DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
This Office action is in response to the communication filed 7-22-26.
Claims 1-9, 12, 16, 20-28, 31, 35, 39-43, 47, 59 are pending in the instant application.
Election/Restrictions
Claims 1-9, 12, 16, 39-43, 47, 59 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention or species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 7-22-26.
Applicant’s election without traverse of Group II, claims 20-28, 31 and 35, in the reply filed on 7-22-26, is acknowledged.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 20-28, 31 and 35 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 20 recites the acronym “PRNP” in, e.g., line 5 without spelling out what this acronym represents. Appropriate clarification is required.
Claim 20 recites the limitation "the octapeptide repeat region" in line 16. There is insufficient antecedent basis for this limitation in the claim. Appropriate correction is required.
Claims 20-28, 31 and 35 recite or encompass specific mutations (e.g., claims 25-27) and deletions (e.g., claims 20-24) without specifying a particular nucleotide sequence which has been mutated and/or contains deletions. Appropriate correction/clarification is required.
It is unclear what the abbreviations recited in the last two lines of claim 25 represent (see, e.g., “2-0PRD… to “12-OPRI”). Appropriate clarification is required.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 20-28, 31 and 35 are rejected under 35 U.S.C. 112, first paragraph, because the specification, while being enabling for identifying subjects having at least one reference PRNP allele or having at least one PRNP allele encoding an endogenous scrapie PrP, or additionally sequence confirming a deletion of 24 base pairs (8 amino acids) in a PRP in a subject, does not reasonably enable methods for treating any prion disease in any subject.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
The following factors have been considered in determining that the specification does not enable the skilled artisan to make and/or use the invention over the broad scope claimed.
The breadth of the claims:
The claims are drawn to methods of treating a subject having a prion disease or at risk of developing a prion disease comprising administering or continuing to administer a nucleic acid molecule encoding a modified PrP to the subject that has at least one reference PRNP allele or has at least one PRNP allele encoding an endogenous scrapie PrP; which nucleic acid molecule encoding the modified PrP comprises a nucleotide sequence encoding PrP but having a deletion that comprises 24 nucleotides within the nucleotide sequence encoding an octapeptide repeat region; or which nucleotide sequence encoding PrP but having a deletion that comprises 24 nucleotides and comprises the deletion of ACAGCCT within the nucleotide sequence encoding the octapeptide repeat region, or which nucleic acid molecule encoding the modified PrP comprises a nucleotide sequence encoding PrP but having a deletion of ACAGCCTCATGGTGGTGGCTGGGG (SEQ ID NO: 3) or having a deletion of CATGGTGGTGGCTGGGGACAGCCT (SEQ ID NO: 4) within the nucleotide sequence encoding the octapeptide repeat region of PrP, which modified PrP administered to the subject is optionally inserted into the genome of the subject at the prion promoter site or at a different site in the genome of the subject, which prion disease is familial Creutzfeldt-Jakob disease (CJD), sporadic CJD, variant CJD, iatrogenic CJD, Gerstmann-Straussler-Scheinker (GSS) syndrome, fatal familial insomnia (FFI), prion protein amyloidosis, systemic amyloidosis, or prion protein cerebral amyloid angiopathy.
Teachings in the specification:
Example 1: PRNP Sequencing in Family
Sequencing was performed on a Libyan Jewish family composed of 22 members, 11 of which were asymptomatic carriers of the PRNP-E200K highly penetrant mutation (>94%). This family included a highly resilient and healthy 95 year old female that was well beyond the age at onset of 30-80 years, but never had Creutzfeldt-Jakob disease (CJD). Sequencing confirmed a deletion of 24 base pairs (8 amino acids), creating a new repeat sequence in the OPR (octapeptide repeat) of this individual that was validated by long read sequencing. This deletion, truncating part of R3 and R4 of the OPR, was on another allele different from the E200K variant this person carried.
The example provided in the instant specification, of identification of a Libyan Jewish family in which half of the family members were asymptomatic carriers of a single mutation, PRNP-E200K, and where an elder family member also had a deletion of 24 base pairs, truncating a portion of the R3 and R4 of the octapeptide repeat, is not representative or correlative of the ability to treat any subject for any prion disease
upon administration by any route of a modified PrP of unknown sequence but having a deletion that comprises 24 nucleotides and/or comprises the deletion of ACAGCCT within the nucleotide sequence encoding the octapeptide repeat region of the modified PrP, or which nucleic acid molecule encoding the modified PrP comprises a nucleotide sequence encoding PrP but having a deletion of ACAGCCTCATGGTGGTGGCTGGGG (SEQ ID NO: 3) or having a deletion of CATGGTGGTGGCTGGGGACAGCCT (SEQ ID NO: 4), and which modified PrP is optionally inserted into the genome of the subject.
In light of the teachings in the specification, one skilled in the art would not accept on its face the examples provided in the instant disclosure as being correlative or representative of the ability to provide treatment effects for any prion disease in any subject. Since the specification fails to provide the requisite guidance for the adequate delivery and expression of any modified PRP in any subject, and further whereby any prion disease is treated, and since determination of the factors required for accomplishing this in any subject is highly unpredictable, it would require undue experimentation to practice the invention over the broad scope claimed.
For these reasons, the instant rejection for lacking enablement over the full scope claimed is proper.
Claims 20-28, 31 and 35 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
The breadth of the claims:
The claims are drawn to methods of treating a subject having a prion disease or at risk of developing a prion disease comprising administering or continuing to administer a nucleic acid molecule encoding a modified PrP to the subject that has at least one reference PRNP allele or has at least one PRNP allele encoding an endogenous scrapie PrP; which nucleic acid molecule encoding the modified PrP comprises a nucleotide sequence encoding PrP but having a deletion that comprises 24 nucleotides within the nucleotide sequence encoding an octapeptide repeat region; or which nucleotide sequence encoding PrP but having a deletion that comprises 24 nucleotides and comprises the deletion of ACAGCCT within the nucleotide sequence encoding the octapeptide repeat region, or which nucleic acid molecule encoding the modified PrP comprises a nucleotide sequence encoding PrP but having a deletion of ACAGCCTCATGGTGGTGGCTGGGG (SEQ ID NO: 3) or having a deletion of CATGGTGGTGGCTGGGGACAGCCT (SEQ ID NO: 4) within the nucleotide sequence encoding the octapeptide repeat region of PrP, which modified PrP administered to the subject is optionally inserted into the genome of the subject at the prion promoter site or at a different site in the genome of the subject, which prion disease is familial Creutzfeldt-Jakob disease (CJD), sporadic CJD, variant CJD, iatrogenic CJD, Gerstmann-Straussler-Scheinker (GSS) syndrome, fatal familial insomnia (FFI), prion protein amyloidosis, systemic amyloidosis, or prion protein cerebral amyloid angiopathy.
Teachings in the specification:
The teachings in the specification are described above in the scope of enablement rejection.
The specification fails to provide the requisite guidance for using the genus of therapeutic agents instantly claimed, and further whereby treatment is provided in any subject. The specification describes mutations and deletions of modified PrP, but provides no corresponding SEQ ID Nos. that adequately describe the mutated forms of PrP. It cannot be discerned where these deletions or mutations concisely occur within a particular full length nucleic acid sequence. Although the claims repeatedly refer to deletions comprising 24 nucleotides, octapeptide repeat regions, and R3 to R4 regions, there is no way of determining where these deletions or repeat regions exactly occur in the full length nucleic acid molecules.
Since the disclosure fails to describe the common attributes and characteristics concisely identifying members of the proposed genus of therapeutic agents, and because the claimed genus is highly variant, the description provided is insufficient. One of skill in the art would reasonably conclude that the disclosure fails to provide a concise description of the broad genus of therapeutic agents instantly claimed.
Thus, Applicant was not in possession of the broadly claimed genus.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 20-22, 28, 35 is/are rejected under 35 U.S.C. 103 as being unpatentable over Pongor et al (WO 2014/041380), Burton et al (WO 2003/085086), Flechsig et al (Neuron, Vol. 27, pages 399-408 (2000)) and Yu et al (International J. Molecular Sciences, Vol. 22, pages 1-11 (2021)).
The claims are drawn to methods of treating a subject having a prion disease or at risk of developing a prion disease comprising administering or continuing to administer a nucleic acid molecule encoding a modified PrP to the subject that has at least one reference PRNP allele or has at least one PRNP allele encoding an endogenous scrapie PrP; which nucleic acid molecule encoding the modified PrP comprises a nucleotide sequence encoding PrP but having a deletion that comprises 24 nucleotides within the nucleotide sequence encoding an octapeptide repeat region
Pongor et al (WO 2014/041380) studied the octapeptide repeat region of human major prion protein as a prototype example of a repetitive protein. An approximately 200 bp region was chosen that contains five 24 bp near-perfect repeats, with the structure of R1-R2-R2-R3-R4, where Rl is a nonapeptide repeat, R2 is present in two identical copies. A natural variant of this region contains a 24 bp deletion between Rl and R2 (no. 2 in Table SI -2), while disease-linked mutations include several single or multiple insertions of 24bp repeats ' . The sequence of the insertion often corresponds to variants of the R2 repeat, which gives rise to structures such as R1-R2-R2'-R2-R2'R3-R4 (no 3 in Table Sl-2) where R2' differs from R2 by a single nucleotide substitution (sequences given in Appendix). (See pages 14-15). [Emphasis added].
Burton et al (WO 2003/085086) (IDS filed 5-6-24) teach methods to detect infectious forms of prion proteins (Abstract, first para on page 7, claims 7, 10, 11, 13). Scrambling of interfacing residues between wild type PrP and PrpSc abolished aggregation (first para on page 7; pages 12-13). Burton describes mutations comprising base substitutions and the presence of additional octarepeats in subjects with CJD (Pages 40-42).
Flechsig et al (Neuron, Vol. 27, pages 399-408 (2000)) (IDS filed 5-6-24) teach the deletion of codons 32-93, removing all five octarepeats of PrP, to study the interaction between PrP and PrpSc. Flechsig teaches the N-terminal half of PrP contains a conserved region of tandem repeats of an eight amino acid sequence (octarepeats) with affinity for copper ions. Amplification of the repeat number beyond the usual five was found in subjects with human familial prion diseases. The octarepeat sequence was found to affect the level of prion accumulation and pathogenesis in the brain (text on page 399, Fig. 1 on page 400; Fig. 2 on page 401; bridging para on pages 404-405).
Yu et al (International J. Molecular Sciences, Vol. 22, pages 1-11 (2021)) (IDS filed 3-1-24) teach that the misfolding of the wild type PrP aggregates into a disease associated state termed PrPSc (Sc stands for scrapie). Prion proteins play an essential role in the pathogenesis of prion diseases. The misfolding of PrP into PrPSc causes various types of encephalopathies in animals, including Creutzfeldt-Jakob diseases (CJD). Single point mutations and multiple insertion mutations in an octapeptide region in the N terminal domain of PrP contribute to aggregation. The wild type PrP has a large helical domain and a short antiparallel beta sheet in the C terminal domain. PrPSc contrasts this with increases in cross beta sheets and few helical structures. (page 1). The N terminal domain of PrP contains five tandem repeats of an octapeptide. There is a correlation between the age of onset of CJD symptoms and the number of excess octapeptide repeats (page 2). Changing the number of octapeptide repeats weakens the helical structures and promotes prion aggregates. Insertion of additional octapeptides correlates with early onset of CJD. Insertion of additional octapeptides weakens the helical structure, accelerates prion fibrillation, increasing protein aggregation (page 7; Conclusion on pages 9-10).
It would have been obvious to treat subjects at risk of developing or having a prion disease by modifying the prion protein (PrP) by deleting the octapeptide repeat region because the prior art provided correlations between additional octapeptide repeat regions and the onset of various prion diseases, including CJD. The secondary structures of PrP and PrPSc were well studied in the prior art and the reduction of helical regions and the increase of beta sheet structures and protein aggregation in prion disease has been well documented, as revealed in the teachings of Pongor, Burton, Flechsig, and Yu. One of ordinary skill in the art would have reasonable expected that removal of octarepeats would reduce protein aggregation and onset of prion diseases. Both the removal of octarepeats and an observed reduction in aggregation of PrP were routinely taught in the prior art as set forth above.
For these and the aforementioned reasons, the instant invention would have been obvious to one of ordinary skill in the art prior to the effective filing date of the instant invention.
Conclusion
Certain papers related to this application may be submitted to Art Unit 1637 by facsimile transmission. The faxing of such papers must conform with the notices published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 C.F.R. ' 1.6(d)). The official fax telephone number for the Group is 571-273-8300. NOTE: If Applicant does submit a paper by fax, the original signed copy should be retained by applicant or applicant's representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED so as to avoid the processing of duplicate papers in the Office.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jane Zara whose telephone number is (571) 272-0765. The examiner’s office hours are generally Monday-Friday, 10:30am - 7pm. If attempts to reach the examiner by telephone are unsuccessful, the examiner's supervisor, Jennifer Dunston, can be reached on (571)-272-2916. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (703) 308-0196.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free).
Jane Zara
9-9-26
/JANE J ZARA/Primary Examiner, Art Unit 1637
Prosecution Insights