the disclosed species, there is no prior-art or disclosed teaching as to the large number of structures and functions upon which mutant Saccharomyces cerevisiae KCTC14983BP, mutant Saccharomyces cerevisiae KCTC14984BP and mutant Saccharomyces cerevisiae KCTC14985BP poses. The breadth of the claims encompass any variation upon which SEQ ID NO: 1 is including SEQ ID NO: 2 and any structure/function of mutant Saccharomyces cerevisiae KCTC14983BP, mutant Saccharomyces cerevisiae KCTC14984BP and mutant Saccharomyces cerevisiae KCTC14985BP.
An adequate written description of a chemical invention also requires a precise definition, such as by structure, formula, chemical name, or physical properties, and not merely a wish or plan for obtaining the chemical invention claimed. See, e.g., Univ. of Rochester v. G.D. Searle & Co., 358 F.3d 916, 927, 69 USPQ2d 1886, 1894-95 (Fed. Cir. 2004). Here, the disclosure fails to teach where SEQ ID NO: 2 is included within SEQ ID NO: 1 out of the numerous possibilities for promoting the decomposition of endogenous aldehyde. Furthermore, the disclosure fails to teach the structure and function of mutant Saccharomyces cerevisiae KCTC14983BP, mutant Saccharomyces cerevisiae KCTC14984BP and mutant Saccharomyces cerevisiae KCTC14985BP out of the numerous possibilities.
Accordingly, one of skill in the art would not accept the disclosure of SEQ ID NO: 1 including SEQ ID NO: 2 as being representative of all variations upon which SEQ ID NO: 2 can be included as encompassed by the claims. Furthermore, one would not accept the disclosure of mutant Saccharomyces cerevisiae KCTC14983BP, mutant Saccharomyces cerevisiae KCTC14984BP and mutant Saccharomyces cerevisiae KCTC14985BP are representative of all mutant Saccharomyces cerevisiae for the decomposition of endogenous aldehyde. As such, the specification, taken with the pre-existing knowledge in the art of aldehyde dehydrogenase, fails to satisfy the written description requirement of 35 U.S.C. 112, first paragraph.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 7-8, 15-16 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
The invention appears to employ novel genetically engineered Saccharomyces cerevisiae, KCT13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP. Since the deposited Saccharomyces cerevisiae strains: KCT13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP are essential to the claimed invention, they must be obtainable by a repeatable method set forth in the specification or otherwise be readily available to the public. The Saccharomyces cerevisiae strains, KCT13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP are not fully disclosed, nor have all the sequences required for their construction been shown to be publicly known and freely available. The enablement requirements of 35 U.S.C. 112 may be satisfied by a deposit of the Saccharomyces cerevisiae strains, KCT13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP. The specification does not disclose a repeatable process to obtain the vectors and it is not apparent if the DNA sequences are readily available to the public. Accordingly, it is deemed that a deposit of the Saccharomyces cerevisiae strains, KCT13925BP, KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCTC14985BP should have been made in accordance with 37 CFR 1.801-1.809.
If a deposit was made under the terms of the Budapest Treaty, then an affidavit or declaration by applicants, or a statement by an attorney of record over his or her signature and registration number, stating that the specific strain has been deposited under the Budapest Treaty and that the strain will be available to the public under the conditions specified in 37 CFR 1.808, would satisfy the deposit requirement made herein.
If the deposit has not been made under the Budapest treaty, then in order to certify that the deposit meets the criteria set forth in 37 CFR 1.801-1.809, applicants may provide assurance or compliance by an affidavit or declaration, or by a statement by an attorney of record over his or her signature and registration number, showing that:
1. during the pendency of this application , access to the invention will be afforded to the Commissioner upon request;
2. upon granting of the patent the strain will be available to the public under the conditions specified in 37 CFR 1.808;
3. the deposit will be maintained in a public repository for a period of 30 years or 5 years after the last request or for the effective life of the patent, whichever is longer; and
4. the deposit will be replaced if it should ever become inviable.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-7, 9-16 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 1 (claims 2-7 dependent therefrom), 8, the recitation of the phrase ‘improving memory and cognitive function’ is indefinite because it is unclear what the scope of the phrase is intended to encompass structurally. It is unclear what the phrase ‘improving memory and cognitive function’ is intended to encompass. It is unclear from the claims and specification what the phrase ‘improving memory and cognitive function’ is referring to structurally. Applicant has not properly ascertained how improving memory and (cognitive function) is measured. Accordingly, the metes and bounds upon which patent protection is sought cannot be ascertained from the claims. Appropriate correction is suggested.
Regarding claims 1 (claims 3-7 dependent therefrom), 2, 9, 10 (claims 11-15 dependent therefrom), the recitation of the term ‘gene’ is indefinite because it is unclear what the scope of the phrase is intended to encompass structurally. It is unclear what the term ‘gene’ is intended to encompass. It is unclear from the claims and specification what the term ‘gene’ is referring to structurally. Said term is broad. Additionally, it is not clear if the term ‘gene’ encompasses the regulatory sequences along with the sequence that encodes the polypeptide. Examiner would suggest amending the claim to recite “polynucleotide” in place of “gene.” Accordingly, the metes and bounds upon which patent protection is sought cannot be ascertained from the claims. Appropriate correction is suggested
Regarding claims 2 (claims 3-7 dependent thereof), 10 (claims 11-15 dependent thereof) the phrase "the gene of SEQ ID NO: 1 including SEQ ID NO: 2" renders the claim indefinite because SEQ ID NO: 2 shows that it is just an oligonucleotide of 42 nucleotides. As such, it is unclear what the phrase “by including” means. It is unclear if SEQ ID NO: 2 is included at the 5”end, 3” end or randomly within a region in SEQ ID NO: 1. Appropriate correction is suggested.
Claim 3 (claims 4-6 dependent thereof) recites the limitation 'the aldehyde' in lines 1-2. There is insufficient antecedent basis for this limitation in the claim. There is no prior recitation of ‘aldehyde’ in independent claim 1. The term “aldehyde” recited in claim 1 is with reference to the enzyme and not the product “aldehyde.” However, claim 3 appears to be referring to the product “aldehyde” and therefore lacks antecedence. Furthermore, the claim also refers to it as “endogenous aldehyde.” There is no subject, host, or microorganism recited in claim 1 and therefore this recitation that the aldehyde is endogenous is indefinite. Appropriate correction is suggested.
Claim 11 (claims 12-14 dependent thereof) recites the limitation 'the aldehyde' in line 2. There is insufficient antecedent basis for this limitation in the claim. There is no prior recitation of ‘aldehyde’ in independent claim 9 and claim 10, upon which claim 11 depends. The term “aldehyde” recited in claim 9 is with reference to the enzyme and not the product “aldehyde.” However, claim 11 appears to be referring to the product “aldehyde” and therefore lacks antecedence. Furthermore, the claim also refers to it as “endogenous aldehyde.” There is no subject, host, or microorganism recited in claim 9, also claim 10 upon which claim 9 depends, and therefore this recitation that the aldehyde is endogenous is indefinite. Appropriate correction is suggested.
Claim 16 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being incomplete for omitting essential elements, such omission amounting to a gap between the elements. See MPEP § 2172.01. As recited, claim 16 is in dependent form due to the recitation ‘the pharmaceutical.’ It is suggested that Applicant amend claim 16 to recite ‘A pharmaceutical.’ In the interest of compact prosecution, Examiner will examine claim 16 as reciting ‘A pharmaceutical.’
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-16 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Kwon et al (Patent No. US 11,618,889 B2, Date Filed: Feb 16, 2021, Examiner cited) {herein Kwon} as evidenced by Lee et al (December 12, 2019, Aging & Geriatrics, Examiner cited) {herein Lee}, Accession No: NM_001182673 (GenBank, Date Published: 17-May-2010, Examiner cited) {herein NM_001182673} and LN907796.1 (GenBank, Date Published: 29-Sep-2017, Examiner cited) {herein LN907796.1}.
Claims 1-7 are drawn to a food composition for improving memory and cognitive function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1.
Claim 8 is drawn to a food composition for improving behavior and motor function, further comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the lysates of group of microorganisms consisting of KCTC13925BP, KCTC14122BP,KCTC14123BP KCTC14983BP, KCTC 14984BP and KCTC 14985BP.
Claims 9-15 are drawn to a pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia, containing aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1.
Claim 16 is drawn to the pharmaceutical composition for suppressing and preventing Parkinson's disease, comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTC13925BP, KCTC14122BP, KCTC14123BP KCTC14983BP, KCTC14984BP and KCTC14985BP. Applicant is reminded that claim 16 is being interpreted as reciting a ‘pharmaceutical composition for suppressing and preventing Parkinson's disease, comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTC13925BP, KCTC14122BP, KCTC14123BP KCTC14983BP, KCTC14984BP and KCTC14985BP’ to facilitate prosecution.
With respect to claims 1-7, 9-15, Kwon teaches strains of Saccharomyces cerevisiae, KCTC13925BP, KCTC14122BP, KCTC14123BP, with high amounts of aldehyde dehydrogenase (column 5, lines 21-26; lines 30-32) and glutathione to reduce ROS and improve cognitive function (column 1, lines 31-34, 41-42). Absent evidence otherwise, it is the Examiner’s position that the treatment of cognitive disorders, taught by Kwon, includes the recited Alzheimer's and Louis Body dementia (claims 9-16) as it is known by those of ordinary skill in the art that Alzheimer's and Louis Body dementias are cognitive disorders that affect behavioral and motor functioning. Kwon further teaches that KCTC13925BP, KCTC14122BP, KCTC14123BP are utilized in food and medicines for the treatment of glutathione deficiencies (column 1, lines 55-59). Furthermore, it is the Examiner’s position that the recitation of “medicines” by Kwon is the same as a pharmaceutical composition. Kwon further teaches that among Koreans, excessive aldehyde residues in the body, produced by alcohol intake, have been reported to cause diseases resulting from oxidation, such as neurodegenerative diseases and aging (column 2, lines 34-40). Consumption of aldehyde dehydrogenase produced by KCTCl13925BP, KCTC 141 22BP, KCTC 141 23BP reduces the amount of excess aldehyde in the body (column 5, lines 9-12 and 21-26). As such, it is the Examiner’s position that the reduction of aldehyde in the body by aldehyde dehydrogenase produced by said strains is a suitable treatment for both excess alcohol intake and Alzheimer’s. Supporting the Examiner’s position is the evidentiary reference of Lee which recites that alcohol and Alzheimer's disease-prone genes may put humans at greater risk of Alzheimer's onset and progression (page 3, para 4) due to a mutation in the aldehyde dehydrogenase 2 gene which leads to the accumulation of aldehyde in the blood (page 3, para 2). Kwon further teaches acetaldehyde is a hangover causing substance that is produced by human cells via ethanol metabolism (column 3, lines 8-12). As such, absent evidence otherwise, it is the Examiner’s position that said acetaldehyde is an endogenous acetaldehyde. Said strains also convert aminoacetone (an amine) into lactic acid (column 4, lines 32-33). It is the Examiner’s position that the recited SEQ ID NO: 1 (instant application claims 1, 9) and recited ‘gene of SEQ ID NO: 1 including SEQ ID NO: 2’ (instant application claims 2, 10) are the same as the aldehyde dehydrogenase from strains KCTCl13925BP, KCTC14122BP, KCTC14123BP, taught by Kwon since Applicant recites ‘the aldehyde dehydrogenase is contained in lysate of any one or a mixture thereof selected from the group consisting of KCTCl3925BP, KCTCl4122BP, KCTCl4123BP’ within the instant application claims 7, 15, of which Kwon teaches strains of Saccharomyces cerevisiae, KCTC13925BP, KCTC14122BP, KCTC14123BP (column 5, lines 21-26; lines 30-32). Supporting the Examiner position is the evidentiary references of NM_001182673.1 (appendix A) and LN907796.1 (appendix B) which provides evidence that NM_001182673.1 is 100% identical to the instant application SEQ ID NO: 1 (appendix A) and LN907796.1 is 100% identical to the instant application SEQ ID NO: 2 (appendix B; see above rejection under 112b) of which are sequences within Saccharomyces cerevisiae (para 0001). Furthermore, said sequence would inherently have the characteristic of promoting the oxidation of endogenous amine compounds such as dopamine, norepinephrine, serotonin and GABA, as recited in the instant application claims 5, 13 and the oxidation of formaldehyde, acetaldehyde, 4-hydroxy-2-nonenal, non-2-enal, 4-hydroxy-hexanal (4- hydroxy-hexanal), 4-oxo-nonena, malondialdehyde (MDA), propionaldehyde, hexanal (hexanal), palmitic aldehyde, succinic aldehyde and acrylic aldehydem as recited in the instant application claims 6, 14. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. Especially since acetylaldehyde dehydrogenase 2 uses acetaldehyde as a substrate for the oxidation and removal/oxidation of acetaldehyde (column 3, line 7).
With respect to claim 8, Kwon teaches mutant strains of Saccharomyces cerevisiae, KCTC13925BP, KCTC14122BP, KCTC14123BP, with high levels of aldehyde dehydrogenase (column 5, lines 21-26; lines 30-32) and glutathione to reduce ROS, improve cognitive function and disease prevention (column 1, lines 31-34, 41-42). Absent evidence otherwise, it is the Examiner’s position that the treatment of cognitive disorders, taught by Kwon, includes the recited Parkinson’s disease (instant application claim 8) as it is known by those of ordinary skill in the art that Parkinson’s disease is a cognitive disorder that affects behavioral and motor functioning. Kwon further teaches that KCTC13925BP, KCTC14122BP, KCTC14123BP are utilized in food and medicines for the treatment of glutathione deficiencies (column 1, lines 55-59). In addition, Kwon teaches the aldehyde dehydrogenase is located within the lysate of the microorganism (column 12, lines 15).
With respect to claim 16, Kwon teaches strains of Saccharomyces cerevisiae, KCTC13925BP, KCTC14122BP, KCTC14123BP, with high amount of aldehyde dehydrogenase (column 5, lines 21-26; lines 30-32) and glutathione to reduce ROS and improve cognitive function (column 1, lines 31-34, 41-42). Absent evidence otherwise, it is the Examiner’s position that the treatment of cognitive disorders, taught by Kwon, includes the recited Parkinson’s disease (claim 16) as it is known by those of ordinary skill in the art that Parkinson’s disease is a cognitive disorder that affects behavioral and motor functioning. Kwon further teaches that KCTC13925BP, KCTC14122BP, KCTC14123BP are utilized in food and medicines for the treatment of glutathione deficiencies (column 1, lines 55-59). It is the Examiner’s position that the recitation of “medicines” is the same as a pharmaceutical composition.
For the reasons stated herein, the teachings of Kwon anticipate claims 1-16.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-7, 9-15 are rejected under 35 U.S.C. 103 as being unpatentable over Kwon et al (Patent No. US 11,618,889 B2, Date Filed: Feb 16, 2021, Examiner cited) {herein Kwon} in view of Lee et al (2019, Stanford Medicine, Examiner cited) {herein Lee} as evidenced by Accession No: NM_001182673 (GenBank, Date Published: 17-May-2010, Examiner cited) {herein NM_001182673} and LN907796.1 (GenBank, Date Published: 29-Sep-2017, Examiner cited) {herein LN907796.1}. The applied reference has a common Inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2).
This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
Claims 1-7 are drawn to a food composition for improving behavioral and motor function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1.
Claims 9-15 are drawn to a pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia, containing aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1.
With respect to claims 1-7, 9-15, Kwon teaches strains of Saccharomyces cerevisiae, KCTC13925BP, KCTC14122BP, KCTC14123BP, with high amounts of aldehyde dehydrogenase (column 5, lines 21-26; lines 30-32) and glutathione to reduce ROS and improve cognitive function (column 1, lines 31-34, 41-42). Absent evidence otherwise, it is the Examiner’s position that the treatment of cognitive disorders, taught by Kwon, includes the recited Alzheimer's and Louis Body dementia (claims 9-16) as it is known by those of ordinary skill in the art that Alzheimer's and Louis Body dementias are cognitive disorders that affect behavioral and motor functioning. Kwon further teaches that KCTC13925BP, KCTC14122BP, KCTC14123BP are utilized in food and medicines for the treatment of glutathione deficiencies (column 1, lines 55-59). Furthermore, it is the Examiner’s position that the recitation of “medicines” by Kwon is the same as a pharmaceutical composition. Kwon further teaches that among Koreans, excessive aldehyde residues in the body, produced by alcohol intake, have been reported to cause diseases resulting from oxidation, such as neurodegenerative diseases and aging (column 2, lines 34-40). Consumption of aldehyde dehydrogenase produced by KCTCl13925BP, KCTC 141 22BP, KCTC 141 23BP reduces the amount of excess aldehyde in the body (column 5, lines 9-12 and 21-26). As such, it is the Examiner’s position that the reduction of aldehyde in the body by aldehyde dehydrogenase produced by said strains is a suitable treatment for both excess alcohol intake and Alzheimer’s. Supporting the Examiner’s position is the reference of Lee which teaches the ‘Asian glow’ mutation (brought about due to excess alcohol intake) may contribute to Alzheimer’s disease due to a defective version of the aldehyde dehydrogenase 2 gene when alcohol is consumed (page 1, para 2). Lee further teaches that alcohol and Alzheimer's disease-prone genes may put humans at greater risk of Alzheimer's onset and progression (page 3, para 4) due to a mutation in the aldehyde dehydrogenase 2 gene which leads to the accumulation of aldehyde in the blood (page 3, para 2). Kwon further teaches acetaldehyde is a hangover causing substance that is produced by human cells via ethanol metabolism (column 3, lines 8-12). As such, absent evidence otherwise, it is the Examiner’s position that said acetaldehyde is an endogenous acetaldehyde. Said strains also convert aminoacetone (an amine) into lactic acid (column 4, lines 32-33). It would be obvious to one of ordinary skill in the art that the recited SEQ ID NO: 1 (instant application claims 1, 9) and recited ‘gene of SEQ ID NO: 1 including SEQ ID NO: 2’ (instant application claims 2, 10) are the same as the aldehyde dehydrogenase from strains KCTCl13925BP, KCTC14122BP, KCTC14123BP, taught by Kwon since Applicant recites ‘the aldehyde dehydrogenase is contained in lysate of any one or a mixture thereof selected from the group consisting of KCTCl3925BP, KCTCl4122BP, KCTCl4123BP’ within the instant application claims 7, 15, of which Kwon teaches strains of Saccharomyces cerevisiae, KCTC13925BP, KCTC14122BP, KCTC14123BP (column 5, lines 21-26; lines 30-32). Supporting the Examiner position is the evidentiary references of NM_001182673.1 (appendix A) and LN907796.1 (appendix B) which provides evidence that NM_001182673.1 is 100% identical to the instant application SEQ ID NO: 1 (appendix A) and LN907796.1 is 100% identical to the instant application SEQ ID NO: 2 (appendix B; see above rejection under 112b) of which are sequences within Saccharomyces cerevisiae (para 0001). Furthermore, said sequence would inherently have the characteristic of promoting the oxidation of endogenous amine compounds such as dopamine, norepinephrine, serotonin and GABA, as recited in the instant application claims 5, 13 and the oxidation of formaldehyde, acetaldehyde, 4-hydroxy-2-nonenal, non-2-enal, 4-hydroxy-hexanal (4- hydroxy-hexanal), 4-oxo-nonena, malondialdehyde (MDA), propionaldehyde, hexanal (hexanal), palmitic aldehyde, succinic aldehyde and acrylic aldehydem as recited in the instant application claims 6, 14. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. Especially since acetylaldehyde dehydrogenase 2 uses acetaldehyde as a substrate for the oxidation and removal/oxidation of acetaldehyde (column 3, line 7).
Non-Statutory Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-16 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1- 6 of U.S. Patent No. US 11618889 B2 to Kwon, hereinafter referred to as ’889, which are commonly owned and have common inventors and filed before the instant application. Although the claims at issue are not identical, they are not patentably distinct from each other because claims 1- 6 of ‘889, drawn to Saccharomyces cerevisiae yeast having an enhanced ability to produce aldehyde dehydrogenase and glutathione concurrently, the Saccharomyces cerevisiae yeast is selected from the group consisting of Saccharomyces cerevisiae Kwon P-1 KCTC13925BP, Saccharomyces cerevisiae Kwon P-2 KCTC14122BP, and Saccharomyces cerevisiae Kwon P-3 KCTC14123BP, wherein the Saccharomyces cerevisiae yeast is obtained by a process comprising: a first step for treating a Saccharomyces cerevisiae yeast with ethylmethanesulfonate or nitrosoguanidine to induce mutation, a second step for treating the induced mutant yeast obtained in the first step with methylglyoxal to select a methylglyoxal-adapted mutant yeast from the induced mutant yeast, and a third step for treating the methylglyoxal-adapted mutant yeast selected in the second step with lysine to select a lysine-adapted mutant yeast from the methylglyoxal-adapted mutant yeast selected in the second step, anticipate and/or make obvious instant claims 1-16 a food composition for improving memory and cognitive function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1; a food composition for improving memory and cognitive function, comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTCl13925BP, KCTC 141 22BP, KCTC 141 23BP KCTC 14983BP, KCTC14984BP and KCTC14985BP; a pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia, containing aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1.
Claims 1-16 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over copending claims 1-5 of copending Application No. 18/519,482 (Kwon), hereinafter referred to as ‘482, which are commonly owned and have common inventors and filed before the instant application. Although the claims at issue are not identical, they are not patentably distinct from each other because copending claims 1-5 of ‘482, drawn to a composition for alleviating endoplasmic reticulum stress, containing any one or a mixture thereof selected from the group consisting of Saccharomyces cerevisiae KCTC13925BP,KCTC14122BP, KCTC14123BP, KCTC14983BP, KCTC14984BP, and KCT1l4985BP, anticipate and/or make obvious instant claims 1-16 drawn to a food composition for improving memory and cognitive function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1; a food composition for improving memory and cognitive function, comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTCl13925BP, KCTC 141 22BP, KCTC 141 23BP KCTC 14983BP, KCTC14984BP and KCTC14985BP; a pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia, containing aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 1-16 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-11 of copending Application No. 18/519,569 (Kwon), hereinafter referred to as ’569, which are commonly owned and have common inventors and filed before the instant application. Although the claims at issue are not identical, they are not patentably distinct from each other because copending claims 1-11 of ‘569, drawn to a food composition that suppresses or improves symptoms of tremor or movement disorder, containing an aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1, anticipate and/or make obvious instant claims 1-16 drawn to a food composition for improving memory and cognitive function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1; a food composition for improving memory and cognitive function, comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTCl13925BP, KCTC 141 22BP, KCTC 141 23BP KCTC 14983BP, KCTC14984BP and KCTC14985BP; a pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia, containing aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 1-16 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-6 of copending Application No. 18/519,500 (Kwon), hereinafter referred to as ’500, which are commonly owned and have common inventors and filed before the instant application. Although the claims at issue are not identical, they are not patentably distinct from each other because copending claims 1-6 of ‘500 is drawn to a composition for promoting decomposition of endogenous aldehyde, containing an aldehyde dehydrogenase, wherein the aldehyde dehydrogenase is encoded by the polynucleotide comprising the nucleic acid sequence set forth in SEQ ID NO: 1, anticipate and/or make obvious instant claims 1-16 drawn to a food composition for improving memory and cognitive function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1; a food composition for improving memory and cognitive function, comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTCl13925BP, KCTC 141 22BP, KCTC 141 23BP KCTC 14983BP, KCTC14984BP and KCTC14985BP; a pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia, containing aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 1-16 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-7 of copending Application No. 18/954,826 (Kwon), hereinafter referred to as ’826, which are commonly owned and have common inventors and filed before the instant application. Although the claims at issue are not identical, they are not patentably distinct from each other because copending claims 1-7 of ‘826, drawn to a food composition for improving behavioral and motor function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1 and a food composition for improving behavior and motor function, further comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTC13925BP, KCTC14122BP, KCTC14123BP KCTC14983BP, KCTC14984BP and KCTC14985BP, anticipate and/or make obvious instant claims 1-16 drawn to a food composition for improving memory and cognitive function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1; a food composition for improving memory and cognitive function, comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTCl13925BP, KCTC 141 22BP, KCTC 141 23BP KCTC 14983BP, KCTC14984BP and KCTC14985BP; a pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia, containing aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented
Claims 1-16 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 6 of copending Application No. 17/792,836 (Kwon), hereinafter referred to as ’836, which are commonly owned and have common inventors and filed before the instant application. Although the claims at issue are not identical, they are not patentably distinct from each other because copending claim 6 of ‘836, drawn to a hangover relieving composition comprising: glutathione and aldehyde dehydrogenase, wherein the glutathione and aldehyde dehydrogenase are derived from a lysate or extract of a mutant Saccharomyces cerevisiae yeast, and wherein the mutant Saccharomyces cerevisiae yeast is selected from the group consisting of Saccharomyces cerevisiae Kwon P-1 KCTC13925BP, Saccharomyces cerevisiae Kwon P-2 KCTC14122BP, Saccharomyces cerevisiae Kwon P-3 KCTC14123BP, and a mixture thereof, anticipate and/or make obvious instant claims 1-16 drawn to a food composition for improving memory and cognitive function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1; a food composition for improving memory and cognitive function, comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTCl13925BP, KCTC 141 22BP, KCTC 141 23BP KCTC 14983BP, KCTC14984BP and KCTC14985BP; a pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia, containing aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 1-16 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-6 US Patent No. 12378532B2 (Kwon), hereinafter referred to as ’532, which are commonly owned and have common inventors and filed before the instant application. Although the claims at issue are not identical, they are not patentably distinct from each other because claim 1 of ‘532 is drawn to a method for treating Alzheimer Dementia in a subject in need thereof, comprising administering to the subject a food composition containing aldehyde dehydrogenase, wherein the aldehyde dehydrogenase is encoded by a gene having the sequence of SEQ ID NO: 1 (claim 1), wherein the aldehyde dehydrogenase is contained in lysate of any one or a mixture thereof selected from the group consisting of: Saccharomyces cerevisiae KCTC13925BP, Saccharomyces cerevisiae KCTC14122BP, Saccharomyces cerevisiae KCTC14123BP, Saccharomyces cerevisiae KCTC14983BP, Saccharomyces cerevisiae KCTC14984BP and Saccharomyces cerevisiae KCTC14985BP (claim 6), anticipate and/or make obvious instant claims 1-16 drawn to a food composition for improving memory and cognitive function, containing aldehyde dehydrogenase encoded by a gene having more than 98% homology to the gene of SEQ ID NO: 1; a food composition for improving memory and cognitive function, comprising aldehyde dehydrogenase contained in lysate of any one or a mixture thereof selected from the group consisting of KCTCl13925BP, KCTC 141 22BP, KCTC 141 23BP KCTC 14983BP, KCTC14984BP and KCTC14985BP; a pharmaceutical composition for suppressing and preventing Alzheimer's or Louis Body dementia, containing aldehyde dehydrogenase encoded by a gene with more than 98% homology to the gene of SEQ ID NO: 1. It is noted that the issued claims of ‘532 are drawn to a method. However, ‘532 is a CON (not a DIV) of the instant application and there was never a restriction in the instant or in the issued case, ‘532. Therefore, Applicants do not get the safe harbor over an ODP. The same strains claimed in the instant application have been claimed in the allowed method and therefore said strains could now be claimed as a composition or as a part of a food composition.
Conclusion
Status of Claims
Claims 1-16 are pending.
Claims 1-16 are rejected.
No claims are in condition for allowance.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ERICA NICOLE JONES-FOSTER whose telephone number is (571)270-0360. The examiner can normally be reached mf 7:30a - 4:30p.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Manjunath Rao can be reached at 571-272-0939. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ERICA NICOLE JONES-FOSTER/Examiner, Art Unit 1656
/MANJUNATH N RAO/Supervisory Patent Examiner, Art Unit 1656
Appendix A
Accession No: GenBank: NM_001182673.1 (BLAST search with 100% identity to instant application SEQ ID NO: 1)
Query 1534 ATGCCTACCTTGTATACTGATATCGAAATCCCACAATTGAAAATCTCTTTAAAGCAACCG 1593
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 ATGCCTACCTTGTATACTGATATCGAAATCCCACAATTGAAAATCTCTTTAAAGCAACCG 60
Query 1594 CTAGGGTTGTTTATCAACAATGAGTTTTGTCCATCATCAGATGGAAAGACCATCGAAACT 1653
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 CTAGGGTTGTTTATCAACAATGAGTTTTGTCCATCATCAGATGGAAAGACCATCGAAACT 120
Query 1654 GTGAACCCAGCTACTGGCGAACCGATAACATCCTTCCAAGCAGCTAACGAAAAGGATGTA 1713
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 121 GTGAACCCAGCTACTGGCGAACCGATAACATCCTTCCAAGCAGCTAACGAAAAGGATGTA 180
Query 1714 GACAAAGCTGTGAAAGCTGCCAGGGCTGCTTTTGATAACGTTTGGTCGAAGACATCTTCT 1773
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 GACAAAGCTGTGAAAGCTGCCAGGGCTGCTTTTGATAACGTTTGGTCGAAGACATCTTCT 240
Query 1774 GAGCAACGTGGTATTTATCTTTCAAACTTATTAAAACTTATTGAGGAGGAGCAAGACACA 1833
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 GAGCAACGTGGTATTTATCTTTCAAACTTATTAAAACTTATTGAGGAGGAGCAAGACACA 300
Query 1834 CTTGCCGCATTAGAGACTTTAGACGCTGGTAAGCCTTTCCATTCCAATGCTAAACAAGAC 1893
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 CTTGCCGCATTAGAGACTTTAGACGCTGGTAAGCCTTTCCATTCCAATGCTAAACAAGAC 360
Query 1894 TTAGCCCAGATTATAGAACTTACAAGATACTATGCGGGGGCGGTCGACAAGTTCAATATG 1953
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 TTAGCCCAGATTATAGAACTTACAAGATACTATGCGGGGGCGGTCGACAAGTTCAATATG 420
Query 1954 GGTGAAACCATTCCATTGACTTTTAACAAGTTTGCATATACTCTAAAAGTTCCTTTTGGC 2013
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 GGTGAAACCATTCCATTGACTTTTAACAAGTTTGCATATACTCTAAAAGTTCCTTTTGGC 480
Query 2014 GTTGTTGCTCAAATCGTTCCATGGAATTATCCTCTAGCTATGGCTTGTAGAAAAATGCAA 2073
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 GTTGTTGCTCAAATCGTTCCATGGAATTATCCTCTAGCTATGGCTTGTAGAAAAATGCAA 540
Query 2074 GGTGCCTTAGCGGCCGGTAACACGGTTATCATCAAACCTGCTGAAAATACCTCTCTATCT 2133
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GGTGCCTTAGCGGCCGGTAACACGGTTATCATCAAACCTGCTGAAAATACCTCTCTATCT 600
Query 2134 CTACTTTATTTTGCTACTTTAATTAAAAAAGCAGGTTTTCCACCTGGTGTTGTCAATGTC 2193
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 601 CTACTTTATTTTGCTACTTTAATTAAAAAAGCAGGTTTTCCACCTGGTGTTGTCAATGTC 660
Query 2194 ATTCCTGGTTATGGTTCCGTTGTGGGGAAAGCTTTAGGAACCCACATGGATATCGACAAA 2253
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 661 ATTCCTGGTTATGGTTCCGTTGTGGGGAAAGCTTTAGGAACCCACATGGATATCGACAAA 720
Query 2254 ATATCTTTTACGGGAAGTACTAAGGTTGGCGGCTCAGTATTGGAAGCTTCCGGCCAATCG 2313
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 721 ATATCTTTTACGGGAAGTACTAAGGTTGGCGGCTCAGTATTGGAAGCTTCCGGCCAATCG 780
Query 2314 AACCTTAAGGATATCACACTAGAATGCGGTGGTAAGTCTCCTGCTCTTGTATTTGAAGAT 2373
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 781 AACCTTAAGGATATCACACTAGAATGCGGTGGTAAGTCTCCTGCTCTTGTATTTGAAGAT 840
Query 2374 GCAGACCTTGATAAGGCTATAGAATGGGTAGCAAATGGTAttttttttAATTCGGGACAG 2433
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 841 GCAGACCTTGATAAGGCTATAGAATGGGTAGCAAATGGTATTTTTTTTAATTCGGGACAG 900
Query 2434 ATCTGCACTGCAAACTCAAGAGTTTATGTTCAAAGTTCGATCTACGACAAGTTTGTTGAA 2493
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 901 ATCTGCACTGCAAACTCAAGAGTTTATGTTCAAAGTTCGATCTACGACAAGTTTGTTGAA 960
Query 2494 AAGTTTAAAGAAACTGCAAAGAAGGAGTGGGATGTTGCAGGAAAATTTGATCCGTTTGAT 2553
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 961 AAGTTTAAAGAAACTGCAAAGAAGGAGTGGGATGTTGCAGGAAAATTTGATCCGTTTGAT 1020
Query 2554 GAGAAATGCATCGTTGGTCCAGTTATATCAAGTACACAGTATGACCGCATCAAAAGTTAC 2613
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1021 GAGAAATGCATCGTTGGTCCAGTTATATCAAGTACACAGTATGACCGCATCAAAAGTTAC 1080
Query 2614 ATAGAACGTGGTAAAAAGGAGGAAAAGTTGGACATGTTCCAGACCTCTGAATTTCCTATT 2673
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1081 ATAGAACGTGGTAAAAAGGAGGAAAAGTTGGACATGTTCCAGACCTCTGAATTTCCTATT 1140
Query 2674 GGTGGAGCTAAAGGCTACTTCATTCCCCCAACCATCTTCACTGATGTACCAGAAACATCT 2733
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1141 GGTGGAGCTAAAGGCTACTTCATTCCCCCAACCATCTTCACTGATGTACCAGAAACATCT 1200
Query 2734 AAGTTGCTGCGTGATGAAATATTTGGCCCGGTTGTGGTTGTTAGCAAGTTCACAAATTAT 2793
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1201 AAGTTGCTGCGTGATGAAATATTTGGCCCGGTTGTGGTTGTTAGCAAGTTCACAAATTAT 1260
Query 2794 GATGACGCTCTGAAGCTGGCTAATGATACTTGCTACGGGCTCGCCTCTGCGGTCTTCACC 2853
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1261 GATGACGCTCTGAAGCTGGCTAATGATACTTGCTACGGGCTCGCCTCTGCGGTCTTCACC 1320
Query 2854 AAAGATGTCAAGAAAGCGCACATGTTTGCTCGCGATATTAAAGCAGGAACTGTTTGGATC 2913
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1321 AAAGATGTCAAGAAAGCGCACATGTTTGCTCGCGATATTAAAGCAGGAACTGTTTGGATC 1380
Query 2914 AATCAAACCAATCAAGAAGAAGCTAAAGTTCCTTTTGGCGGATTTAAGATGAGTGGTATT 2973
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1381 AATCAAACCAATCAAGAAGAAGCTAAAGTTCCTTTTGGCGGATTTAAGATGAGTGGTATT 1440
Query 2974 GGTAGAGAATCAGGCGACACCGGCGTTGATAACTATTTACAAATAAAATCAGTCCATGTG 3033
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1441 GGTAGAGAATCAGGCGACACCGGCGTTGATAACTATTTACAAATAAAATCAGTCCATGTG 1500
Query 3034 GATCTTTCATTGGATAAATAA 3054
|||||||||||||||||||||
Sbjct 1501 GATCTTTCATTGGATAAATAA 1521
Appendix B
GenBank LN907796.1 is 100% identical to the instant application SEQ ID NO: 2
Saccharomyces cerevisiae N85 chromosome XIII, complete genome
Sequence ID: LN907796.1 Length: 895281 Number of Matches: 1
Range 1: 317317 to 317358 GenBank GraRhics l\lnvf _Malet!_ .. PreVIQUS Mc1tch
Score
78.7 bits(42)
Expect
2e-11
Identities
42/42(100%)
Gaps
0/42(0%)
Strand
Plus/Plus
Query 1 AGATATAGATTATACACATTTAGAAAATTAGCCAAAAGAAAA 42
111111111111111 I I I I I I I I I I I I I I I I I I I I I I I I I I I
Sbjct 317317 AGATATAGATTATACACATTTAGAAAATTAGCCAAAAGAAAA 317358
Prosecution Insights