DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
This Office action is in response to the communication filed 1-31-24.
Claims 1-17, 19-21 are pending in the instant application.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 11-17, 19-21 are rejected under 35 U.S.C. 112, first paragraph, because the specification, while being enabling for treating pulmonary hypertension (PH) in a rat model comprising administration of a vector comprising AAV9-mediated, hBNP promoter-driven MTS- HADHA and/or MTS-HADHB expression, and being enabling for an in vitro model comprising H9c2 cells infected with adenovirus expressing HADHA (Ad-HADHA) or EGFP (Ad-EGFP) and kept in normoxia or hypoxia for 72 hours, does not reasonably enable methods for treating right ventricle (RV) dysfunction and failure in pulmonary hypertension (PH) in any subject comprising administering a vector comprising a nucleic acid sequence comprising any human pro-B-type natriuretic protein (hBNP) promoter operably linked to any mitochondrial targeting sequence (MTS) and/or any gene that encodes a PH therapeutic.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
The following factors have been considered in determining that the specification does not enable the skilled artisan to make and/or use the invention over the broad scope claimed.
The breadth of the claims:
The claims are drawn to methods of treating right ventricle (RV) dysfunction and failure in pulmonary hypertension (PH) in any subject comprising administering a vector comprising a nucleic acid sequence comprising any human pro-B-type natriuretic protein (hBNP) promoter operably linked to any mitochondrial targeting sequence (MTS) and/or any gene that encodes a PH therapeutic, wherein the PH therapeutic is expressed in cardiomyocytes undergoing cardiac stress, which hBNP promoter becomes active under cardiac stress and optionally comprises SEQ ID No. 1, which MTS is optionally on the 5’ end of the gene of interest, which PH therapeutic optionally comprises hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha (HADHA), Hydroxyacyl-CoA Dehydrogenase Trifunctional Multienzyme Complex Subunit Beta (HADHB), or c-Src, and which vector is optionally administered intravenously, and which therapeutic is expressed in cardiomyocytes undergoing cardiac stress.
Teachings in the specification:
The specification teaches the following:
FIG. 2 shows an example of RV dysfunction in preclinical PH models. Adult SD rats exposed to 3 wks of hypoxia (10% FiO2), followed by 4 wks of normoxia (PH). Controls (CON) injected with vehicle and kept in normoxia1-3. Hemodynamics and echocardiography were performed at 7 wks, demonstrating increase RV systolic pressure, impaired RV systolic and diastolic function. Tricuspid annular plane systolic excursion (TAPSE); Cardiac Output (CO); RV late diastolic tissue Doppler velocity (e’), RV end diastolic pressure (RVEDP). n=8-12 rats/group (both male and female)…
[0015] FIG. 3 shows Decreased Mito FAO respiration in RV muscle fibers of PH rats. Tissue-specific oxygen flux recorded in real time from permeabilized RV of Control (CON) and PH rats (7 wks timepoint). F: FAO (F-junction substrates); F(N): FAO with low concentration of malate (a N-linked substrate); FN: FAO is combined with high concentration of N-linked substrates, i.e., Pyruvate (P) and Glutamate (G); FNS: FN plus succinate (FN- and succinate-linked). ETC: Electron Transfer Capacity. PalM: Palmitoylcartinine/Malate; Oct: Octanoylcarnitine; S: Succinate; Rot: Rotenone. n=6 rats/group, Mean±SEM, * p<0.01.
[0016] FIG. 4 shows decreased HADHA and HADHB expression in RV of PH rats (7 wks). …
[0017] FIGS. 5A and 5B show reduced mature cardiolipin and less dense cristae packing in RV myocardium of PH rats (7 wks). [FIG. 5A] Mature cardiolipin measurements by mass spectrometry from RV tissue slices. n=4-5/group. Mean±SEM. * p<0.05. [FIG. 5B]. Representative TEM images of RV mito show less dense cristae in RV of PH rats. Scale bar= 200 nm.
[0018] FIGS. 6A and 6B show reduced complex III (CIII) and IV (CIV) abundance in the supercomplex (SC) region (but not in total expression) in RV myocardium of PH rats (7 wks). [FIG. 6A] Representative images of blue native page to assay for CIII and CIV SC abundance. [FIG. 6B] Quantitated data from A. n=10-11 rats/group. Mean±SEM. * p<0.05.
[0019] FIG. 7 shows expression of HADHA and HADHB is decreased in hypoxia vs. normoxia. RNA was extracted from H9c2 cells that were cultured in normoxia or hypoxia for 72 hrs and was used for RNA extraction and real-time PCR. n=3 per group. Mean±SEM. * p<0.05. Data were normalized to GAPDH.
[0020] FIGS. 8A-8C show HADHA overexpression attenuates the reduced FAO and mature CL amount in hypoxia. [FIG. 8A] HADHA expression. H9c2 cells were infected with adenovirus expressing HADHA (Ad-HADHA) or EGFP (Ad-EGFP) and kept in normoxia or hypoxia for 72 hrs, followed by RNA extraction and real-time PCR. …
[0021] FIGS. 9A and 9B show knockdown of HADHA is sufficient to decrease levels of mature CL. HADHA was knocked down using sequence-specific shRNA in H9c2 cells. [FIG. 9A] HADHA expression level in cells with scramble or HADHA shRNA…
[0022] FIGS. 10A-10F show AAV9 delivered, PH-induced, RV cardiomyocyte-specific, mitochondria-targeted payload delivery in vivo. AAV9-hBNP-MTS-EGFP (13 x 1013 genome copies/kg) was injected in rats 2 days before PH induction and tissues were collected at 4 wks. [FIG. 10A] Tiled image of whole heart in cross section. [FIG. 10B, FIG. 10C] A enlarged area of RV and LV, respectively. [FIG. 10D] EGFP expression in LV and RV of Ctr and PH rats injected with same amount of AAV9. [FIG. 10E] EGFP expression in whole cell lysates (WCL) and mitochondrial and cytosolic fractionations from RV of the PH rat injected with AAV9. [FIG. 10F] EGFP expression in major organs of the PH rat.
[0023] FIG. 11 shows human BNP promoter (hBNP) can be activated in vitro by phenylephrine (PE). H9c2 cells were transfected with pGL3 basic EGFP (without promoter) or pGL3 with hBNP-driven EGFP and then stimulated with or without PE.
[0024] FIG. 12 shows a schematic of trifunctional protein (HADHA and HADHB) expression leads to right ventricle (RV) dysfunction.
[0025] FIG. 13 shows an example of viruses that can be used and in vitro study designs.
[0026] FIG. 14 shows an example of an efficiency study in vivo.
[0027] FIGS. 15A and 15B show (FIG. 15A) schematics of an example of disclosed compositions. (FIG. 15B) Illustration of gene construct that is packaged into AAV9 for specific gene delivery to mitochondria of diseased RV cardiomyocytes in PH.
The specification provides more detail and teaches the following:
Preclinical model of PH and RV dysfunction:
[00152] A preclinical PH rat model was used for the study. Adult Sprague Dawley (SD) rats receive 20 mg/kg sc SU5416 (a VEGF antagonist) are exposed to 3 wks of hypoxia (10% FiO2), followed by normoxia. Control rats injected with vehicle are kept in normoxia. At 7 wks time point, hemodynamic and echo assessments (FIG. 2) show PH (increased RV systolic pressure), RV systolic dysfunction (decreased TAPSE and CO) and diastolic dysfunction (decreased e’, elevated RVEDP) in PH rats in comparison to the control rats. No changes noted in LV.
ii. Decreased mito FAO respiration in RV myocardium of PH rats:
[00153] The mito FAO respiration was assessed in RV myocardium using high resolution O2K-FluoRespirometer (Oroboros). Oxygen consumption was recorded in permeabilized RV myocardial fibers from control and PH animals that have RV dysfunction (FIG. 2) to measure FAO-mediated maximal OXPHOS. FIG. 3 shows there is a significant decrease in ADP-induced, palmitoylcartinine- and octanoylcarnitine-mediated maximal OXPHOS in mito from RV of the PH rats (7 wk) in comparison to controls, consistent with other reports and observations in humans. No such change was noted in the LV.
iii. Expression of trifunctional proteins (HADHA and HADHB) is dramatically decreased in RV myocardium of PH rats and in dysfunctional RV of human patients:
[00154] Proteomic profiles were assessed using mito isolated from RV of PH and controls rats (7 wk time point) and identified a significant decrease of a number of proteins that regulate FAO pathway. Among them, HADHA and HADHB are the most downregulated protein in the fatty oxidation pathway: both decreased by ~70% in the RV of PH rats compared to that of control rats. … Consistently, the data show a dramatic decrease in expression levels of HADHA and HADHB in the RV of PH rats (Fig. 4), but not in the LV (data not shown). We also found reduction of HADHA and HADHB expression in dysfunctional human RV than normal functional RV (data nor shown). Together, those data indicate that down-regulation of trifunctional proteins can play a key role in RV mito function and structure in settings of PH.
iv. Altered mature CL, mito structure, and SC in RV myocardium of PH rats:
[00155] Given the importance of HADHA in mito cardiolipin maturation and subsequent mito structure regulation, whether mature CL and mito structure in RV myocardium of PH rats are altered was determined. Mature CL (CL[18:2]4) was measured by mass spectrometry. FIG. 5A shows significant reduction in the amount of mature CL in RV of PH rats, which is associated with decreased HADHA expression (FIG. 4).
[00156] Mito structure was determined using transmission electron microscopy (TEM, Fig 5B), which shows less dense cristae packing in the RV of PH rats compared to controls. In addition, SC assembly was assessed and the data show that the RV of PH rats have a decreased abundance of CIII and CIV in the supercomplex region (FIG. 6), while the total expression of either CIII or CIV is not changed. Together, these data indicate that decreased HADHA likely results in reduced mature CL, less dense cristae packing, and impaired SC assembly in RV myocardium of PH rats, which are sufficent to lead to mito dysfunction.
v. In vitro model mimicking the mito changes observed in PH rat model:
[00157] An in vitro model was generated to study the mechanisms and effect of decreased FAO proteins using a rat myocyte cell line (H9c2 cells) that is amenable to easy culture and genetic manipulations. Exposing the H9c2 cells to hypoxia (1% O2) for 72 hrs recapitulated the expression profile observed in the dysfunctional RV of PH rats: a significant decrease in expression of several proteins regulating FAO including HADHA and HADHB (FIG. 7 and Table 1). In order to determine whether overexpression of HADHA can rescue the dysfunctional mito, adenovirus expressing HADHA were generated. As shown in FIG. 8A, the cells infected with adenovirus expressing HADHA have a 3.6-fold increase of HADHA expression than cells infected with adenovirus expressing EGFP (control) in hypoxia.
vi. Down-regulation of HADHA in H9c2 cells in hypoxia is associated with decreased FAO and mature CL, which can be attenuated by HADHA overexpression:
[00158] Whether H9c2 cells in hypoxia have altered FAO and mature CL was determined as well as whether overexpression of HADHA in H9c2 in hypoxia can attenuate the changes in FAO and mature CL. H9c2 cells were infected by adenovirus and kept in hypoxia for 72 hrs, followed by FAO assessments (Oroboros) or mature CL measurements (mass spectrometry). Fig. 8B shows a 50% reduction of FAO-linked respiration in hypoxic cells and HADHA expression is able to significantly improve FAO-linked respiration in hypoxia. Similarly, compared to normoxic cells, a 70% reduction in the account of mature CL in hypoxic cells was seen, which is almost fully attenuated by HADHA expression (FIG. 8C). We also found that HADHA specific knockdown is sufficient to decrease mature CL in H9c2 cells (FIG. 9). The data demonstrate that HADHA is critical in maintaining FAO and mito structure. In this proposal, the efficacy of TFP/HADHA overexpression in PH rat model is tested.
[00172] Primary cardiomyocytes are isolated from adult male and female SD rats. The cells are cultured in either normoxic or hypoxic (1% O2) conditions for 48-72h after infection with the following: Ad-EGFP, Ad-MTS-HADHA, Ad-MTS-HADHB, and Ad-MTS-HADHA-HADHB (as in Fig. 8A). At the end of the experiments, myocytes are collected for the following assays: (i) Subcellular fractionation followed by immunoblot for HADHA and HADHB, (ii) RNA Isolation and qPCR for genes regulating FAO (e.g. Table 1), (iii) Assessments of mito FAO and OXPHOS using Oroboros (see FIG. 8B), (iv) Evaluation of mito structure by TEM, (v) mito isolation followed by blue native page to assay for supercomplex abundance and activity, and (vi) abundance of mature CL and precursors using MALDI-TOF or LCMS (FIG. 8C).
[00173] Optimize the AAV infection strategy using isolated adult rat cardiomyocytes under vehicle/phenylephrine in vitro and determine mito specific exogenous gene expression using mito fractionation and immunoblot, mito FAO using Oroboros, mito SC abundance/activity using blue native page, mature CL content using mass spectrometry, and mito structure using TEM.
[00174] Primary cardiomyocytes from adult male and female SD rats are cultured either in presence or absence of 10-50 μM phenylephrine (a strong myocyte hypertrophy agonist that stimulates hBNP promoter, FIG. 11) for 48-72h after infection with the following: AAV9-hBNP-MTS-EGFP, AAV9-hBNP-MTS-HADHA, AAV9-hBNP-MTS-HADHB or both AAV9-hBNP-MTS-HADHA and AAV9-hBNP-MTS-HADHB. At the end of the experiments, myocytes are collected for the following assays: (i) Subcellular fractionation followed by immunoblot for HADHA and HADHB, (ii) RNA Isolation and qPCR for genes regulating FAO (e.g. Table 1), (iii) Assessments of mito FAO and OXPHOS using Oroboros (see FIG. 8B), (iv) Evaluation of mito structure by TEM, (v) mito isolation followed by blue native page to assay for supercomplex abundance and activity, and (vi) abundance of mature CL and precursors using MALDI-TOF or LCMS (FIG. 8C).
Example 3: Determine the efficiency and efficacy of AAV9-mediated gene delivery in dysfunctional RV in preclinical rat PH model on RV mito structure/ function, metabolism, and RV function in vivo .
[
00177] Adult rats subjected to sc SU5416 (a VEGF antagonist) are exposed to 3 wks of hypoxia (10% FiO2), followed by normoxia, to induce PH. The rats develop severe PH and RV dysfunction and will be used at 7 wk timepoint (FIG. 2). Control rats injected with vehicle are kept in normoxia.
[00178] In vivo optimization studies: AAV9 vectors generated can be injected and tested (AAV9 expressing hBNP-MTS-EGFP as control) 2 days before PH induction and assess expression of HADHA and HADHB and EGFP. Dose optimization is performed by injecting different amount of AAV9 (5-13 x 1013 genomes/kg body weight) to restore the HADHA and HADHB expression level comparable to the endogenous level in control rats. Cardiac cells (e.g., cardiomyocytes, fibroblasts, endothelial cells, smooth muscle cells) are isolated and used in immunoblots to determine the RV cardiomyocyte-specific expression. Next, expression of EGFP and HADHA/HADHB at 1, 4, 7, 10 wks is assessed to ascertain the temporal expression profile in the RV using the optimal dose. This informs the use of the right timing of the AAV9 injection for expression of the target molecules. The expression of AAV9 mediated genes can alter the levels of target proteins in the heart by ~ 3 wks post PH induction. At 3 wks time point, the PH and RV dysfunction is already present.
[00179] Efficacy Studies: After optimizing and validation of mito-targeted HADHA and HADHB expression in RV, effects of restoring mito HADHA and HADHB expression on RV are determined in PH using groups: Treatment Group: PH rats with AAV9-mediated, hBNP promoter-driven MTS- HADHA and/or MTS-HADHB expression, and Control Group: PH rats with AAV9-mediated, hBNP promoter-driven EGFP expression (FIG. 14). At 7 wk time point, the following are assessed: (i) Cardiac morphology and function assessed by serial echocardiography (also before AAV injection and 4 weeks after PH induction). (ii) Invasive hemodynamics at the end of the experiments to assess RV systolic and diastolic pressures. (iii) Oroboros for RV mito respirations with FAO and mito ROS in RV myocardium. (Iv) OxyBlot to assess oxidative stress and ATP assays to measure ATP amount in RV myocardium. (v) Myocardial histology (gross morphology, H&E, and TUNEL staining for apoptosis, trichrome staining for fibrosis), (iv) EM for assessment of mito size and cristae density, and (vii) levels of mature CL.
[Emphases added][citations omitted].
The examples provided in the instant specification, of the administration of an AAV9 vector of no description and comprising the hBNP promoter of SEQ ID No. 1, the MTS of SEQ ID No. 2, and HADHA and/or HADHB to a preclinical PH rat model, and of the in vitro model comprising H9c2 cells infected with adenovirus expressing HADHA (Ad-HADHA) or EGFP (Ad-EGFP) and kept in normoxia or hypoxia for 72 hours are not representative or correlative of the broad claims encompassing the ability to treat right ventricle (RV) dysfunction and failure in pulmonary hypertension (PH) in any subject upon administration by any route of the therapeutic agents broadly claimed.
In light of the teachings in the art and the specification, one skilled in the art would not accept on its face the examples provided in the instant disclosure as being correlative or representative of the ability to provide treatment effects in any subject using the broad genus of therapeutic agents claimed. Since the specification fails to provide the requisite guidance for the treatment in any subject, and since determination of the factors required for accomplishing this in any subject is highly unpredictable, it would require undue experimentation to practice the invention over the broad scope claimed.
For these reasons, the instant rejection for lacking enablement over the full scope claimed is proper.
Claims 11-17. 19-21 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
The breadth of the claims:
The claims are drawn to methods of treating right ventricle (RV) dysfunction and failure in pulmonary hypertension (PH) in any subject comprising administering a vector comprising a nucleic acid sequence comprising any human pro-B-type natriuretic protein (hBNP) promoter operably linked to any mitochondrial targeting sequence (MTS) and/or any gene that encodes a PH therapeutic, wherein the PH therapeutic is expressed in cardiomyocytes undergoing cardiac stress, which hBNP promoter becomes active under cardiac stress and optionally comprises SEQ ID No. 1, which MTS is optionally on the 5’ end of the gene of interest, which PH therapeutic optionally comprises hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit alpha (HADHA), Hydroxyacyl-CoA Dehydrogenase Trifunctional Multienzyme Complex Subunit Beta (HADHB), or c-Src, and which vector is optionally administered intravenously, and which therapeutic is expressed in cardiomyocytes undergoing cardiac stress.
Teachings in the specification:
The teachings in the specification are described above in the scope of enablement rejection.
The specification fails to provide the requisite guidance for using the large genus of therapeutic agents and vectors instantly claimed, and further whereby treatment is provided in any subject. The specification teaches an AAV9 vector with no description of its size, and comprising the promoter of SEQ ID No. 1, the MTS of SEQ ID No. 2, and further comprising HADHA and//or HADHB as therapeutic agents. These examples do not provide a representative number of species for the multitude of therapeutics encompassed by the claims.
Since the disclosure fails to describe the common attributes and characteristics concisely identifying members of the proposed genus of therapeutic agents and vectors, and because the claimed genus is highly variant, the description provided is insufficient. One of skill in the art would reasonably conclude that the disclosure fails to provide a representative number of species to describe the broad genus of therapeutic vectors and agents instantly claimed.
Thus, Applicant was not in possession of the broadly claimed genus.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 1 is/are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Jovanovic et al (US 2011/0158947).
Jovanovic et al (US 2011/0158947) teach nucleic acid constructs comprising the human brain natriuretic peptide (hBPN) promoter, a mitochondrial targeting sequence (MTS), and an operably linked gene of interest (see esp. paragraphs 0048, 0056, claims 16 and 25).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1-5, 7-10 is/are rejected under 35 U.S.C. 103 as being unpatentable over Jovanovic et al (US 2011/0158947) in view of O’Carroll et al (WO 2020/163240) and N. Bursac (US 2019/0030186).
The claims are drawn to nucleic acid constructs comprising an AAV9 viral vector comprising a human pro-B-type natriuretic protein (hBNP) promoter operably linked to a mitochondrial targeting sequence (MTS) of SEQ ID No. 2, and a pulmonary hypertension (PH) therapeutic optionally comprising Hydroxyacyl-CoA Dehydrogenase subunit alpha (HADHA) and Hydroxyacyl-CoA Dehydrogenase subunit beta (HADHB).
Jovanovic et al (US 2011/0158947) teach nucleic acid constructs comprising the human brain natriuretic peptide (hBPN) promoter, a mitochondrial targeting sequence (MTS), and an operably linked gene of interest (see esp. paragraphs 0048, 0056, claims 16 and 25).
The primary reference does not teach AAV9 vectors comprising the mitochondrial targeting signal (MTS) comprising SEQ ID No. 2 or the therapeutic agents Hydroxyacyl-CoA Dehydrogenase subunit alpha (HADHA) and Hydroxyacyl-CoA Dehydrogenase subunit beta (HADHB).
O’Carroll et al (WO 2020/163240) teach nucleic acid constructs comprising the mitochondrial targeting signal (MTS) comprising SEQ ID No. 2 in combination with the therapeutic agents Hydroxyacyl-CoA Dehydrogenase subunit alpha (HADHA) and Hydroxyacyl-CoA Dehydrogenase subunit beta (HADHB) (see esp. Table 3 on pages 72-86, and the alignment below between Accession No. BIC75094 of O’Carroll and instantly claimed SEQ ID No. 2).
RESULT 9
BIC75094
ID BIC75094 standard; DNA; 2184 BP.
XX
AC BIC75094;
XX
DT 01-OCT-2020 (first entry)
XX
DE Human ACADVL gene mutant 950T/C.
XX
KW ACAVL gene; VLCAD protein; Very long chain acyl-CoA dehydrogenase; ds;
KW fatty acid oxidation disorder; fatty acid oxidation quantitation;
KW metabolic-gen.; mutant; pharmaceutical; screening; therapeutic.
XX
OS Homo sapiens.
OS Synthetic.
XX
CC PN WO2020163240-A1.
XX
CC PD 13-AUG-2020.
XX
CC PF 03-FEB-2020; 2020WO-US016430.
XX
PR 04-FEB-2019; 2019US-0800995P.
XX
CC PA (RENE-) RENEO PHARM INC.
XX
CC PI Ocarroll C, Odonnell N, Purkins L, Dorenbaum A;
XX
DR WPI; 2020-76723C/069.
XX
CC PT Treating fatty acid oxidation disorder in mammal comprises administering
CC PT to the mammal with fatty acid oxidation disorder peroxisome proliferator-
CC PT activated receptor delta agonist compound.
XX
CC PS Claim 12; Page; 107pp; English.
XX
CC The present invention relates to a novel method for treating a fatty acid
CC oxidation disorder (FAOD) in a mammal. The method comprises administering
CC a peroxisome proliferator-activated receptor delta (PPAR delta) agonist
CC compound to the mammal. The invention further provides: (1) a method for
CC measuring whole-body fatty acid oxidation in a human with a fatty acid
CC oxidation disorder (FAOD); and (2) a method for measuring changes in
CC whole-body fatty acid oxidation in a human with a fatty acid oxidation
CC disorder (FAOD), such as carnitine transporter deficiency,
CC carnitine/acylcarnitine translocase deficiency, carnitine palmitoyl
CC transferase deficiency type 1, carnitine palmitoyl transferase deficiency
CC type 2, glutaric acidemia type 2, long-chain 3-hydroxyacyl CoA
CC dehydrogenase deficiency, medium-chain acyl CoA dehydrogenase deficiency,
CC short-chain acyl CoA dehydrogenase deficiency, short-chain 3-hydroxyacyl
CC CoA dehydrogenase deficiency, trifunctional protein deficiency and/or
CC very long-chain acyl CoA dehydrogenase deficiency, carnitine
CC palmitoyltransferase II deficiency, very long-chain acyl-CoA
CC dehydrogenase deficiency, long-chain 3-hydroxyacyl-CoA dehydrogenase
CC deficiency and/or trifunctional protein deficiency. Note: The present
CC sequence is not shown in the specification but is derived from the human
CC ACADVL gene sequence given in table 3 (see BIC75059), based on the
CC information provided in claim 12.
XX
SQ Sequence 2184 BP; 476 A; 575 C; 686 G; 447 T; 0 U; 0 Other;
Query Match 100.0%; Score 126; Length 2184;
Best Local Similarity 100.0%;
Matches 126; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGCAGGCGGCTCGGATGGCCGCGAGCTTGGGGCGGCAGCTGCTGAGGCTCGGGGGCGGA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 48 ATGCAGGCGGCTCGGATGGCCGCGAGCTTGGGGCGGCAGCTGCTGAGGCTCGGGGGCGGA 107
Qy 61 AGCTCGCGGCTCACGGCGCTCCTGGGGCAGCCCCGGCCCGGCCCTGCCCGGCGGCCCTAT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 108 AGCTCGCGGCTCACGGCGCTCCTGGGGCAGCCCCGGCCCGGCCCTGCCCGGCGGCCCTAT 167
Qy 121 GCCGGG 126
||||||
Db 168 GCCGGG 173.
N. Bursac (US 2019/0030186) teaches AAV9 vectors for administration to cardiac tissue and cells (see esp. paragraphs 0006-0008, 0116-0120).
It would have been obvious to design and construct the nucleic acid vectors and sequences claimed because the combination of the cardiac promoter hBNP, a mitochondrial targeting signal (MTS) and the PH therapeutics HADHB and HADHA were well known and routinely used in the prior art, as taught by O’Carroll and Jovanovic. One would have been motivated to package these components in an AAV9 vector because AAV9 vectors are routinely used for cardiac delivery, as taught previously by Bursac. One of ordinary skill would have reasonably expected that these components would provide enhanced targeting and expression in cardiac tissues and cells.
For these reasons, the instant invention would have been obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention.
Allowable Subject Matter
SEQ ID No. 1 appears free of the prior art searched and of record.
Claim 6 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Conclusion
Certain papers related to this application may be submitted to Art Unit 1637 by facsimile transmission. The faxing of such papers must conform with the notices published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 C.F.R. ' 1.6(d)). The official fax telephone number for the Group is 571-273-8300. NOTE: If Applicant does submit a paper by fax, the original signed copy should be retained by applicant or applicant's representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED so as to avoid the processing of duplicate papers in the Office.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jane Zara whose telephone number is (571) 272-0765. The examiner’s office hours are generally Monday-Friday, 10:30am - 7pm. If attempts to reach the examiner by telephone are unsuccessful, the examiner's supervisor, Jennifer Dunston, can be reached on (571)-272-2916. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (703) 308-0196.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free).
Jane Zara
7-22-26
/JANE J ZARA/Primary Examiner, Art Unit 1637
Prosecution Insights