Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
The action is written in response to applicant’s correspondence received on 8/17/2026. Claims 1-20 are currently pending.
Priority
The instant application claims priority to US Provisional Application 63/428,769 with an effective filing date of 11/30/2023.
Election/Restriction
Applicant’s election without traverse of the invention of Group I, claims 1-10 and 15-20, drawn to a polynucleotide encoding a nucleic acid construct and a CRISPR-Cas nuclease in an expression cassette, and a cell and/or composition with said construct, in the reply filed on 8/17/2026 is acknowledged.
Applicants further elect the following species:
SEQ ID NO: 1
Claims 11-14 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 8/17/2026.
Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i).
Claims 1-10 and 15-20 are currently under examination on the merits.
Specification
The use of the term Pur-A-Lyzer (page 15), BDS LSR II (page 23) and FACSDiva (page 23), which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Interpretation
Regarding claim 1, applicant recites “a nucleic acid construct comprising a domain hybridizing with early coding regions of the androgen receptor gene”. Examiner interprets “a domain” that hybridizes with a portion of the sequence as a sequence that shares structure and function to that of gRNA. Looking to the specification for guidance, applicant describes a second aspect of the invention that pertains to a polynucleotide encoding a nucleic acid construct comprising a domain hybridizing to a gene and a CRISPR-Cas nuclease, the active CRISPR enzyme. The CRISPR-Cas nuclease forms a complex that hybridizes with the target gene and induces mutation (see paragraph 0012). Looking to the supplemental sequence listing as well as Table 1., SEQ ID NO: 1 corresponds to designed sgRNAs for CRISPR/Cas9 treatment of baldness (see paragraph 0064). Absent evidence to the contrary, the domain recited in the instant application is indistinguishable from a sequence that is a guide RNA.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-3, 5, 7-10, and 15 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Meyer (WO 2017/197141 A2, published 11/16/2017) evidenced by Gelmann et al. (Molecular Biology of the Androgen Receptor, Journal of Clinical Oncology, Volume 20, No. 13, pgs. 3001-3015, published 2002).
Regarding claims 1-3, Meyer teaches targeted treatment of androgenic alopecia using engineered nucleases comprising a DNA binding domain and a cleavage domain including polynucleotide encoding nucleases, vectors comprising polynucleotides encoding nucleases, and cells comprising polynucleotide encoding nucleases (see abstract). Meyer discloses compositions comprising a DNA-binding domain that specifically binds to a target site in any gene associated with AGA, which can include the DNA-binding portion (sgRNA) of a CRISPR/Cas nuclease (see paragraph 0086) and where in certain embodiments, the DNA-binding domain is part of a CRISPR/Cas nuclease system, including a single guide RNA that binds to DNA (see paragraph 0101).
Meyer further teaches Table 7, which discloses exemplary guide RNAs, specifically AR-targeted sgRNAs, which include SEQ ID NOs: 170-179. When aligning the targeted sgRNAs with the AR gene, which is approximately 90kb, SEQ ID NO: 170 (GGATCACTTCGCGCACGCTC) of Meyer hybridizes with nucleotide number 1210-1229 of the human AR gene (shown below).
PNG
media_image1.png
232
694
media_image1.png
Greyscale
Though Meyers does not directly recite where the DNA hybridizing domain (sgRNA) targets an early coding region of the androgen receptor gene, Exon 1 of the androgen receptor gene spans approximately 520-550 amino acids, corresponding to approximately 1613 bp nucleotides. This is evidenced by Fig. 1 in Gelmann (shown below). Therefore, the sgRNA of SEQ ID NO: 170 of Meyer targets or hybridizes a region of the AR gene that corresponds with an early coding region, more specifically, Exon 1.
PNG
media_image2.png
505
737
media_image2.png
Greyscale
Regarding claims 1-3, as Meyer discloses SEQ ID NO: 170, which hybridizes nucleotides 1210-1229 of the AR gene, the sgRNA of SEQ ID NO: 170 therefore hybridizes with early coding regions of the androgen receptor gene. Taken in its totality, Meyer discloses a nucleic acid construct (see paragraph 0083) comprising a DNA binding domain (sgRNA, SEQ ID NO: 170) (see paragraph 0086 and 0101) which targets an early coding regions, the first coding region, and the first coding exon of the androgen receptor gene.
Regarding claim 5, Meyer teaches the disclosure provides a polynucleotide encoding any of the proteins described herein. In yet another aspect, a gene delivery vector comprising any of the polynucleotides described herein is provided (see paragraph 0038). Meyer discloses compositions comprising a DNA-binding domain that specifically binds to a target site in any gene associated with AGA, which can include the DNA-binding portion (sgRNA) of a CRISPR/Cas nuclease (see paragraph 0086) and where in certain embodiments, the DNA-binding domain is part of a CRISPR/Cas nuclease system, including a single guide RNA that binds to DNA (see paragraph 0101).
Regarding claim 7, Meyer discloses that the CRISPR-Cpf1 system is used. The CRISPR-Cpf1 system is functionally conserved with Cas9 but differ in many aspects including their guide RNAs and substrate specificity. However, Meyer does disclose in the methods and compositions described herein, it is understood that the term “Cas” includes both Cas9 and Cfp1 (see paragraph 0144). Furthermore, Meyer teaches guide RNAs for the S. pyogenes CRISPR/Cas9 systems are also constructed to target genes. All guide RNAs are tested in the CRIPSR/Cas9 system and are found to be active in K562 cells and in human stem cells (See paragraph 0185).
Regarding claim 8, Meyer discloses polynucleotides encoding nucleases, vectors comprising polynucleotides encoding nucleases, and cells comprising polynucleotide encoding nucleases are also provided (see abstract, paragraph 0019, 0021).
Regarding claim 9, Meyer discloses polynucleotides encoding nucleases, vectors comprising polynucleotides encoding nucleases, and cells comprising polynucleotide encoding nucleases and/or cells comprising nucleases are also provided (see abstract, 0014, 0019, 0027, 0028, 0029, 0031, 0032).
Regarding claim 10, Meyer teaches the modified cells of the invention may be a stem/progenitor cell, an embryonic stem cell (e.g. human ES), a hematopoietic stem cell (HSC), or a mesenchymal stem cell (see paragraph 0032). In examples, Meyer discloses the test of guide RNAs with a CRISPR/Cas9 system are found to be active in K562 cells and in human stem (skin stem) cells (see paragraph 0185).
Regarding claim 15, the nucleases and/or transcription factors can be introduced as mRNA, in protein form, and/or as a DNA sequence encoding the nucleases. In some embodiments, the delivery is accomplished via…nanoparticle (see paragraph 0036).
In view of the foregoing, claims 1-3, 5, 7-10, and 15 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Meyer.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Meyer (WO 2017/197141 A2, published 11/16/2017) in view of Wiles et al. (CRISPR-Cas9-mediated genome editing and guide RNA design, Mamm Genome, Volume 26, Volume 9-10, pgs. 501-510, published 2015).
Regarding claim 4, Meyer teaches guide RNA are often produced in vitro using the T7, T3, or SP6 phage promoter system where methods require specific primers synthesized for each guide RNA. Additionally, efficient transcription initiation starts preferably with “G” nucleotide, which poses a constrain on the first nucleotide of target sequence in the guide RNA if efficiency is a concern. Alternatively, and especially for in vivo use, guide RNAs are designed to be driven by the U3/U6 snoRNA promoters, especially in mammalian cells and in plant cells (see paragraph 0143). Meyer also teaches Table 7 which includes exemplary guide RNAs.
Regarding claim 4, Meyer does not teach wherein the hybridizing domain comprises of SEQ ID NO: 1.
Regarding claim 4, Wiles teaches methods for designing guide RNAs. Wiles teaches “in practice, by simply designing the 5’ 20 nt sequence on the sgRNA to be complementary to the genomic target sequence, the Cas9 nuclease-sgRNA complex can be directed to specific genomic locus generating DNA DSBs. The target defining region of the sgRNA is about 20 nt long, with variations from 17 to 30 nt having been successfully used. Other key elements in determining the target sequence specificity is the PAM motif that is adjacent to the target site at the genome locus but is not a part of the guide RNA sequence. For Cas9 nuclease from S. pyogenes, the PAM sequence is NGG” (see section titled CRISPR-Cas9 mediated genome editing).
It would have been obvious to one with ordinary skill in the art, before the effective filing date of the claimed invention, to combine the teachings of Meyer and Wiles to arrive at a nucleic acid with a hybridizing domain that comprises SEQ ID NO: 1.
One would expect a reasonable chance of success as Meyer discloses that sgRNA are often designed and produced with specific primers to target a sequence of interest. Meyer also produces an exemplary table of multiple gRNAs that target the AR gene. Wiles discloses that designing sgRNA to target a specific genomic locus is very well known and routine in the art, provided elements such as sgRNA length (17-30 nts) and PAM recognition site is present, such as “NGG” for S. pyogenes Cas9. Meyer also briefly exemplified this by stating efficient transcription of sgRNA design prefers the “G” nucleotide. While the AR gene itself is large, approximately 90kb, the AR sgRNA of Meyer, such as SEQ ID NO: 170, targets the same region (Exon 1) as claimed in the instant application. Exon 1 of the AR gene is approximately 1600 bps. Therefore, a skilled artisan, such as Meyer, could screen the 1600 bp region of Exon 1, looking specifically for “NGG” PAM sites and through routine experimentation, arrive at the instantly claimed SEQ ID NO: 1.
One skilled in the art would be motivated to do so to target the AR gene with a specific guide RNA and Cas9 to modify AR gene expression to treat diseases such as male pattern baldness. Meyer discloses this by teaching Androgenetic alopecia is the most common form of hair loss, also known as male pattern baldness (MPB) in men (see paragraph 0006).
In view of the foregoing, claim 4 is rejected under 35 U.S.C. 103 as being prima facie obvious, before the effective filing date.
Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over Meyer (WO 2017/197141 A2, published 11/16/2017) in view of Doudna et al. (RNA-programmed genome editing in human cells, eLife, Volume 2, all pages, published 2013).
Regarding claim 6, Meyer teaches exogenous guide DNAs can be loaded onto a TtAgo protein, allowing the TtAgo protein to target DNA cleavage to a complementary-investigator specified target DNA, thereby creating a targeted double-strand break in DNA. For the cleavage of mammalian genomic DNA, it would be preferable to use a version of TtAgo codon optimized for expression in mammalian cells (see paragraph 0106).
Regarding claim 6, Meyer does not teach where the polynucleotide, comprising a sgRNA and CRISPR-Cas nuclease is codon optimized for the expression in mammalian cells.
Regarding claim 6, Doudna teahes that sgRNA expression and/or its assembly into Cas9, rather than Cas9 expression, localization or folding, presently limits Cas9 function in human cells. Higher efficiencies of Cas9-mediated genome targeting could be achieved by optimization of the sgRNA construct design, its expression levels, or its subcellular localization (see discussion). Doudna also teaches the sequence encoding S. pyogenes cas9 fused to an HA epitope, a nuclear localization signal was codon optimized for human expression (see plasmid design and construction).
It would have been obvious to one with ordinary skill in the art, before the effective filing date, to combine the teachings of Meyer and Doudna to arrive at a polynucleotide encoding Cas9 and sgRNA that is codon optimized for expression in a mammal.
One would expect a reasonable chance of success as Meyer already discloses a construct a construct of guide DNAs and TtAgo endonuclease that is codon optimized for targeting mammalian genomic DNA. While TtAgo and Cas9 are both endonucleases, TtAgo utilizes guide DNA instead of guide RNA. While TtAgo is not Cas9, this deficiency is alleviated by Doudna who discloses the use of codon optimized Cas9 endonuclease and sgRNA for genome editing in human cells. Therefore, a skilled artisan could codon optimize the polynucleotide encoding a Cas9 endonuclease, described in Meyer, with a high predictability of success.
One would be motivated to do so as Cas9 was originally derived as a bacterial endonuclease. Doudna initially discloses that prior to experimentation and optimization, it was unclear whether such a bacterial system would function in eukaryotic cells (see introduction of Doudna). Furthermore, Doudna teaches that optimization of different elements of the CRISPR/Cas9 construct, such as the sgRNA, would allow for higher efficiencies of genome targeting (see discussion). Therefore, a skilled artisan would codon optimize the invention of Meyer to achieve greater efficiency of genome targeting and editing of the AR gene.
In view of the foregoing, claim 6 is rejected under 35 U.S.C. 103 as being prima facie obvious, before the effective filing date.
Claims 16-20 are rejected under 35 U.S.C. 103 as being unpatentable over Meyer (WO 2017/197141 A2, published 11/16/2017) in view of Doudna et al. (WO 2021/183783 A1, published 9/16/2021) and Ni et al. (Piperazine-derived lipid nanoparticles deliver mRNA to immune cells in vivo, Nature Communications, Volume 13, all pages, published 8/15/2022), evidenced by Haque et al. (WO 2023/078950 A1, published 5/11/2023).
Regarding claims 16-20, a nucleic acid construct, a composition, or a cell comprising a domain hybridizing with an early coding region of the androgen receptor gene, a Cas endonuclease, and a nanoparticle delivery system is taught by Meyer, as described above, which is recited in claims 1 and 15 of the instant application.
Regarding claims 16-20, Meyer does not teach the composition of the nanoparticle delivery system, which comprises lipid nanoparticles, an ionizable cationic lipid compound, wherein the ionizable lipid compound is synthesized by reacting an amino alcohol, at least one fatty acid, and at least one lipid component.
Meyer does not teach where the amino acid alcohol is piperazine or a derivative thereof, where the fatty acid is a C4-C26 fatty acid, and where the lipid component is selected from the group consisting of helper phospholipids, PEGylated lipids, cholesterol, and a combination thereof.
Regarding claim 16, Doudna teaches a modified CRISPR/Cas effector polypeptide of the present disclosure (or an mRNA comprising a nucleotide sequence encoding a modified CRISPR/Cas effector polypeptide and/or guide RNA may be delivered simultaneously using particles or lipid envelops (see paragraph 0134) and specifies lipid nanoparticles (see paragraph 0138).
Regarding claims 16-20, Ni teaches piperazine-derived lipid nanoparticles to deliver mRNA to immune cells in vivo (see abstract). Ni first rationally designed ionizable lipids consisting of a piperazine core and two tertiary amines as ionizable head groups linked to hydrophobic carbon chains. To the piperazine core, Ni added a saturated hydrocarbon chain ranging from C10 to C12. Ni chose this lipid length since C8 and C12 are well represented among other lead ionizable lipids and may help disrupt cellular membranes, thereby facilitating delivery (see results). Ni also teaches the use of lipid components such as cholesterol and PEG (see Fig. 1 of Ni, where Ni shows 8 different PPZ lipids, 2 cholesterol variants, 2 PEG-lipid variants (C14PEG2K and C18PEG2K). Based on their analysis, Ni identified a top Pi-LNP, named LNP-A10 (see Fig. 3A and 3B) which contains the ionizable lipid PPZ-A10, cholesterol, C18PEG2K, and DOPE (see section titled “Understanding LNP properties and tropism with PPZ lipids”).
It would have been obvious to one with ordinary skill in the art, before the effective filing date, to combine the teachings of Meyer, Doudna, and Ni, to arrive at the instantly claimed invention.
One would expect a reasonable chance of success as Meyer already discloses a nanoparticle system to deliver nucleic acid compositions. While Meyer does not disclose the nanoparticle formulation, this deficiency is alleviated by Ni. Ni teaches piperazine-derived lipid nanoparticles to deliver mRNA to cells in vivo. The formulations of Ni also teach where the final presented lipid nanoparticle formulation is synthesized by a combination of piperazine (an amino alcohol), a fatty acid (Ni discloses saturated hydrocarbon chain ranging from C10-12 in initial experiments but the final LNP has a C18 fatty acid as evidenced by C18PEG2k) and a lipid component (Ni discloses PEG and cholesterol in formulating Pi-LNP). Though a skilled artisan would recognize that the delivery of mRNA with Pi-LNPs would encompass nucleic acid compositions comprising Cas9 and a gRNA as recited in the present invention, Doudna provides further evidence that LNPs can be used to specifically deliver a modified CRISPR/Cas polypeptide to a target cell, and where LNPs can be modified in various formulations to test efficiency.
One would be motivated to combine these arts in order to effectively deliver the nucleic acid composition of the instant invention into target cells efficiently in order to avoid degradation of the nucleic acid compositions and to facilitate cellular uptake.
Ni discloses “systemic RNA delivery to non-hepatocytes remains challenging” (see abstract of Ni). These challenges are further evidenced by Haque, where Haque discloses “there are many challenges associated with the delivery of nucleic acids to effect a desired response in a biological system…LNPs formed from cationic lipids with other lipid components, such as neutral lipids, cholesterol, PEG, PEGylated lipids have been used to prevent degradation of RNAs in plasma and facilitate the cellular uptake of the oligonucleotides” (see page 21, section titled “background” of Haque).
In view of the foregoing, claims 16-20 are rejected under 35 U.S.C. 103 as being prima facie obvious, before the effective filing date.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DAVID YU whose telephone number is (571)272-1118. The examiner can normally be reached Monday-Friday 7:30 am -5 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.T.Y./Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Prosecution Insights