DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application is being examined under the pre-AIA first to invent provisions.
New claims 26-47 are pending in the present application.
The Supplemental amendment to the specification filed on 05/22/2026 has been entered.
Applicant’s election of the following species in the reply filed on 05/13/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
The elected species are: (i) PDCD1; (ii) SEQ ID NO: 78 (corresponding to PDCD1_T03 recognition sequence); (iii) SEQ ID NOs. 87 and 88 (corresponding to the PDCD1-T03-L and PDCD1-T03-R nuclease); and (iv) SEQ ID NOs. 96 and 97 (corresponding to PDCD1-T01-R and PDCD1-T03-L TALEN nucleotide sequence).
Accordingly, claims 39, 43-45 are withdrawn from further considerations because they are directed to non-elected species.
Therefore, claims 26-38, 40-42 and 46-47 are examined on the merits herein with the above elected species.
Priority
The present application is a CON of 16/876,079, filed on 05/17/2020, now issued US Patent 11891614; which is a CON of 16/027,629, filed on 07/05/2018, now abandoned; which is a CON of 13/892,805, filed on 05/13/2013, now issued US Patent 11603539; which claims benefit of the provisional application 61/696,612, filed on 09/04/2012; and the provisional application 61/651,933, filed on 05/25/2012.
Upon review of the specifications of the above non-provisional and provisional applications, and comparison with the specification of the present application it is determined that the instant claims at best are entitled to the effective filing date 05/13/2013 of the present application. This is because there is no written support in neither the provisional application 61/651,933 nor the provisional application 61/696,612 for the specific concept of inactivating any PDCD1/PD1 gene in engineered T cells for immunotherapy.
Claim Rejections - 35 USC § 112 (Lack of Written Description)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 26-28, 38, 41-42 and 46-47 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc). Additionally, Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111 (Fed. Cir. 1991), clearly states that “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1117. The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed” Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1116.
The instant claims encompass a method of treating a patient in need thereof comprising: (a) preparing engineered T-cells comprising an inactivated PDCD1 that is selectively inactivated by DNA cleavage by any rare-cutting endonuclease, not necessarily limited to TALEN and/or ZFN; and (b) administering a population of the T-cells to said patient; the same method further contacting said engineered T cells with RNA encoded at least one rare-cutting endonuclease and applying an agile pulse sequence recited in claim 46. With respect to claims 41-42, they encompass the use of a first half-TALE-nuclease comprising an amino acid sequence having at least 70% (e.g., 75%, 85%, 90%, 95% or 99%) sequence identity to the elected SEQ ID NO: 87 and a second half-TALE-nuclease comprising an amino acid sequence having at least 70% (e.g., 75%, 85%, 90%, 95% or 99%) sequence identity to the elected SEQ ID NO:88; or a first half-TALE-nuclease comprising an amino acid sequence (not necessarily limited to the entire amino acid sequence) encoded by the elected SEQ ID NO:96 and a second half-TALE-nuclease comprising an amino acid sequence (not necessarily limited to the entire amino acid sequence) encoded by the elected SEQ ID NO: 97.
Apart from disclosing the use of specific pairs of heterodimeric TALE-nucleases targeting PDCD1, including the first half-TALE-nuclease comprising the repeat sequence of SEQ ID NO: 87 (530-amino-acid sequence) with the half-TALE nuclease sequence encoded by SEQ ID NO:97 (2817-basepair sequence) together with the second half-TALE-nuclease comprising the repeat sequence of SEQ ID NO: 88 (529-amino-acid sequence) with the half TALE-nuclease sequence encoded by SEQ ID NO:98 (2828-basepair sequence) to target the elected PDCD1 sequence of SEQ ID NO: 78 (49-basepair sequence) in human primary T cells (Example 3 and Table 10); the instant disclosure fails to provide sufficient written description for any other rare-cutting endonucleases that are able to selectively inactivate the immune checkpoint PDCD1 gene for preparation of a population of engineered T cells to be administered into a patient for the treatment method as claimed broadly. For example, apart from the versatility of zinc-finger nucleases (ZFNs) and TALENs arising from the ability to customize the DNA-binding domain to recognize virtually any sequence, what is the exact structure(s) of any PDCD1-specific meganuclease targeting any sequence in the PDCD1 gene of T cells, let alone any other rare-cutting endonucleases having the recited functional property as encompassed broadly by the instant claims?
With respect to claims 41-42, apart from disclosing two specific pairs of heterodimeric TALE-nucleases targeting PDCD1 sequences, including the first half-TALE-nuclease comprising SEQ ID NO: 87 (530-amino-acid sequence) and the second half-TALE-nuclease comprising SEQ ID NO: 88 (529-amino-acid sequence) that form a heterodimeric DNA cleavage complex that recognizes and cleaves the elected target PDCD1 sequence of SEQ ID NO: 78 in human primary T cells (Example 3 and Table 10); the instant disclosure fails to provide sufficient written description for any other first half-TALE nuclease and second half-TALE nuclease that form a heterodimeric DNA cleavage complex that recognizes and cleaves the target PDCD1 sequence of SEQ ID NO: 78 for a preparation of engineered T cells to be administered into a patient in need as encompassed broadly by the instant claimed treatment method. For example, which modifications (e.g., substitutions, insertions, deletions or combinations thereof) be made at which specific amino acid residue(s) and/or specific amino acid sequence(s) such that a first half TALE-nuclease having at least 70% sequence identity with SEQ ID NO: 87 (up to 159 amino acid modifications along the sequence of SEQ ID NO: 87) and a second half-TALE nuclease having at least 70% sequence identity with SEQ ID NO: 88 (up to 159 amino acid modifications along the sequence of SEQ ID NO: 88) are still capable of forming a heterodimeric DNA cleavage complex that recognizes and cleaves the target PDCD1 sequence of SEQ ID NO: 78 as encompassed broadly by the instant claims? It is also apparent that there is no correlation between the at least 70% amino acid sequence identity with SEQ ID NO: 87 and/or SEQ ID NO: 88 with the recited functional properties (e.g., recognition and cleavage of the target PDCD1 sequence of SEQ ID NO: 78). This is evidenced at least by the teachings of Galetto et al (US 2013/0315884; IDS) disclosing the GRex3-specific TALEN DNA of SEQ ID NO: 21 comprising the sequence of nucleotides 481-2070 that encodes an amino acid sequence that is 98.1% identical to SEQ ID NO: 87 of the present application (Table 1 and attached sequence search below); and the CD52-specific TALEN DNA of SEQ ID NO: 55 comprising the sequence of nucleotides 481-2070 that encodes an amino acid sequence that is 98.3% identical to SEQ ID NO: 87 of the present application (Table 5 and attached sequence search below); let alone an encoded PDCD1-specificTALEN having at least 70% identical to SEQ ID NO: 87 as encompassed by the instant claims. Similarly, the teachings of Segovia Sanz et al (WO 2017/077135; IDS) disclosing the PKLR-specific TALEN DNA of SEQ ID NO: 2 comprising the sequence of nucleotides 499-2088 that encodes an amino acid sequence that is 98.7% identical to SEQ ID NO: 88 of the present application (Abstract; SEQ ID NO: 2 and attached sequence search below). Smith et al (WO 2014/039523; IDS) also disclosed the CD52-specific TALEN DNA of SEQ ID NO: 56 comprising the sequence of nucleotides 499-2088 that encodes an amino acid sequence that is 98.5% identical to SEQ ID NO: 88 of the present application (Example 2 and attached sequence search below), let alone an encoded PDCD1-specific TALEN having at least 70% identical to SEQ ID NO: 88 as encompassed by the instant claims.
Similarly, apart from disclosing the use of specific pairs of heterodimeric TALE-nucleases targeting PDCD1, including the first half-TALE-nuclease with the half-TALE nuclease sequence encoded by SEQ ID NO:97 (2817-basepair sequence) together with the second half-TALE-nuclease with the half TALE-nuclease sequence encoded by SEQ ID NO:98 (2828-basepair sequence) to target the elected PDCD1 sequence of SEQ ID NO: 78 (49-basepair sequence) in human primary T cells (Example 3 and Table 10), the instant specification fails to provide sufficient written description for any other PDCD1-specific TALE-nuclease having any amino acid sequence of any length as long as it is an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:97 or 98. For example, what is the specific structure of an amino acid sequence of the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 97 or 98 that is still functional and capable of recognizing and effecting DNA cleavage at the elected PDCD1 sequence of SEQ ID NO: 78, let alone the elected combination of an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 96 and an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 97 as encompassed broadly by the instant claims? It is noted that SEQ ID NO: 96 encodes the half-TALE nuclease with the repeat sequence of SEQ ID NO: 86 that is used in combination with the half-TALE nuclease with the repeat sequence of SEQ ID NO:85 to recognize and effect DNA cleavage at the non-elected target sequence of SEQ ID NO: 77 (see Table 10 of the specification).
Since the prior art at effective filing date of the present application (05/13/2013) failed to provide sufficient guidance for the aforementioned issues as evidenced at least by the teachings of Gregory et al (US 2011/0136895; IDS), Gregory et al (US 2013/0196373; IDS), Cooper et al (US 2014/0349402; IDS) and Gregory et al (US 9,597,357; IDS), it is incumbent upon the present application to do so. The present application also fails to provide a representative number of species for a broad genus of a rare-cutting endonuclease that is able to selectively inactivate an immune checkpoint protein by DNA cleavage a gene encoding said immune checkpoint protein, wherein the immune checkpoint protein is PDCD1, including a TALE-nuclease having at least 70% amino acid sequence identity to SEQ ID NO: 87 and/or 88, or a TALE-nuclease having an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 96, 97, and/or 98, for preparation of engineered T cells for administration into a patient in need thereof in a treatment method as claimed broadly.
The claimed invention as a whole is not adequately described if the claims require essential or critical elements which are not adequately described in the specification and which are not conventional in the art as of Applicants’ filing date. Possession may be shown by actual reduction to practice, clear depiction of the invention in a detailed drawing, or by describing the invention with sufficient relevant identifying characteristics such that a person skilled in the art would recognize that the inventor had possession of the claimed invention. Pfaff v. Wells Electronics, Inc., 48 USPQ2d 1641, 1646 (1998). The skilled artisan cannot envision the complete detailed structure of a representative number of species for a broad genus of a rare-cutting endonuclease that is able to selectively inactivate an immune checkpoint protein by DNA cleavage a gene encoding said immune checkpoint protein, wherein the immune checkpoint protein is PDCD1, including a TALE-nuclease having at least 70% amino acid sequence identity to SEQ ID NO: 87 and/or 88, or a TALE-nuclease having an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 96, 97, and/or 98, for preparation of engineered T cells for administration into a patient in need thereof in a treatment method as claimed broadly; and therefore conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method. Adequate written description requires more than a mere statement that it is part of the invention and reference to a method of isolating it. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (Fed. Cir. 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016 (Fed. Cir. 1991). One cannot describe what one has not conceived. See Fiddes v. Baird, 30 USPQ2d 1481, 1483.
Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 U.S.C. §112 is severable from its enablement provision (see page 1115).
Claim Rejections - 35 USC § 112 (Scope of Enablement)
Claims 26-38, 40-42 and 46-47 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for:
A method for treating a cancer in a patient, the method comprising:
(a) preparing engineered T-cells comprising a gene selectively inactivated by DNA cleavage by a rare-cutting nuclease, wherein said gene encodes an immune check-point protein, wherein said immune check-point protein is selected from the group consisting of PDCD1 and CTLA4; and
(b) administering a population of the engineered T-cells to said patient;
wherein the rare-cutting nuclease is selected from the group consisting of a Transcription activator-like effector nuclease (TALE-nuclease) and a Zinc finger nuclease (ZFN); and wherein the engineered T cells are autologous to the patient;
does not reasonably provide enablement for other method of treating a patient in need thereof as encompassed broadly by the instant claims. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
The factors to be considered in the determination of an enabling disclosure have been summarized as the quantity of experimentation necessary, the amount of direction or guidance presented, the state of the prior art, the relative skill of those in the art, the predictability or unpredictability of the art and the breadth of the claims. Ex parte Forman, (230 USPQ 546 (Bd Pat. Appl & Unt, 1986); In re Wands, 858 F.2d 731, 8 USPQ 2d 1400 (Fed. Cir. 1988)).
The instant specification is not enabled for the instant broadly claimed invention for the reasons discussed below.
1. The breadth of the claims
The instant claims encompass a method for treating any patient in need thereof (e.g., a patient with a cancer; a graft-versus-host (GvH) disease; a host-versus-graft (HvG) disease; an autoimmune disease such as lupus, rheumatoid arthritis, multiple sclerosis, diabetes; and a virally infected disease such as HIV, influenza, and RSV), the method comprising: (a) preparing engineered T cells derived from any source (e.g., autologous, allogeneic, or xenogeneic T cells relative to the patient) as long as the engineered T cells comprising a gene selectively inactivated by DNA cleavage by any rare-cutting nuclease, not necessarily limited to a TALE-nuclease and a ZF nuclease, wherein said gene encodes an immune check-point protein, wherein said immune check-point protein is selected from the group consisting of PDCD1 (an elected species) and CTLA-4; and (b) administering a population of the T-cells to said patient via any route of delivery (e.g., subcutaneous, intramuscular, intravenous or intraperitoneal administering).
2. The state and the unpredictability of the prior art
Before the effective filing date of the present application (05/13/2013), little was known about a method of treating a patient with any disease or disorder by administering to said patient a population of engineered T-cells derived from any source as long as the engineered T-cells comprise an inactivated PDCD1 gene or CTLA-4 via the use of any rare-cutting nuclease as evidenced at least by the teachings of Gregory et al (US 2011/0136895; IDS), Gregory et al (US 2013/0196373; IDS), Cooper et al (US 2014/0349402; IDS) and Gregory et al (US 9,597,357; IDS). Moreover, the physiological art is already recognized as unpredictable (MPEP 2164.03).
3. The amount of direction or guidance provided
Apart from disclosing the use of specific pairs of heterodimeric TALE-nucleases targeting PDCD1 or CTLA4, including the first half-TALE-nuclease comprising the repeat sequence of SEQ ID NO: 87 (530-amino-acid sequence) with the half-TALE nuclease sequence encoded by SEQ ID NO:97 (2817-basepair sequence) together with the second half-TALE-nuclease comprising the repeat sequence of SEQ ID NO: 88 (529-amino-acid sequence) with the half TALE-nuclease sequence encoded by SEQ ID NO:98 (2828-basepair sequence) to target the elected PDCD1 sequence of SEQ ID NO: 78 (49-basepair sequence) in human primary T cells (Example 3 and Table 10); the instant specification failed to provide sufficient guidance for an ordinary skilled artisan on how to use any population of engineered T cells with an inactivated PDCD1 gene or CTLA4 gene to treat a plethora of disease or disorder in a patient, including a patient with a GvH disease, a HvG disease, or an autoimmune disease, as encompassed broadly by the instant claims. Particularly, the instant specification stated “In immune-competent hosts allogeneic cells are rapidly rejected, a process termed host versus graft rejection (HvG), and this substantially limits the efficacy of the transferred cells. In immune-incompetent hosts, allogeneic cells are able to engraft, but their endogenous TCR specificities recognize the host tissue as foreign, resulting in graft versus host disease (GvHD) which can lead to serious tissue damage and death” (lines 15-20 at page 3). It is noted that the prepared engineered T cells to be administered into a patient in need thereof in the claimed treatment method do not have inactivated TCRalpha and/or TCRbeta genes, wherein the inactivation of TCRalpha and/or TCRbeta results in the elimination of TCR expression from the surface of engineered T cells, and prevents recognition of alloantigen and GvHD; let alone the use of a population of xenogeneic engineered T cells to treat any patient in need as encompassed broadly by the instant claims. Additionally, the prepared engineered T cells to be administered into a patient in need thereof in the claimed treatment method also do not have inactivated genes encoding targets for different immunosuppressive drugs (e.g., CD52 and GR), wherein the use of immunosuppressive drugs is known to have a detrimental effect on introduced T cells in an adoptive immunotherapy (e.g., the use of glucocorticoid steroids results in reduced levels of cytokine production leading to T cell anergy and interfering in T cell activation; treatment with Alemtuzumab (a humanized monoclonal antibody directed against CD52) has been shown to induce a rapid depletion of circulating lymphocytes and monocytes) (last paragraph on page 3 of the specification continues to first paragraph at page 4). Moreover, there is also no evidence of record indicating that the prepared engineered T cells in the claimed treatment method are capable of yielding any therapeutic effects in a patient with any autoimmune disease, particularly the administered engineered T cells with inactivated immune checkpoint PDCD1 and/or CTLA4 genes are even more actively responsive.
Apart from the versatility of zinc-finger nucleases (ZFNs) and TALENs arising from the ability to customize the DNA-binding domain to recognize virtually any sequence, the instant specification fails to provide sufficient guidance for an ordinary skill in the art on how to make and use any other rare-cutting nucleases to selectively inactivate the immune check-point PDCD1 or CTLA-4 gene for the preparation of engineered T cells in the treatment method as claimed broadly. For example, what is the exact structure(s) of any PDCD1-specific meganuclease targeting any sequence in the PDCD1 gene of T cells, let alone any other rare-cutting endonucleases having the recited functional property as encompassed broadly by the instant claims?
With respect to claims 41-42, the instant specification also fails to provide sufficient guidance for an ordinary skill in the art on how to make and use a broad genus of a TALE-nuclease to prepare engineer T-cells in the treatment method as claimed broadly. Please also refer to the above Lack of Written Description rejection. Apart from disclosing the use of specific pairs of heterodimeric TALE-nucleases targeting PDCD1 or CTLA-4 in Table 10 of the present application, the specification fails to provide sufficient guidance for an ordinary skill in the art on how to use any combination of SEQ ID NOs. 85-88 (e.g., not necessarily limited to using the specific combination of SEQ ID NOs. 85 and 86 for targeting the PDCD1 sequence of SEQ ID NO: 77, or the specific combination of SEQ ID NOs. 87-88 for targeting the PDCD1 sequence of SEQ ID NO: 78); and any combination of half TALE-nucleases encoded by the nucleotide sequences of SEQ ID Nos. 95-98 (e.g., Applicant elected the combination of SEQ ID NOs. 96 and 97 for a first half-TALE nuclease and a second half-TALE nuclease). It is noted that the half TALE-nuclease encoded by SEQ ID NO: 96 is paired with the half TALE-nuclease encoded by SEQ ID NO: 95 to cleave specifically the PDCD1 target sequence of SEQ ID NO: 77; while the half TALE-nuclease encoded by SEQ ID NO: 97 is paired with the half TALE-nuclease encoded by SEQ ID NO: 98 to cleave specifically the PDCD1 target sequence of SEQ ID NO: 78 (Table 10). However, the specification stated explicitly “[h]eterodimeric TALE-nucleases targeting respectively PDCD1 and CTLA4 genes were designed and produced. The targeted genomic sequences consist of two 17-bp long sequences (called half targets) separated by an 11 or 15-bp spacer. Each half-target is recognized by repeats of half TALE-nucleases listed in table 10” (lines 8-11 at page 61). Thus, there are highly specific spatial requirements for a pair of heterodimeric TALE nucleases to achieve precise double-strand breaks without off-target activity to selectively inactivate the immune check-point PDCD1 and/or CTLA-4 genes in engineered T cells to be used in the claimed treatment method. There is no evidence of record indicating or suggesting that Applicant’s elected combination of SEQ ID NOs. 96 and 97 for a first half-TALE nuclease and a second half-TALE nuclease is capable of inactivating any PDCD1 targeting gene sequence.
Since the prior art before the effective filing date of the present application failed to provide sufficient guidance regarding to the aforementioned issues, it is incumbent upon the present application to do so. Given the state of the prior art, coupled with the lack of sufficient guidance provided by the present application, it would have required undue experimentation for a skilled artisan to make and use the instant invention as claimed broadly.
As set forth in In re Fisher, 166 USPQ 18 (CCPA 1970), compliance with 35 USC 112, first paragraph requires:
That scope of claims must bear a reasonable correlation to scope of enablement provided by specification to persons of ordinary skill in the art; in cases involving predictable factors, such as mechanical or electrical elements, a single embodiment provides broad enablement in the sense that, once imagined, other embodiments can be made without difficulty and their performance characteristics predicted by resort to known scientific laws; in cases involving unpredictable factors, such as most chemical reactions and physiological activity, scope of enablement varies inversely with degree of unpredictability of factors involved.
Moreover, the courts have also stated that reasonable correlation must exist between scope of exclusive right to patent application and scope of enablement set forth in the patent application (27 USPQ2d 1662 Ex parte Maizel.).
Accordingly, due to the lack of sufficient guidance provided by the specification regarding to the issues set forth above, the state and unpredictability of the relevant art, and the breadth of the instant claims, it would have required undue experimentation for one skilled in the art to make and/or use the instant broadly claimed invention.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 27-29 and 46 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 27-29 and 46, each recites the limitation "said at least one rare-cutting endonuclease" in lines 1-2 of the claim. There is insufficient antecedent basis for this limitation in the claim. This is because each of these claims are dependent on claim 26, and there is no recitation of any at least one rare-cutting endonuclease. Thus, which particular at least one rare-cutting endonuclease that Applicant refer to. Clarification is requested because the metes and bounds of the claims are not clearly determined.
Additionally, claim 46 is also indefinite because the claim does not recite step (iii). Additionally, it is unclear whether Applicant really intends to claim a voltage range from 2250 to 3000 V in recited step (i) and a voltage of 325 V in recited step (ii), rather than a voltage range from 2250 to 3000 V/cm and a voltage of 325 V/cm, respectively, as a voltage range from 2250 to 3000 V per centimeter was recited prior to the recited steps (i) and (ii). Moreover, in step (ii), it is unclear what is encompassed by the limitation “4 electrical pulses with a voltage of 325V”. A voltage of 325 V is for 4 electrical pulses or each of the 4 electrical pulses with a voltage of 325 V? Clarification is requested because the metes and bounds of the claim are not clearly determined.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of pre-AIA 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(e) the invention was described in (1) an application for patent, published under section 122(b), by another filed in the United States before the invention by the applicant for patent or (2) a patent granted on an application for patent by another filed in the United States before the invention by the applicant for patent, except that an international application filed under the treaty defined in section 351(a) shall have the effects for purposes of this subsection of an application filed in the United States only if the international application designated the United States and was published under Article 21(2) of such treaty in the English language.
Claims 26-38 are rejected under pre-AIA 35 U.S.C. 102(e) as being anticipated by Gregory et al (US 9,597,357 with the effective filing date of 10/10/2012; IDS).
With respect to the elected species, Gregory et al already taught at least a method for modifying T-cells ex vivo (e.g., autologous T cells) in which endogenous PDCD1/PD1 and/or CTLA4 genes being inactivated via engineered CRISPR/Cas nuclease systems, ZFNs and TALE nucleases to prevent or reduce T-cell inhibition, wherein the PD1 and/or CTLA4 knockout T cells may be expanded prior to introduction into a subject in need of cancer treatment (see at least Summary; col. 16, lines 4-51; Table 1; col. 33, lines 1-4; examples 2-4; and issued claims 1-23). Gregory et al also taught that the modified T cells further comprise a CAR that specifically targets a tumor antigen (last two paragraphs at col. 16). Gregory et al stated explicitly “[t]he PD1-PD-L1/PD-L2 interaction enables the tumor to escape action by the CAR-targeted T-cell by deactivating the T-cells and increasing apoptosis and cell exhaustion. Additionally, the PD1-PDL interactions are also involved in the repression of the T-cell response to HIV, where increased expression of both the PD1 and PDL leads to T-cell exhaustion. Induction of CTLA-4 expression on activated T-cells is also one of the first steps to damping the immune response, and thus a T-cell armed with a CAR might become inactive due to the engagement of this system designed to balance T-cell activation with T-cell inhibition” (col. 3, lines 38-49). Gregory et al also disclosed that engineered T cells include helper CD4+ T cells, cytotoxic CD8+ T-cells, memory T-cells, regulatory T-cells and tumor infiltrating lymphocytes (TILs) (col. 5, lines 10-15; col. 33, lines 1-8); and methods for introducing nucleic acids encoding engineered ZFNs and TALENs into T-cells include electroporation, lipofection, liposomes, naked DNA, mRNAs and Amaxa Biosystems (col. 33, lines 36-67; col. 34, lines 1-13). Gregory et al also taught ZFNs and/or TALENs comprise a nuclease in the form of a cleavage domain or heterologous cleavage half-domain, with a cleavage half-domain can be obtained from any nuclease or portion thereof (e.g., Fok I) that requires dimerization for cleavage activity and in general two fusion proteins are required for cleavage if the fusion proteins comprise cleavage half-domains (col. 29, line 38 continues to line 3 on col. 32). Gregory et al also stated clearly “[t]he target sites for the two fusion proteins are preferably disposed, with respect to each other, such that binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation to form a functional cleavage domain, e.g., by dimerization. Thus, in certain embodiments, the near edges of the target sites are separated by 5-8 nucleotides or by 15-18 nucleotides. However any integral number of nucleotides or nucleotide pairs can intervene between two target sites (e.g., from 2 to 50 nucleotide pairs or more). In general, the site of cleavage lies between the target sites” (col. 30, lines 13-24).
Accordingly, the teachings of Gregory et al meet every limitation of the instant claims. Therefore, the reference anticipates the instant claims.
Claim Rejections - 35 USC § 103
The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action:
(a) A patent may not be obtained through the invention is not identically disclosed or described as set forth in section 102, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negatived by the manner in which the invention was made.
Claims 26, 29 and 40 are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over Gregory et al (US 9,597,357 with the effective filing date of 10/10/2012; IDS) in view of Lan et al (US 9,289,480; IDS).
Gregory et al already taught at least a method for modifying T-cells ex vivo (e.g., autologous T cells) in which endogenous PDCD1/PD1 and/or CTLA4 genes being inactivated via engineered CRISPR/Cas nuclease systems, ZFNs and TALE nucleases to prevent or reduce T-cell inhibition, wherein the PD1 and/or CTLA4 knockout T cells may be expanded prior to introduction into a subject in need of cancer treatment (see at least Summary; col. 16, lines 4-51; Table 1; col. 33, lines 1-4; examples 2-4; and issued claims 1-23). Gregory et al also taught that the modified T cells further comprise a CAR that specifically targets a tumor antigen (last two paragraphs at col. 16). Gregory et al stated explicitly “[t]he PD1-PD-L1/PD-L2 interaction enables the tumor to escape action by the CAR-targeted T-cell by deactivating the T-cells and increasing apoptosis and cell exhaustion. Additionally, the PD1-PDL interactions are also involved in the repression of the T-cell response to HIV, where increased expression of both the PD1 and PDL leads to T-cell exhaustion. Induction of CTLA-4 expression on activated T-cells is also one of the first steps to damping the immune response, and thus a T-cell armed with a CAR might become inactive due to the engagement of this system designed to balance T-cell activation with T-cell inhibition” (col. 3, lines 38-49). Gregory et al also disclosed that engineered T cells include helper CD4+ T cells, cytotoxic CD8+ T-cells, memory T-cells, regulatory T-cells and tumor infiltrating lymphocytes (TILs) (col. 5, lines 10-15; col. 33, lines 1-8); and methods for introducing nucleic acids encoding engineered ZFNs and TALENs into T-cells include electroporation, lipofection, liposomes, naked DNA, mRNAs and Amaxa Biosystems (col. 33, lines 36-67; col. 34, lines 1-13). Gregory et al also taught ZFNs and/or TALENs comprise a nuclease in the form of a cleavage domain or heterologous cleavage half-domain, with a cleavage half-domain can be obtained from any nuclease or portion thereof (e.g., Fok I) that requires dimerization for cleavage activity and in general two fusion proteins are required for cleavage if the fusion proteins comprise cleavage half-domains (col. 29, line 38 continues to line 3 on col. 32). Gregory et al also stated clearly “[t]he target sites for the two fusion proteins are preferably disposed, with respect to each other, such that binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation to form a functional cleavage domain, e.g., by dimerization. Thus, in certain embodiments, the near edges of the target sites are separated by 5-8 nucleotides or by 15-18 nucleotides. However any integral number of nucleotides or nucleotide pairs can intervene between two target sites (e.g., from 2 to 50 nucleotide pairs or more). In general, the site of cleavage lies between the target sites” (col. 30, lines 13-24).
Gregory et al did not disclose specifically that the PDCD1-specific TALEN is directed against the elected PDCD1 sequence of SEQ ID NO:78 (49-basepair sequence).
At the effective filing date of the present application (5/13/2013), Lan et al already provided a pharmaceutical composition for enhancing immune response in a subject under the treatment of an infection or malignant disease, comprising a DNA construct encoding PD-1/PDCD1, fragments or functional variants thereof, that is fused with an expression vector and a pharmaceutically acceptable carrier (Abstract; and Brief Summary of the Invention). Lan et al also defined the term “a fragment” of a polypeptide to refer to a fragment of at least 10 amino acids long or preferably are 10-50 amino acids long (col. 6, lines 36-44). Lan et al taught an exemplary DNA vaccine against PD-1 comprising the sequence of SEQ ID NO: 23 (450-basepair sequence) that encodes the amino acid sequence at the 21st-170th residues of human PD-1 protein; wherein the sequence of nucleotides 301-349 of SEQ ID NO: 23 is 100% identical to SEQ ID NO: 78 of the present application, to induce immunity specific for PD-1 for disrupting the PD1/PD-L pathway; and thereby enhancing immune response in a subject under the treatment of an infection or malignant disease (col. 1, lines 40-61; Example 11, particularly col. 13, lines 21-25; SEQ ID NO: 23 and attached sequence search below).
Accordingly, it would have been obvious for an ordinary skilled artisan to modify the teachings of Gregory et al by also selecting SEQ ID NO: 23 or any fragment in a range of about 39-52 contiguous nucleotides in length thereof such as the sequence of nucleotides 301-349 of SEQ ID NO: 23 as a PDCD1/PD-1 target sequence to be inactivated by a pair of PDCD1-specific half TALENs, in light of the teachings of Lan et al as presented above.
An ordinary skilled artisan would have been motivated to carry out the above modification because Lan et al already taught an exemplary DNA vaccine against PD-1 comprising the sequence of SEQ ID NO: 23 (450-basepair sequence) that encodes the amino acid sequence at the 21st-170th residues of human PD-1 protein; wherein the sequence of nucleotides 301-349 of SEQ ID NO: 23 is 100% identical to SEQ ID NO: 78 of the present application, that contain encoded epitope(s) to induce immunity specific for PD-1 for disrupting the PD1/PD-L pathway; and thereby enhancing immune response in a subject under the treatment of an infection or malignant disease. Additionally, Lan et al also taught that an encoded PDCD1/PD1 fragment is preferably 10-50 amino acids long (encoded by a contiguous 30-150 nucleotide sequence). Moreover, the primary Gregory reference already taught that a PD-1 targeting sequence that is recognized and being cleaved by two half TALENs is at least in a range of about 39-52 contiguous nucleotides in length. Furthermore, an ordinary skill in the art would readily recognize that the genomic PD1 locus with the nucleotide sequence of SEQ ID NO: 23 containing the target sequence of SEQ ID NO: 78 of the present application would be accessible for at least a pair of PD1-specific half TALENs for recognition and cleavage because the coding sequence is transcriptionally active.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Gregory et al and Lan et al; coupled with a high level of skill of an ordinary skilled artisan in the relevant art.
The modified method resulting from the combined teachings of Gregory et al and Lan et al as set forth above is indistinguishable and is encompassed by the presently claimed invention.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Claims 26-38 and 40 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 7, 10-13, 19 and 22-24 of U.S. Patent No. 11,912,776 in view of Gregory et al (US 9,597,357 with the effective filing date of 10/10/2012; IDS) and Lan et al (US 9,289,480; IDS).
Claims 1, 7, 10-13, 19 and 22-24 of U.S. Patent No. 11,912,776 are drawn to a method of treating a condition associated with malignant cells expressing B-cell maturation antigen (BCMA) in a subject comprising: administering to a subject in need thereof an effective amount of a pharmaceutical composition comprising an engineered immune cell (e.g., a T cell; dependent claims 12 and 24) expressing a BCMA-specific CAR having the features recited in independent claim 1 or 13, and wherein the engineered immune cell further comprises a disruption in one or more endogenous genes, that includes an endogenous gene encodes an immune checkpoint protein such as PD-1 (dependent claims 7, 10-11, 19 and 22-23).
The claims of the present application differ from claims 1, 7, 10-13, 19 and 22-24 of U.S. Patent No. 11,912,776 in reciting specifically at least a step of preparing engineered T-cells comprising an inactivated PDCD1 gene via DNA cleavage by a rare-cutting nuclease (e.g., a TALE-nuclease); the TALE-nuclease is encoded by RNA that is introduced into the T-cells by RNA electroporation; the TALE-nuclease is constituted by a first half-TALE nuclease and a second half-TALE nuclease; the TALE-nuclease is directed against the gene target PDCD1 sequence of SEQ ID NO: 78; and the T-cells are tumor infiltrating lymphocytes (TILs).
At the effective filing date of the present application (05/13/2013), Gregory et al already taught at least a method for modifying T-cells ex vivo (e.g., autologous T cells) in which endogenous PDCD1/PD1 and/or CTLA4 genes being inactivated via engineered CRISPR/Cas nuclease systems, ZFNs and TALE nucleases to prevent or reduce T-cell inhibition, wherein the PD1 and/or CTLA4 knockout T cells may be expanded prior to introduction into a subject in need of cancer treatment (see at least Summary; col. 16, lines 4-51; Table 1; col. 33, lines 1-4; examples 2-4; and issued claims 1-23). Gregory et al also taught that the modified T cells further comprise a CAR that specifically targets a tumor antigen (last two paragraphs at col. 16). Gregory et al stated explicitly “[t]he PD1-PD-L1/PD-L2 interaction enables the tumor to escape action by the CAR-targeted T-cell by deactivating the T-cells and increasing apoptosis and cell exhaustion. Additionally, the PD1-PDL interactions are also involved in the repression of the T-cell response to HIV, where increased expression of both the PD1 and PDL leads to T-cell exhaustion. Induction of CTLA-4 expression on activated T-cells is also one of the first steps to damping the immune response, and thus a T-cell armed with a CAR might become inactive due to the engagement of this system designed to balance T-cell activation with T-cell inhibition” (col. 3, lines 38-49). Gregory et al also disclosed that engineered T cells include helper CD4+ T cells, cytotoxic CD8+ T-cells, memory T-cells, regulatory T-cells and tumor infiltrating lymphocytes (TILs) (col. 5, lines 10-15; col. 33, lines 1-8); and methods for introducing nucleic acids encoding engineered ZFNs and TALENs into T-cells include electroporation, lipofection, liposomes, naked DNA, mRNAs and Amaxa Biosystems (col. 33, lines 36-67; col. 34, lines 1-13). Gregory et al also taught ZFNs and/or TALENs comprise a nuclease in the form of a cleavage domain or heterologous cleavage half-domain, with a cleavage half-domain can be obtained from any nuclease or portion thereof (e.g., Fok I) that requires dimerization for cleavage activity and in general two fusion proteins are required for cleavage if the fusion proteins comprise cleavage half-domains (col. 29, line 38 continues to line 3 on col. 32). Gregory et al also stated clearly “[t]he target sites for the two fusion proteins are preferably disposed, with respect to each other, such that binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation to form a functional cleavage domain, e.g., by dimerization. Thus, in certain embodiments, the near edges of the target sites are separated by 5-8 nucleotides or by 15-18 nucleotides. However any integral number of nucleotides or nucleotide pairs can intervene between two target sites (e.g., from 2 to 50 nucleotide pairs or more). In general, the site of cleavage lies between the target sites” (col. 30, lines 13-24).
Lan et al already provided a pharmaceutical composition for enhancing immune response in a subject under the treatment of an infection or malignant disease, comprising a DNA construct encoding PD-1/PDCD1, fragments or functional variants thereof, that is fused with an expression vector and a pharmaceutically acceptable carrier (Abstract; and Brief Summary of the Invention). Lan et al also defined the term “a fragment” of a polypeptide to refer to a fragment of at least 10 amino acids long or preferably are 10-50 amino acids long (col. 6, lines 36-44). Lan et al taught an exemplary DNA vaccine against PD-1 comprising the sequence of SEQ ID NO: 23 (450-basepair sequence) that encodes the amino acid sequence at the 21st-170th residues of human PD-1 protein; wherein the sequence of nucleotides 301-349 of SEQ ID NO: 23 is 100% identical to SEQ ID NO: 78 of the present application, to induce immunity specific for PD-1 for disrupting the PD1/PD-L pathway; and thereby enhancing immune response in a subject under the treatment of an infection or malignant disease (col. 1, lines 40-61; Example 11, particularly col. 13, lines 21-25; SEQ ID NO: 23 and attached sequence search below).
Accordingly, it would have been obvious for an ordinary skilled artisan to modify the cancer treatment method in claims 1, 7, 10-13, 19 and 22-24 of U.S. Patent No. 11,912,776 by also including a step of preparing engineered T cells comprising an inactivated PDCD1 gene that is mediated by a TALE-nuclease; including introducing into the T-cells (e.g., tumor infiltrating lymphocytes or TILs) RNA encoding a PDCD1-specific TALE-nuclease via RNA electroporation; including using encoded TALE-nuclease in the form of a first half-TALE nuclease and a second half-TALE nuclease as well as targeting the PDCD1 sequence of SEQ ID NO: 77; in light of the teachings of Gregory et al and Lan et al as set forth above with a reasonable expectation of success.
An ordinary skilled artisan would have been motivated to carry out the above modifications because Gregory et al already taught successfully at least a method for modifying T-cells (e.g., TILs) ex vivo in which endogenous PDCD1 and/or CTLA-4 genes being inactivated via mRNA electroporation of engineered TALE nuclease(s) comprising a nuclease in the form of a cleavage domain or heterologous cleavage half-domain, with a cleavage half-domain can be obtained from any nuclease or portion thereof (e.g., Fok I) that requires dimerization for cleavage activity and in general two fusion proteins are required for cleavage if the fusion proteins comprise cleavage half-domains, to prevent or reduce T-cell inhibition and wherein the PD1 or CTLA-4 knockout T cells may be expanded prior to introduction into a subject in need thereof. Additionally, Lan et al already taught an exemplary DNA vaccine against PD-1 comprising the sequence of SEQ ID NO: 23 (450-basepair sequence) that encodes the amino acid sequence at the 21st-170th residues of human PD-1 protein; wherein the sequence of nucleotides 301-349 of SEQ ID NO: 23 is 100% identical to SEQ ID NO: 78 of the present application, to induce immunity specific for PD-1 for disrupting the PD1/PD-L pathway for enhancing immune response in a subject under the treatment of an infection or malignant disease. Moreover, an ordinary skill in the art would readily recognize that the genomic PD1 locus with the nucleotide sequence of SEQ ID NO: 23 containing the target sequence of SEQ ID NO: 78 of the present application would be accessible for at least a pair of PD1-specific half TALENs for recognition and cleavage because the coding sequence is transcriptionally active.
The modified treatment method resulting from claims 1, 7, 10-13, 19 and 22-24 of US Patent No. 11,912,776 along with the teachings of Gregory et al and Lan et al as set forth above is indistinguishable and is encompassed by the presently claimed invention.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
Walters et al (US 6,010,613; IDS) disclosed a method of treating organic materials with pulsed electrical fields, comprising the step of applying an agile pulse sequence having at least three pulses to a material, wherein the agile pulse sequence has one, two, or there of the following characteristics: (1) at least two of the at least three pulses differ from each other in pulse amplitude; (2) at least two of the at least three pulses differ from each other in pulse width, and (3) a first pulse interval for a first set of two of the at least three pulses is different from a second pulse interval for a second set of two of the at least three pulses (Abstract).
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., whose telephone number is (571) 272-0776.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763.
To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1633; Central Fax No. (571) 273-8300.
Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public.
/QUANG NGUYEN/Primary Examiner, Art Unit 1631
Sequence 23,
Patent No. 9289480
Query Match 100.0%; Score 49; DB 27; Length 450;
Best Local Similarity 100.0%;
Matches 49; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TACCTCTGTGGGGCCATCTCCCTGGCCCCCAAGGCGCAGATCAAAGAGA 49
|||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 TACCTCTGTGGGGCCATCTCCCTGGCCCCCAAGGCGCAGATCAAAGAGA 349
BAZ46601 standard; DNA; 2814 BP.
Half TALE-nuclease encoding gene, GRex3T2-L TALEN, SEQ ID 21.
US2013315884-A1.
Alignment Scores:
Length: 2814
Score: 2563.00 Matches: 510
Percent Similarity: 98.1% Conservative: 10
Best Local Similarity: 96.2% Mismatches: 10
Query Match: 96.1% Indels: 0
DB: 47 Gaps: 0
US-16-876-079-87 (1-530) x BAZ46601 (1-2814)
Qy 1 LeuThrProGluGlnValValAlaIleAlaSerAsnIleGlyGlyLysGlnAlaLeuGlu 20
|||||||||:::|||||||||||||||||||||||| |||||||||||||||||||||
Db 481 TTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATAATGGTGGCAAGCAGGCGCTGGAG 540
Qy 21 ThrValGlnAlaLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGluGlnVal 40
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 ACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTG 600
Qy 41 ValAlaIleAlaSerHisAspGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeu 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 601 GTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTG 660
Qy 61 ProValLeuCysGlnAlaHisGlyLeuThrProGluGlnValValAlaIleAlaSerHis 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 661 CCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCAC 720
Qy 81 AspGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAla 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 721 GATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCC 780
Qy 101 HisGlyLeuThrProGlnGlnValValAlaIleAlaSerAsnGlyGlyGlyLysGlnAla 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 781 CACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCG 840
Qy 121 LeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlu 140
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||:::
Db 841 CTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAG 900
Qy 141 GlnValValAlaIleAlaSerHisAspGlyGlyLysGlnAlaLeuGluThrValGlnArg 160
|||||||||||||||||||||::::::|||||||||||||||||||||||||||||||||
Db 901 CAGGTGGTGGCCATCGCCAGCAATAATGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGG 960
Qy 161 LeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAla 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 961 CTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCC 1020
Qy 181 SerAsnGlyGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCys 200
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1021 AGCAATAATGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGC 1080
Qy 201 GlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAlaSerAsnAsnGlyGlyLys 220
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Db 1081 CAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAG 1140
Qy 221 GlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThr 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1141 CAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACC 1200
Qy 241 ProGlnGlnValValAlaIleAlaSerAsnGlyGlyGlyLysGlnAlaLeuGluThrVal 260
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Db 1201 CCCCAGCAGGTGGTGGCCATCGCCAGCAATAATGGTGGCAAGCAGGCGCTGGAGACGGTC 1260
Qy 261 GlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAla 280
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1261 CAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCC 1320
Qy 281 IleAlaSerAsnAsnGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProVal 300
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Db 1321 ATCGCCAGCAATGGCGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTG 1380
Qy 301 LeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAlaSerAsnAsnGly 320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1381 CTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATAATGGT 1440
Qy 321 GlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGly 340
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1441 GGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGC 1500
Qy 341 LeuThrProGlnGlnValValAlaIleAlaSerAsnAsnGlyGlyLysGlnAlaLeuGlu 360
|||||||||:::|||||||||||||||||||||::::::|||||||||||||||||||||
Db 1501 TTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAG 1560
Qy 361 ThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnVal 380
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1561 ACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTG 1620
Qy 381 ValAlaIleAlaSerAsnAsnGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeu 400
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Db 1621 GTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTG 1680
Qy 401 ProValLeuCysGlnAlaHisGlyLeuThrProGluGlnValValAlaIleAlaSerHis 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1681 CCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCAC 1740
Qy 421 AspGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAla 440
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1741 GATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCC 1800
Qy 441 HisGlyLeuThrProGluGlnValValAlaIleAlaSerHisAspGlyGlyLysGlnAla 460
|||||||||||||||:::|||||||||||||||||||||::: |||||||||||||||
Db 1801 CACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCG 1860
Qy 461 LeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlu 480
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||:::
Db 1861 CTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAG 1920
Qy 481 GlnValValAlaIleAlaSerAsnIleGlyGlyLysGlnAlaLeuGluThrValGlnAla 500
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Db 1921 CAGGTGGTGGCCATCGCCAGCAATAATGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGG 1980
Qy 501 LeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAla 520
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1981 CTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCTCAGCAGGTGGTGGCCATCGCC 2040
Qy 521 SerAsnGlyGlyGlyArgProAlaLeuGlu 530
||||||||||||||||||||||||||||||
Db 2041 AGCAATGGCGGCGGCAGGCCGGCGCTGGAG 2070
BAZ46635 standard; DNA; 2814 BP.
Half TALE-nuclease encoding gene, CD52_T02-L TALEN, SEQ ID 55.
US2013315884-A1.
Alignment Scores:
Length: 2814
Score: 2562.00 Matches: 510
Percent Similarity: 98.3% Conservative: 11
Best Local Similarity: 96.2% Mismatches: 9
Query Match: 96.0% Indels: 0
DB: 47 Gaps: 0
US-16-876-079-87 (1-530) x BAZ46635 (1-2814)
Qy 1 LeuThrProGluGlnValValAlaIleAlaSerAsnIleGlyGlyLysGlnAlaLeuGlu 20
|||||||||:::|||||||||||||||||||||||| |||||||||||||||||||||
Db 481 TTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCGCTGGAG 540
Qy 21 ThrValGlnAlaLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGluGlnVal 40
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 ACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTG 600
Qy 41 ValAlaIleAlaSerHisAspGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeu 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 601 GTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTG 660
Qy 61 ProValLeuCysGlnAlaHisGlyLeuThrProGluGlnValValAlaIleAlaSerHis 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 661 CCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCAC 720
Qy 81 AspGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAla 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 721 GATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCC 780
Qy 101 HisGlyLeuThrProGlnGlnValValAlaIleAlaSerAsnGlyGlyGlyLysGlnAla 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 781 CACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCG 840
Qy 121 LeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlu 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 841 CTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAG 900
Qy 141 GlnValValAlaIleAlaSerHisAspGlyGlyLysGlnAlaLeuGluThrValGlnArg 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 901 CAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGG 960
Qy 161 LeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAla 180
|||||||||||||||||||||||||||||||||||||||:::||||||||||||||||||
Db 961 CTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTGGTGGCCATCGCC 1020
Qy 181 SerAsnGlyGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCys 200
|||::: |||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1021 AGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGC 1080
Qy 201 GlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAlaSerAsnAsnGlyGlyLys 220
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Db 1081 CAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAG 1140
Qy 221 GlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThr 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1141 CAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACC 1200
Qy 241 ProGlnGlnValValAlaIleAlaSerAsnGlyGlyGlyLysGlnAlaLeuGluThrVal 260
|||:::|||||||||||||||||||||||| |||||||||||||||||||||||||||
Db 1201 CCGGAGCAGGTGGTGGCCATCGCCAGCAATATTGGTGGCAAGCAGGCGCTGGAGACGGTG 1260
Qy 261 GlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAla 280
||| |||||||||||||||||||||||||||||||||||||||:::||||||||||||
Db 1261 CAGGCGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTGGTGGCC 1320
Qy 281 IleAlaSerAsnAsnGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProVal 300
|||||||||::::::|||||||||||||||||||||||||||||||||||||||||||||
Db 1321 ATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTG 1380
Qy 301 LeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAlaSerAsnAsnGly 320
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Db 1381 CTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGT 1440
Qy 321 GlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGly 340
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1441 GGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGC 1500
Qy 341 LeuThrProGlnGlnValValAlaIleAlaSerAsnAsnGlyGlyLysGlnAlaLeuGlu 360
|||||||||:::|||||||||||||||||||||::::::|||||||||||||||||||||
Db 1501 TTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAG 1560
Qy 361 ThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnVal 380
|||||||||||||||||||||||||||||||||||||||||||||||||||:::||||||
Db 1561 ACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTG 1620
Qy 381 ValAlaIleAlaSerAsnAsnGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeu 400
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||
Db 1621 GTGGCCATCGCCAGCAATATTGGTGGCAAGCAGGCGCTGGAGACGGTGCAGGCGCTGTTG 1680
Qy 401 ProValLeuCysGlnAlaHisGlyLeuThrProGluGlnValValAlaIleAlaSerHis 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1681 CCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCAC 1740
Qy 421 AspGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAla 440
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1741 GATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCC 1800
Qy 441 HisGlyLeuThrProGluGlnValValAlaIleAlaSerHisAspGlyGlyLysGlnAla 460
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1801 CACGGCTTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCG 1860
Qy 461 LeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlu 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1861 CTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAG 1920
Qy 481 GlnValValAlaIleAlaSerAsnIleGlyGlyLysGlnAlaLeuGluThrValGlnAla 500
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1921 CAGGTGGTGGCCATCGCCAGCAATATTGGTGGCAAGCAGGCGCTGGAGACGGTGCAGGCG 1980
Qy 501 LeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAla 520
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1981 CTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCTCAGCAGGTGGTGGCCATCGCC 2040
Qy 521 SerAsnGlyGlyGlyArgProAlaLeuGlu 530
||||||||||||||||||||||||||||||
Db 2041 AGCAATGGCGGCGGCAGGCCGGCGCTGGAG 2070
BDW53721 standard; DNA; 2832 BP.
Human PKLR TALEN right subunit DNA SEQ ID NO: 2.
WO2017077135-A1.
Alignment Scores:
Length: 2832
Score: 2590.50 Matches: 517
Percent Similarity: 98.7% Conservative: 6
Best Local Similarity: 97.5% Mismatches: 6
Query Match: 97.3% Indels: 1
DB: 55 Gaps: 1
US-16-876-079-88 (1-529) x BDW53721 (1-2832)
Qy 1 LeuThrProGluGlnValValAlaIleAlaSerHisAspGlyGlyLysGlnAlaLeuGlu 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 499 TTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAG 558
Qy 21 ThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnVal 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 559 ACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTG 618
Qy 41 ValAlaIleAlaSerAsnGlyGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeu 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 619 GTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTG 678
Qy 61 ProValLeuCysGlnAlaHisGlyLeuThrProGluGlnValValAlaIleAlaSerHis 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 679 CCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCAC 738
Qy 81 AspGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAla 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 739 GATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCC 798
Qy 101 HisGlyLeuThrProGlnGlnValValAlaIleAlaSerAsnGlyGlyGlyLysGlnAla 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 799 CACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCG 858
Qy 121 LeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGln 140
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||:::
Db 859 CTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAG 918
Qy 141 GlnValValAlaIleAlaSerAsnGlyGlyGlyLysGlnAlaLeuGluThrValGlnArg 160
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Db 919 CAGGTGGTGGCCATCGCCAGCAATATTGGTGGCAAGCAGGCGCTGGAGACGGTGCAGGCG 978
Qy 161 LeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAla 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 979 CTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCC 1038
Qy 181 SerAsnGlyGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCys 200
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1039 AGCAATAATGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGC 1098
Qy 201 GlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAlaSerAsnAsnGlyGlyLys 220
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1099 CAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATAATGGTGGCAAG 1158
Qy 221 GlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThr 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1159 CAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACC 1218
Qy 241 ProGluGlnValValAlaIleAlaSerAsnIleGlyGlyLysGlnAlaLeuGluThrVal 260
|||:::|||||||||||||||||||||||| |||||||||||||||||||||||||||
Db 1219 CCCCAGCAGGTGGTGGCCATCGCCAGCAATAATGGTGGCAAGCAGGCGCTGGAGACGGTC 1278
Qy 261 GlnAlaLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAla 280
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1279 CAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCC 1338
Qy 281 IleAlaSerAsnGlyGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProVal 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1339 ATCGCCAGCAATGGCGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTG 1398
Qy 301 LeuCysGlnAlaHisGlyLeuThrProGluGlnValValAlaIleAlaSerHisAspGly 320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1399 CTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCACGATGGC 1458
Qy 321 GlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGly 340
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1459 GGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGC 1518
Qy 341 LeuThrProGlnGlnValValAlaIleAlaSerAsnGlyGlyGlyLysGlnAlaLeuGlu 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1519 TTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCGCTGGAG 1578
Qy 361 ThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnVal 380
|||||||||||||||||||||||||||||||||||||||||||||||||||:::||||||
Db 1579 ACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTG 1638
Qy 381 ValAlaIleAlaSerAsnAsnGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeu 400
|||||||||||||||::::::|||||||||||||||||||||||||||||||||||||||
Db 1639 GTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTG 1698
Qy 401 ProValLeuCysGlnAlaHisGlyLeuThrProGluGlnValValAlaIleAlaSer--- 419
|||||||||||||||||||||||||||||||||:::|||||||||||||||||||||
Db 1699 CCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAAT 1758
Qy 420 AsnGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAla 439
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1759 AATGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCC 1818
Qy 440 HisGlyLeuThrProGlnGlnValValAlaIleAlaSerAsnAsnGlyGlyLysGlnAla 459
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Db 1819 CACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCG 1878
Qy 460 LeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlu 479
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1879 CTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAG 1938
Qy 480 GlnValValAlaIleAlaSerHisAspGlyGlyLysGlnAlaLeuGluThrValGlnArg 499
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1939 CAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGG 1998
Qy 500 LeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAla 519
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1999 CTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCTCAGCAGGTGGTGGCCATCGCC 2058
Qy 520 SerAsnGlyGlyGlyArgProAlaLeuGlu 529
||||||||||||||||||||||||||||||
Db 2059 AGCAATGGCGGCGGCAGGCCGGCGCTGGAG 2088
BBD49763 standard; DNA; 2832 BP.
TALE-nuclease (Repeat CD52_T02-R) coding sequence, SEQ ID 56.
WO2014039523-A1.
Alignment Scores:
Length: 2832
Score: 2572.50 Matches: 514
Percent Similarity: 98.5% Conservative: 8
Best Local Similarity: 97.0% Mismatches: 7
Query Match: 96.6% Indels: 1
DB: 48 Gaps: 1
US-16-876-079-88 (1-529) x BBD49763 (1-2832)
Qy 1 LeuThrProGluGlnValValAlaIleAlaSerHisAspGlyGlyLysGlnAlaLeuGlu 20
|||||||||:::|||||||||||||||||||||::: |||||||||||||||||||||
Db 499 TTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCGCTGGAG 558
Qy 21 ThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnVal 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 559 ACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTG 618
Qy 41 ValAlaIleAlaSerAsnGlyGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeu 60
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Db 619 GTGGCCATCGCCAGCAATAATGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTG 678
Qy 61 ProValLeuCysGlnAlaHisGlyLeuThrProGluGlnValValAlaIleAlaSerHis 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 679 CCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCAC 738
Qy 81 AspGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAla 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 739 GATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCC 798
Qy 101 HisGlyLeuThrProGlnGlnValValAlaIleAlaSerAsnGlyGlyGlyLysGlnAla 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 799 CACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCG 858
Qy 121 LeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGln 140
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||:::
Db 859 CTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAG 918
Qy 141 GlnValValAlaIleAlaSerAsnGlyGlyGlyLysGlnAlaLeuGluThrValGlnArg 160
|||||||||||||||||||||::: |||||||||||||||||||||||||||||||||
Db 919 CAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGG 978
Qy 161 LeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAla 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 979 CTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCC 1038
Qy 181 SerAsnGlyGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCys 200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1039 AGCAATGGCGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGC 1098
Qy 201 GlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAlaSerAsnAsnGlyGlyLys 220
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Db 1099 CAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAG 1158
Qy 221 GlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThr 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1159 CAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACC 1218
Qy 241 ProGluGlnValValAlaIleAlaSerAsnIleGlyGlyLysGlnAlaLeuGluThrVal 260
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1219 CCGGAGCAGGTGGTGGCCATCGCCAGCAATATTGGTGGCAAGCAGGCGCTGGAGACGGTG 1278
Qy 261 GlnAlaLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAla 280
|||||||||||||||||||||||||||||||||||||||||||||:::||||||||||||
Db 1279 CAGGCGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTGGTGGCC 1338
Qy 281 IleAlaSerAsnGlyGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProVal 300
|||||||||::: |||||||||||||||||||||||||||||||||||||||||||||
Db 1339 ATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTG 1398
Qy 301 LeuCysGlnAlaHisGlyLeuThrProGluGlnValValAlaIleAlaSerHisAspGly 320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1399 CTGTGCCAGGCCCACGGCTTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCCACGATGGC 1458
Qy 321 GlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGly 340
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1459 GGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGC 1518
Qy 341 LeuThrProGlnGlnValValAlaIleAlaSerAsnGlyGlyGlyLysGlnAlaLeuGlu 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1519 TTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGTGGCAAGCAGGCGCTGGAG 1578
Qy 361 ThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnVal 380
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1579 ACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTG 1638
Qy 381 ValAlaIleAlaSerAsnAsnGlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeu 400
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1639 GTGGCCATCGCCAGCAATAATGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTG 1698
Qy 401 ProValLeuCysGlnAlaHisGlyLeuThrProGluGlnValValAlaIleAlaSerAsn 420
|||||||||||||||||||||||||||||||||:::||||||||||||||||||||||||
Db 1699 CCGGTGCTGTGCCAGGCCCACGGCTTGACCCCCCAGCAGGTGGTGGCCATCGCCAGCAAT 1758
Qy 421 ---GlyGlyLysGlnAlaLeuGluThrValGlnArgLeuLeuProValLeuCysGlnAla 439
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1759 GGCGGTGGCAAGCAGGCGCTGGAGACGGTCCAGCGGCTGTTGCCGGTGCTGTGCCAGGCC 1818
Qy 440 HisGlyLeuThrProGlnGlnValValAlaIleAlaSerAsnAsnGlyGlyLysGlnAla 459
|||||||||||||||:::|||||||||||||||||||||||| |||||||||||||||
Db 1819 CACGGCTTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCAATATTGGTGGCAAGCAGGCG 1878
Qy 460 LeuGluThrValGlnArgLeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlu 479
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Db 1879 CTGGAGACGGTGCAGGCGCTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCGGAG 1938
Qy 480 GlnValValAlaIleAlaSerHisAspGlyGlyLysGlnAlaLeuGluThrValGlnArg 499
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1939 CAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTCCAGCGG 1998
Qy 500 LeuLeuProValLeuCysGlnAlaHisGlyLeuThrProGlnGlnValValAlaIleAla 519
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1999 CTGTTGCCGGTGCTGTGCCAGGCCCACGGCTTGACCCCTCAGCAGGTGGTGGCCATCGCC 2058
Qy 520 SerAsnGlyGlyGlyArgProAlaLeuGlu 529
||||||||||||||||||||||||||||||
Db 2059 AGCAATGGCGGCGGCAGGCCGGCGCTGGAG 2088