DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application and Claim Status Summary
Claims 1- 13 are pending.
Claims 11- 13 are withdrawn.
Claims 1- 10 are considered on the merits.
Claims 1- 10 are rejected.
No Claims are allowed.
Election/Restrictions
This action is written in response to applicant's correspondence received 2026 July 7. Claims 1- 10 are currently pending and under examination.
Applicant’s election without traverse of Group I, drawn to "method of prophylactic and therapeutic treatment of metal toxicity," in the reply filed on 2026 July 7 is acknowledged.
Claims 11- 13 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 2026 July 7.
The applicant failed to properly elect a species from group A drawn to a “toxic metal” and similarly failed to elect a species from group B drawn to “a binding aptamer.” In the interest of expedited prosecution, the species election requirement is withdrawn.
Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i).
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1 -10 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
Breadth of the Claims
Claim 1 is directed toward a method of treating metal toxicity with a metal-binding aptamer. The step, “determining a binding aptamer having an affinity for a toxic metal” includes a broad spectrum of aptamer structures. The further aptamer limitation defined by the function “having an affinity for a toxic metal” is similarly broad. Accordingly, possession of the claimed “metal binding aptamer” as broadly claimed requires possession of the genus of “metal binding aptamers.”
Support Provided by the Specification
The specification does not provide any data supporting any aptamer binding any metal other than lead nor any prophetic examples. Furthermore, the specification provides working examples of only four different aptamers.
The specification provides the broad scope of the invention “An aptamer having an affinity for toxic metals such as lead is introduced by a biocompatible delivery mechanism such as a DNA or RNA strand to which the aptamer is attached” [page 2, lines 7- 10].
The specification recites affinities of the aptamers, PB7, PB7S, and PB14 of the instant invention “aptamers, known as Pb7 and Pb 14, have been shown to have low micromolar to high nanomolar affinity (1.60 ± 0.16 μM and 0.76 ± 0.18 μM, respectively) for lead ions” [page 5, lines 15-17]. The specification provides binding data for these particular aptamers against lead ions. The Example in Figure 4 further describes an effective concentration of aptamer “The minimum effective concentration of aptamer required to achieve full protection from exposure at 15mM lead acetate was 2.5 μM.” [page 10, lines 19- 21].
The only structural data provided by the specification is primary sequence data for PB7, PB7S, PB7S antisense, and PB7S scrambled [Table 1, page 8]. The specification indicates their aptamer binds metal (lead) via chelation. In fact, the specification suggests chelation via G quadraplex structural motif, “Structural analyses suggest that lead can associate with nucleic acids through so-called G quadruplex (G4) structures” [page 5, lines 17- 19] and again “The C. elegans model, demonstrates that that lead-chelating DNA and RNA aptamers applied in the presence of lead protect the animals …” [page 6, lines 6- 8]; and once again “Such aptamer-based chelation can be further developed as a prophylactic or therapeutic strategy” [page 6, line 13]. However, the G quadraplex structure is merely prophetic; there is no data to support the claimed structure.
State of the Prior Art and Determination of Possession
The limited working example of a “metal binding aptamers” cited above and the few cited sequences are insufficient to represent the genus “metal binding aptamer” because RNA aptamers, by their nature, are target specific and non-interchangeable as described by Stoltenberg, (Stoltenburg et al. J Anal Methods Chem. 2012;2012:415697.) “Aptamers are by nature nucleic acid molecules, but their functionality is based on their complex three-dimensional structure ... The complex folding of the short, single stranded DNA or RNA aptamers according to their primary sequence enables them to bind with high affinity and specificity to the given target.” (page 1, 1st column, 1st paragraph). Likewise, Zhou (Zhou et al. Nat Rev Drug Discov. 2017 Mar;16(3):181-202.) describes the specificity of RNA aptamers is comparable to antibodies, “Nucleic acid aptamers, often termed “chemical antibodies”, are functionally comparable to traditional antibodies” (Abstract). Furthermore, Zhou describes both the rarity of any random aptamer binding specifically, and the rigorous selection (exclusion) process by citing the following Ellington study, “Candidate binding sequences are then subjected to iterative selection rounds …. Starting with a combinatorial pool of 1013 different sequences [average length 100 nt], they successfully identified [about 100-1,000] RNA molecules capable of specifically binding to small organic dyes” (page 181, 1st column, 1st paragraph). The improbability of the broad genus of any aptamer binding to any metal as cited in the instant claim is highlighted by the authors of this study, “pools of roughly 1013 different RNA molecules, of average length 100 nt, contain 102-105 different sequences capable of specific binding… even a pool of 1013 molecules contains only a very small fraction of all possible sequences (10-47), and therefore the total number of different sequences that can bind to a given ligand must be in the range of 1049-1052” (page 820, 2nd column, 4th paragraph) Ellington (Ellington et al. Nature. 1990 Aug 30;346(6287):818-22.).
In light of the dearth of data presented and challenges in the art, the applicant fails to show a proper sampling of “metal binding aptamers” that are indicative of the claim and therefore, the applicant has not shown they are in possession of the genus of the invention “metal binding aptamers” as claimed.
Therefore, for the reasons stated above, the specification fails to satisfy the written description requirement of 35 U.S.C. 112, first paragraph, with respect to claim 1.
Regarding Claims 2- 10, the claims each depend directly or indirectly from claim 1. None of the limitations of the dependent claims satisfy the written description deficiency described of claim 1.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1, 3, 5- 7, and 9 is/are rejected under 35 U.S.C. 103 as being unpatentable over of Poolsup (Poolsup et al. Curr Opin Biotechnol. 2017 Dec;48:180-186.), and further in view of Liu (Liu et al. Sci Rep. 2022 Jan 10;12(1):460.), and Famulok (Famulok et al. Chem Rev. 2007 Sep;107(9):3715-43.).
In their review, Poolsup teaches methods of treatment via aptamers “Aptamers were also used to address inflammatory diseases, infectious diseases, cardiovascular diseases, and eye diseases” (Abstract). Poolsup further teaches the methods can target metal ions and potentially be used to treat metal toxicity, “Researchers have successfully generated aptamers which recognize specific metal ions… Aptamers show much promise as future therapeutics” (Abstract). Therefore, Poolsup teaches “A method of prophylactic and therapeutic treatment of … toxicity, comprising determining a binding aptamer having an affinity for a [toxin] …”
Poolsup does not teach “… a binding aptamer having an affinity for a toxic metal;… generating a nucleic acid strand including the binding aptamer; and delivering the generated nucleic acid strand into a therapeutic region for binding and transport of the toxic metal.”
Liu teaches metal toxicity, specifically lead toxicity, aptamers that bind lead specifically, and the roles metal and lead binding aptamers play in human health and therapeutics, “Lead (Pb) is one of the most toxic heavy metals known to date… Through mimicking of essential elements such as iron, zinc and calcium, Pb can enter and accumulate in the human body, impairing the functions of multiple organs including kidney, heart and brain… Pb poisoning has been recognized as one major public problem…. various Pb2+-binding DNA aptamers have been identified. Exampled by PS2.M14, PW17, T30695… ” (page 1, 2nd and 3rd paragraph). In these statements, Liu teaches “metal toxicity” and “… a binding aptamer having an affinity for a toxic metal.”
Liu does not teach “… generating a nucleic acid strand including the binding aptamer; and delivering the generated nucleic acid strand into a therapeutic region for binding and transport of the toxic metal.”
In their review, Famoluk teaches the method of generating nucleic acid aptamers, “Aptamers can be isolated in Vitro from vast combinatorial libraries that comprise trillions of different sequences, by a process called “in Vitro selection”, or “SELEX”… the first [step] of which is the generation of a nucleic acid library of random sequences.” (page 3715, 2nd column, 2nd paragraph). Here, Famoluk teaches “… generating a nucleic acid strand including the binding aptamer…” Furthermore, Famoluk envisions, and therefore teaches “delivering the generated nucleic acid strand into a therapeutic region for binding … of the toxic metal” by stating, “Aptamers have been used in an increasing number of applications inside living cells and even whole organisms… Therefore, one of the main future goals remains the development of efficient delivery strategies” (page 3724, 1st column, 4th paragraph).
Furthermore, Famulok teaches “This class of functional nucleic acids [aptamers] can fold into complex three-dimensional shapes, forming binding pockets and clefts for the specific recognition and tight binding of any given molecular target, … [for example] metal ions…” (page 3715, 2nd column, 1st paragraph). Famulok, further envisions (teaches) therapeutic aptamer use directed toward metals “However, allosteric aptazymes can also be isolated directly by in vitro selection approaches. This is useful in cases in which no aptamer for a particular ligand is available or in which an aptazyme is sought to perform under special conditions such as limited divalent metal ion concentrations…” (page 3731, 2nd column, 4th paragraph).
Famoluk does not teach “… and transport of the toxic metal.”
However, the instant specification indicates aptamers are “expelled as waste” without exogenous influence [page 2, line 27]. The specification further reinforces this is a natural phenomenon in Figure 7, “The bound toxin is then capable of removal by patient physiology as waste, via the kidneys or GI tract.” [page 14, lines 14, 15]. Therefore, the limitation “… and transport…” is a scientific truism that adds no patentable weight to the claim.
It would have been obvious for a person having ordinary skill in the art (PHOSITA) before the effective filing date of the claimed invention to have used Poolsup’s method to treat toxicity with aptamers with Liu’s aptamers that target metal toxicity because a PHOSITA would have been motivated to have done so because Liu teaches that metal toxicity was a known problem and they teach that aptamers are a known solution to the known metal toxicity problem and further demonstrate specific aptamers that bind metal ions and their potential therapeutic benefit. Accordingly, a PHOSITA would have been motivated to have generated and delivered such aptamers according to the method of Famulok for the advantage of making and using such aptamers.
Regarding claim 3, Liu further teaches the instant limitation with the statement, “These high-resolution crystal structures showed that [aptamer] TBA forms intramolecular G-quadruplex and Pb2+ is bound by the two G-tetrads in the center.” (Abstract).
Regarding claim 5, in discussing the delivery strategies above, Famulok, describes several methods of combining the nucleic acid with a biocompatible delivery mechanism, “Promising techniques are being investigated, among them the use of cell membrane penetrating peptides, finding of efficient but safe retroviral expression vectors for small RNAs, and advances such as naked as well as liposome-mediated oligonucleotide transfer. Intracellularly expressed aptamers (also called intramers) have also been discussed in the recent literature” (page 3724, 1st column, 4th paragraph).
Regarding claim 6, Famulok teaches methods for generating intracellular biocompatible vehicles for transporting and introducing the nucleic acid and aptamer, “aptamers specific for Ku protein were expressed under the control of a human 7SL promoter in MCF-7 breast carcinoma cells” (page 3724, 1st column, 5th paragraph). The limitation “into a subject for remediation” is simply alternative language for “prophylactic and therapeutic treatment,” that is, a summary of claim 1, and does not further modify the method or structure of any of the subject molecules and therefore is not given any patentable weight.
Regarding claim 7, Famulok teaches forming “safe retroviral expression vectors for small RNAs” as described above in claim 5.
Regarding claim 9, Liu teaches forming “various Pb2+-binding DNA aptamers have been identified. Exampled by PS2.M14, PW17, T30695…” as described above. Therefore, Liu, Poolsup, and Famulok meet the claim.
Claim(s) 2 is/are rejected under 35 U.S.C. 103 as being unpatentable over Poolsup (Poolsup et al. Curr Opin Biotechnol. 2017 Dec;48:180-186.), and Liu (Liu et al. Sci Rep. 2022 Jan 10;12(1):460.), and Famulok (Famulok et al. Chem Rev. 2007 Sep;107(9):3715-43.) as applied to claims 1 above, and further in view of Lakhin (Lakhin et al. Aptamers: problems, solutions and prospects. Acta Naturae. 2013 Oct;5(4):34-43.).
Regarding claim 2, Poolsup, Liu and Famulok teach claim 1 as described above.
Poolsup-Liu-Famulok further teach, “binding the binding aptamer with the toxic metal to form a bound aptamer” as described above. In particular, Famulok’s statement above citing the “use” of aptamers evidences the binding and formation of a bound aptamer, “Aptamers have been used in an increasing number of applications inside living cells and even whole organisms…” (page 3724, 1st column, 4th paragraph).”
However, Poolsup-Liu-Famulok do not teach, “expelling the bound aptamer via a urinary tract or gastrointestinal tract.”
Lakhin shows they are in the same field of endeavor, “… these features make aptamers ideal candidates for diagnostic and therapeutic applications” (page 34, 1st column, 2nd paragraph). Lakhin teaches the ease of expelling the bound aptamer via a urinary tract due to their size, “The removal of aptamers from the bloodstream via renal filtration complicates their therapeutic application. Most aptamers have a molecular weight ranging from 5 to 15 kDa (15–50 nucleotides), and they can be easily excreted by kidneys” (page 36, 2nd column, 1st paragraph). The “complication” referred to by Lakhin is aptamers’ short bloodstream life due to their ease of renal filtration due to their small size. Lakhin follows in the same paragraph with a solution to PEGylate the aptamer, “Conjugation of aptamers with polyethylene glycol (PEG) with a molecular weight of 20 or 40 kDa is the most common solution to this problem”
It would have been obvious for a person having ordinary skill in the art (PHOSITA) before the effective filing date of the claimed invention to have taken the method of Poolsup-Liu-Famulok and further incorporated the teaching of Lakhin to expel the aptamer and bound metal toxin via a urinary tract or gastrointestinal tract because it is simply combining prior art elements according to known methods to yield predictable results. Although Lakhin describes urinary tract excretion of aptamers as a “complication,” they further describe a solution. Furthermore, there is nothing in Lakhins’ description of aptamer urinary tract excretion, nor anywhere else in the prior art that indicates this mode of excretion is unique to any particular aptamer smaller than the 20- 40 kDa size they describe. Therefore, a PHOSITA would reasonably predict Lakhin’s efficient mode of expulsion could work successfully with Poolsup-Liu-Famulok’s method of prophylactic and therapeutic treatment of metal toxicity.
Claim(s) 4 is/are rejected under 35 U.S.C. 103 as being unpatentable over Poolsup (Poolsup et al. Curr Opin Biotechnol. 2017 Dec;48:180-186.), and Liu (Liu et al. Sci Rep. 2022 Jan 10;12(1):460.), and Famulok (Famulok et al. Chem Rev. 2007 Sep;107(9):3715-43.) as applied to claim 1 above, and further in view of Chen (Chen et al. Selection of DNA aptamers for the development of light-up biosensor to detect Pb(II). Sensors and Actuators B: Chemical. Volume 254, 2018. Pages 214-221. ISSN 0925-4005.).
Regarding claim 4, Poolsup, Liu and Famulok teach claim 1 as described above.
Recall from above, Liu teaches metal toxicity, specifically lead toxicity, aptamers that bind lead specifically, and the roles metal and lead binding aptamers play in human health and therapeutics.
However, Poolsup-Liu-Famulok do not teach, “wherein the binding aptamer has a greater affinity for lead than for calcium.”
Chen similarly teaches the dangers of metal toxicity, specifically lead, “With the rapid development of industry and agriculture, heavy metal pollution has become a serious threat to human health due to the toxicity to humans and the environment. As one of the most toxic heavy metal ions, Pb(II) has neurotoxic effect and can impair brain development, such as memory loss, irritability, anemia and mental retardation, especially to children” (page 214, 1st column, 1st paragraph). Chen teaches the instant limitation by teaching the details of their aptamer selection. Chen used SELEX and negative selection against Ca(II) to achieve their goal, “To determine the specificity of the two aptamers, the fluorescence intensity of FAM-aptamer-quenching strand complex was measured when incubation with ten different kinds of metal ions… after incubation with Pb(II) and other interfering metal ions including … Ca(II)... The results indicated that two aptamers have excellent selectivity to Pb(II) against other interfering metal ions tested.” (page 219, 2nd column, 2nd paragraph).
It would have been obvious for a person having ordinary skill in the art (PHOSITA) before the effective filing date of the claimed invention to have used Poolsup-Liu-Famulok’s method to treat toxicity with aptamers, and further designed and used those aptamers with higher affinity to Pb(II) as taught by Chen because a PHOSITA would have been motivated to have done so because Liu teaches that metal toxicity, specifically lead toxicity was a known problem and they teach that aptamers are a known solution to the known lead toxicity problem. Chen follows Liu’s suggestion and further demonstrates lead specific aptamers that bind Pb(II) ions preferentially over Ca(II). Accordingly, a PHOSITA would have been motivated to have used Chen’s lead specific aptamers according to the method of Poolsup-Liu-Famulok.
Claim(s) 10 is/are rejected under 35 U.S.C. 103 as being unpatentable over Poolsup (Poolsup et al. Curr Opin Biotechnol. 2017 Dec;48:180-186.), and Liu (Liu et al. Sci Rep. 2022 Jan 10;12(1):460.), and Famulok (Famulok et al. Chem Rev. 2007 Sep;107(9):3715-43.) as applied to claim 1 and 4 above, and further in view of Chen (Chen et al. Selection of DNA aptamers for the development of light-up biosensor to detect Pb(II). Sensors and Actuators B: Chemical. Volume 254, 2018. Pages 214-221. ISSN 0925-4005.), and NCBI (NCBI Blast_554_Pb7S_SEQIDNO_2_vs_Chen_Pb-7S. https://blast.ncbi.nlm.nih.gov/Blast.cgi), and NCBI (NCBI Blast_554_Pb7S_SEQIDNO_2_vs_Chen_FAM-Pb-7S. https://blast.ncbi.nlm.nih.gov/Blast.cgi).
Regarding claim 10, , Poolsup, Liu and Famulok teach claim 1 as described above.
However, Poolsup-Liu-Famulok do not teach, “wherein the binding aptamer is Pb7S.”
Chen teaches the evolution of their Pb(II) binding aptamer Pb-7 to Pb-7S, “Since the binding ability of aptamers toward the target maybe associated with their folding structures, we further predicted the secondary structures of these sequences by M-fold (http://mfold.rna.albany.edu/). According to their secondary structures, two sequences (Pb-7 and Pb-14) were chosen as aptamer candidates and shortened (named as Pb-7S and Pb-14S respectively) for further study (Fig. S3, ESI)” (page 217, 1st column, 2nd paragraph).
Chen further teaches their “shortened” aptamer “Pb-7S” which is 46 bases (see Table 1, page 218), and its bases 1- 46 match 100% with bases 1- 46 of the instant claimed aptamer Pb7S (SEQ ID NO 2) [see Table 1, page 8]. NCBI (NCBI Blast_554_Pb7S_SEQIDNO_2_vs_Chen_Pb-7S. https://blast.ncbi.nlm.nih.gov/Blast.cgi).
‘554 Pb7S (SEQ ID NO 2) 1 GGGACGACGGCAGGGCTGTCGTACGGTTTGTCGAAGGTGTCGTCCC GA 48
||||||||||||||||||||||||||||||||||||||||||||||
Chen Pb-7S 1 GGGACGACGGCAGGGCTGTCGTACGGTTTGTCGAAGGTGTCGTCCC 46
As can be seen from the alignment above, the only difference is the 3’ GA of the instant application’s Pb7s (SEQ ID NO 2). Also notice, the 3’ GA when added to Chen’s Pb-7S is simply the GA sequence of Chen’s “original” aptamer Pb-7 (see Figure S3 below).
Similarly, Chen teaches their “shortened,” fluorophore labeled, variant of Pb-7S, “FAM-Pb-7S.” The “shortened” aptamer portion of FAM-Pb-7S is 55 bases (see Table 1, page 218), and 48 of its 55 bases (bases 8- 55) match 100% with bases 1- 46 of the instant claimed aptamer Pb7S (SEQ ID NO 2) [see Table 1, page 8]. NCBI (NCBI Blast_554_Pb7S_SEQIDNO_2_vs_Chen_FAM-Pb-7S. https://blast.ncbi.nlm.nih.gov/Blast.cgi).
‘554 Pb7S (SEQ ID NO 2) 1 GGGACGACGGCAGGGCTGTCGTACGGTTTGTCGAAGGTGTCGTCCCGA 48
||||||||||||||||||||||||||||||||||||||||||||||||
Chen FAM-Pb-7S 1 CTCAGTC GGGACGACGGCAGGGCTGTCGTACGGTTTGTCGAAGGTGTCGTCCCGA 55
As can be seen from the alignment above, the only difference is the addition of a 7 nucleotide 5’ stem on Chen’s aptamer. Furthermore, Chen’s Figure S4 below, clarifies the stem structure of the additional 7 nucleotides.
PNG
media_image1.png
349
511
media_image1.png
Greyscale
Likewise, the evolution FAM-Pb-7S via modifications to Chen’s “original” aptamer and “shortened” aptamer can be seen from Figure S3, where Chen highlights the preserved structure of Pb-7. Notice the stem sequence (highlighted in the oval) is not the same sequence as “original” aptamer Pb-7 (compare with the sequence from Figure S3 below).
PNG
media_image2.png
683
569
media_image2.png
Greyscale
Chen does not explicitly state this preserved structure is the critical binding portion of the aptamer. However, it is obvious from Chen’s aforementioned modifications around the preserved structure (but no modifications within the structure) and the continued Pb2+ specific binding of the modified versions of Pb-7 (Pb-7S and FAM-Pb-7S) which contain the preserved structure, that this preserved portion of Pb-7 is the critical binding portion.
It would have been obvious for a person having ordinary skill in the art (PHOSITA) before the effective filing date of the claimed invention to have taken Chen’s “shortened” Pb-7S and modified it by adding the GA of Chen’s “original” Pb-7 to arrive at the instant claimed aptamer PB7S (SEQ ID NO 2) because it is simply choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success (“obvious to try”). As shown above, Chen provided a predictable solution (method) for optimizing their Pb-7 aptamer for preferentially binding to Pb(II). Similarly, but more importantly, Chen provided a starting point for optimizing modifications to their Pb-7 aptamer. The starting point is the preserved region of Pb-7. Chen clearly showed the critical Pb(II) binding component of Pb-7S derived from this Pb-7 starting point. Therefore, the modifications required to arrive from the “shortened” PB-7S to the instant application’s Pb7S (SEQ ID NO 2) is simply a matter of routine optimization based on the limited number of nucleotides to choose from. As stated earlier, a PHOSITA in the field of metal toxicity treatment would therefore necessarily pursue the optimization strategies presented by Chen to arrive at th instant invention, aptamer PB7S.
Claim(s) 8 is/are rejected under 35 U.S.C. 103 as being unpatentable over Liu (Liu et al. Sci Rep. 2022 Jan 10;12(1):460.), and Poolsup (Poolsup et al. Curr Opin Biotechnol. 2017 Dec;48:180-186.), and Famulok (Famulok et al. Chem Rev. 2007 Sep;107(9):3715-43.) as applied to claims 1 and 5 above, and further in view of Yoon (Yoon et al. Adv Drug Deliv Rev. 2018 Sep;134:22-35.), and Kazi (Kazi et al. Microorganisms. 2022 May 31;10(6):1132.).
Regarding claim 8, Liu, Poolsup, and Famulok teach claims 1 and 5.
However, Liu, Poolsup, and Famulok do not teach “further comprising forming a probiotic including the nucleic acid strand by: manipulating a DNA strand to contain the sequence of the binding aptamer; and replicating the DNA strand including the binding aptamer.”
Kazi teaches the claim element “further comprising forming a probiotic including the nucleic acid strand by: manipulating a DNA strand to contain the sequence…” by stating, “Lactic acid bacteria (LAB) play a very vital role … as probiotic agents… With the advent of genetic engineering, recombinant LAB have been effectively employed as vectors for delivering therapeutic molecules” (Abstract). Kazi further teaches the claim element “…and replicating the DNA strand…” by stating, “For the expression and delivery of recombinant proteins and RNA for successful genome engineering using these tools, plasmid-based vectors are essential” (page 1132, 2nd paragraph). Kazi even provides clarification that plasmids are replicating DNA “Plasmids are extrachromosomal, covalently closed, circular, and self-replicating DNA molecules” (page 1132, 3rd paragraph).
Kazi does not teach “…strand to contain the sequence of the binding aptamer; and … including the binding aptamer.”
Yoon teaches “the aptamer library was cloned into a bacterial expression plasmid The library plasmid was transformed into E. coli…” (page 26, section 4.2 Broccoli). Here, Yoon teaches the element, “…strand to contain the sequence of the binding aptamer; and … including the binding aptamer.” Yoon further describes the context of their teachings, “In this review, we discuss … therapeutic applications of aptamers in human diseases. We also highlight … the future strategies to facilitate the translation of intracellular aptamers.” (Abstract).
It would have been obvious for a person having ordinary skill in the art (PHOSITA) before the effective filing date of the claimed invention to have taken Liu-Poolsup-Famulok’s (Liu et al) method of prophylactic and therapeutic treatment of metal toxicity with a biocompatible delivery mechanism, and further adhered the probiotic engineering teachings of Kazi and the recombinant aptamer encoded bacteria teachings of Yoon because it is simply combining prior art elements according to known methods to yield predictable results. A PHOSITA starting with Liu et al as described above would likewise recognize Kazi’s successful recombinant probiotic-based gene expression. Likewise, the same PHOSITA would have recognized Yoon’s successful methods of incorporating and expressing aptamer encoded plasmids into bacteria. Therefore, a PHOSITA would similarly have a reasonable expectation of success by incorporating Yoon’s aptamer plasmid into Kazi’s probiotic bacteria, and further use this within the method of Liu-Poolsup-Famulok’s biocompatible delivery mechanism.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AARON DUREL WARD whose telephone number is (571)272-8495. The examiner can normally be reached Monday to Thursday 8:00AM 6:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 15712705919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AARON DUREL WARD/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
