DETAILED ACTION
Non-Final Rejection
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
2. Applicant’s election without traverse of Group I claims 1-2, 4-12, 14-16 and 27-28 in the reply filed on 08/13/2026 is acknowledged.
Species election: Applicant elected following species.
SARS-CoV-2 in claim 4; SARS CoV-1 in claim 10-11, SEQ ID NO:11 in claim 12. Applicant indicated that the species election reads on claims 1-6, 8-12, 14-16, and 27-28.
For Compact Prosecution: The search and consideration were extended to the non-elected species SEQ ID NOs: 1-3, 5, 7, 9 and 11 recited in claims 7 and 12.
Status of Claims
3. Claims 1-2, 4-12, 14-16 and 27-28 filed on 08/13/2026 are pending and under examination.
4. Claims 3, 13, and 17-26 are cancelled by the applicant.
5. Claims 1-2, 4-12, 14-16 and 27-28 as elected Group I is under examination.
Priority
6. This application claims priority from GR20210100099 filed 16 February 2021 and from US63/196,128 filed 02 June 2021.
Receipt is acknowledged of certified foreign priority copies of Application papers filed on 08/15/2023 required by 37 CFR 1.55.
Information Disclosure Statement
7. The information disclosure statements (IDSs) submitted on 08/15/2023, 03/15/2024, and 04/17/2024 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Objections
8. Claims 8 and 12 is objected to because of the following informalities:
In claim 8, “CDS+” T cell epitope appears to be a typographical error and should be CD8+ T cell epitope in view of the support in specification.
In claim 12, “set out in”. The phrase is not routinely used and there is no clarity to the claim by use of “set out in”.
Appropriate correction is required.
Objections to Specification
9. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
See, page 23 last para: The immune epitope database (IEDB; http://www.iedb.org)
See, page 88: Transcription Kit (https://www.fishersci.co.uk/shop/products/product/10219104).
Claim Rejections - 35 USC § 112
10. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 7 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The claim 7 recite a term “variant” that renders the claim indefinite without limiting the % identity permissible variation of the claimed sequence in the SEQ ID NO in the claim. A variant sequence can include insertion, deletion, substitution of an amino acid, a fragment of a immunogenic peptide. The specification recites only SEQ ID NO. without providing a closed definition. Accordingly, the metes and bound of the term “variant” is unclear.
Claim Rejections - 35 USC § 112 (Written Description)
11. The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 4-12, 14-16, and 27-28 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 1 and dependent claims 2, 4-12, 14-16, and 27-28 are directed to a genus of an immunogenic peptide comprising an epitope from a polypeptide encoded by an open reading frame (ORF) encoded by at least part of the reverse complement of the genome of a coronavirus.
Claim 7. The dependent claim 7 a limitation, wherein the ORF comprises the sequence of SEQ ID NO. 1 or a variant thereof or encodes a polypeptide comprising the sequence of SEQ ID NO: 13 or a variant thereof.
Under BRI, the limitation variant thereof reads on a genus of variant sequences that comprise many species that are not defined for its sequences. A variation can comprise insertion, deletion or substitution in the sequence. Variant sequence reads on a fragment of sequence comprised in SEQ ID NO: 1. Instant specification page 28 recites that a variant of SEQ ID NO: 1 having at least 50% sequence identity thereto. In SEQ ID NO: 1 each n is independently selected from t and u. In one aspect, each n may, for example, be t. That is, all of the ns may be t. In another aspect, each n may, for example, be u. That is, all of the ns may be u. In a further aspect, some of the ns may be t and some of the ns may be u. That is, the sequence may contain a combination of t and u. The variant may, for example, have at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or 99% sequence identity to SEQ ID NO: 1. Although claim 1 does not recite variant of immunogenic peptide, in view of the instant specification the phrase comprise can include a variant sequence of SEQ ID NO: 1.
Claim 12. The immunogenic peptide of claim 1, comprising one or more of the peptides set out in SEQ ID NOs: 2 to 12. The instant claim 12 inherits variant limitations from claim 1. The instant specification page 19 recites that a variant may, for example, have at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 900%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the relevant sequence selected from SEQ ID NOs: 2 to 12.
The invention is directed to an immunogenic peptide composition intended to induce protective immune response against a coronavirus (also read on elected species SARS-CoV-2) to confer protection and thus implicitly comprise a functional limitation an induction of protective immune response against a coronavirus. The instant claims 1 and dependent claims recites a broad genus of an immunogenic peptide that has large variation as per limitation “variant thereof” (see, specification pages as recited supra). When there is substantial variation within the genus, as here, one must describe a sufficient variety of species to reflect the variation within the genus to provide a “representative number” of species. The claimed genus comprises innumerable number of sequences that arise due to the claimed variation. The specification has not adequately described the species of the genus, nor successfully reduced to practice the variant species of the genus. The dependent claim 7 recite a variant thereof without disclosing any specific sequence of a variant by structure of the variant immunogenic peptide. Under BRI the variation can comprise substitutions (claim 7 , nucleotide or amino acids). The claimed variant nucleotide or peptide sequence can comprise deletion or insertion or substitution in the sequences that can affect the B and T cell epitopes and thus can affect protective immune response (humoral and cellular) against a coronavirus (see claim 8). One of ordinary skills in the art cannot conclude that Applicant was in possession of the innumerable variant species of immunogenic peptide sequences encompassed by the claimed genus. Absent the disclosed positions of variation along the sequence, the skilled artisan would not be able to visualize or otherwise predict, a priori, each individual variant sequence of the claimed immunogenic peptide of a coronavirus in comparison to the reference sequences elected sequence SEQ ID NO: 11 or even the non-elected sequences recited in the claims 7, and 12. Thus, it is clear that the breadth of the claimed genus overreaches the Applicant’s contribution.
In the absence of a representative number of examples, the specification must at least describe the structural features that are required for the claim function. In the instant case, the specification should explain the structure of the variant immunogenic peptide SEQ ID NO: 11 the non-elected sequences recited in claims 7, and 12 that is required to induce protective immune response. However, the specification fails to describe any substantive structural limitations as to establish the criteria necessary to select the peptide that is intended to induce protective anti-coronavirus immune response.
The disclosure of an antigen fully characterized by its structure, formula, chemical name, physical properties, or deposit in a public depository does not, without more, provide an adequate written description of an antibody claimed by its binding affinity to that antigen, even when preparation of such an antibody is routine and conventional. Describing a composition by its function alone typically will not suffice to sufficiently describe the composition. See Eli Lilly, 119 F.3 at 1568, 43 USPQ2d at 1406 (Holding that description of a gene’s function will not enable claims to the gene "because it is only an indication of what the gene does, rather than what it is."); see also Fiers, 984 F.2d at 1169-71, 25 USPQ2d at 1605-06 (discussing Amgen Inc. v. Chugai Pharm. Co., 927 F.2d 1200, 18 USPQ2d 1016 (Fed. Cir. 1991)). An adequate written description of a chemical invention also requires a precise definition, such as by structure, formula, chemical name, or physical properties, and not merely a wish or plan for obtaining the chemical invention claimed. See Univ. of Rochester v. G.D. Searle & Co., 358 F.3d 916, 927, 69 USPQ2d 1886, 1894-95 (Fed. Cir. 2004). See MPEP 216.
One having ordinary skill in art cannot determine the structures encompassed by the claimed genus. Overall, the claims as currently written are not adequately described and one of ordinary skills in that art would have readily appreciated that Applicant was not in possession of the claimed genus at the time of filing.
"The purpose of [the written description requirement] is to ensure that the scope of the right to exclude, as set forth in the claims, does not overreach the scope of the inventor’s contribution to the field of art as described in the patent specification"); LizardTech Inc. v. Earth Resource Mapping Inc., 424 F.3d 1336, 1345, 76 USPQ2d 1724, 1732 (Fed. Cir. 2005). This requirement is separate and distinct from the enablement requirement. To satisfy the written description requirement for a claimed genus, the specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention at the time of filing. See In re Reiffin v. Microsoft Corp., 214 F.3d 1342, 1345, 54 USPQ2d 1915, 1917 (Fed. Cir. 2000). “Even if a claim is supported by the specification, the language of the specification, to the extent possible, must describe the claimed invention so that one skilled in the art can recognize what is claimed. The appearance of mere indistinct words in a specification or a claim, even an original claim, does not necessarily satisfy that requirement.” See In re Enzo Biochem, Inc. v. Gen–Probe, Inc., 323 F.3d 956, 968, 63 USPQ2d 1609, 1616 (Fed. Cir. 2002). See also MPEP § 2163.
The written description requirement may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See In re University of California v. Eli Lilly & Co., 119 F.3d 1559, 1566, 43 USPQ2d 1398, 1404 (Fed. Cir. 1997); and Juno Therapeutics, Inc. v. Kite Pharma, Inc., 10 F.4th 1330, 1337, 2021 USPQ2d 893 (Fed. Cir. 2021).
A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, the applicant must describe a sufficient variety of species to reflect the variation within the genus. See In re AbbVie Deutschland GMBH v. Janssen Biotech, 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014). The disclosure of only one species encompassed within a genus adequately describes a claim directed to that genus only if the disclosure "indicates that the patentee has invented species sufficient to constitute the gen[us]." See In re Enzo Biochem, 323 F.3d at 966, 63 USPQ2d at 1615; Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004). "A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed." See In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004).
The Federal Circuit has clarified the application of the written description requirement to inventions in the field of biotechnology. The Court stated that a written description of an invention requires a precise definition, one that defines the structural features of the chemical genus that distinguishes it from other chemical structures. A definition by function does not suffice to define the genus because it is only an indication of what the genus does, rather than what it is. This is because functionally defined genus claims can be inherently vulnerable to invalidity challenge for lack of written description support, especially in technology fields that are highly unpredictable, where it is difficult to establish a correlation between structure and function for the whole genus or to predict what would be covered by the functionally claimed genus. Further, the Court held that to adequately describe a claimed genus, an applicant must describe a representative number of species of the claimed genus, and that one of skill in the art should be able to “visualize or recognize the identity of the members of the genus.” The description needed to satisfy the written description varies depending on the nature and scope of the claims and on the complexity and predictability of the relevant technology. See In re University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568, 43 USPQ2d 1398, 1406 (Fed. Cir. 1997); In re AbbVie Deutschland GMBH v. Janssen Biotech, 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014); In re Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 94 USPQ2d 1161 (Fed. Cir. 2010); and In re Capon v. Eshhar, 418 F.3d at 1357, 76 USPQ2d at 1084.
The legal standard for sufficiency of a patent's (or a specification’s) written description is whether that description "reasonably conveys to the artisan that the inventor had possession at that time of the claimed subject matter", Vas-Cath, Inc. v. Mahurkar, 19 USPQ2d 1111 (Fed. Cir. 1991). In the instant case, the specification does not convey to the artisan that the applicant had possession at the time of invention of the claimed invention. The full breadth of the claims does not meet the written description provision of 35 U.S.C. 112, first paragraph.
Examiners suggestion: The applicant may narrow the claim to the specific sequence species represented by searchable SEQ ID NO so that the scope of the claim is commensurate with the support in the instant specification (e.g. 100% identity to the elected SEQ ID NO: 11 or 100% identity to other non-elected SEQ ID NOs as recited in the claim. The recited SEQ ID are free of prior art for 100% identity).
Claim Rejections - 35 USC § 112 (Scope of Enablement)
12. Claims 1-2, 4-12, 14-16, and 27-28 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for 100% identity of the elected claimed sequences to the SEQ ID NO: 11 or non-elected sequences (as recited in claims 7 and 12), does not reasonably provide enablement for variant sequences (claims 7 and 12). The instant claim 1 comprises a genus of an immunogenic peptide (see, written description above) that comprises numerous unclaimed species (species comprising sequences of immunogenic peptide). One of the ordinary skills cannot envision all the species comprised in the genus other than the species with a defined specific sequence (SEQ ID NO) recited in the instant claims or the instant specification. Therefore, the instant specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
The specification does not reasonably provide enablement for the entire genus of an immunogenic peptide that can comprise numerous unclaimed species in instant claims 1 or variant species as claimed in instant claim 7. In view of the specification reciting to a variant species the instant claim 12 can also encompass variant species of the sequences (se, written description above). Because claim 1 inherently comprise a functional limitation of induction of immune response because of a genus “an immunogenic peptide”. Under BRI the variation can comprise substitutions (claim 7, nucleotide or amino acids). The claimed variant nucleotide or peptide sequence can comprise deletion or insertion or substitution in the sequences that can affect the B and T cell epitopes and thus can affect protective immune response (humoral and cellular) against a coronavirus (see claim 8).
In order to determine compliance with the enablement requirement of 35 U.S.C. 112(a), the Federal Circuit has developed a framework of factors in In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988), referred to as the Wands factors, to assess whether any necessary experimentation required by the specification is "reasonable" or is "undue." The factors considered include, but are not limited to: (A) the breadth of the claims; (B) the nature of the invention; (C) the state of the prior art; (D) the level of one of ordinary skill in the art; (E) the level of predictability in the art; (F) the amount of direction provided by the inventor; (G) the existence of working examples; and (H) the quantity of experimentation needed to make or use the invention based on the content of the disclosure.
Breadth of the claims and nature of the invention: Claim 1 is drawn to an immunogenic peptide of a coronavirus that is a broad genus. The dependent claims 7 is drawn to a variant immunogenic protein of a coronavirus. In view of the specification the claim 1 and claim 12 can comprise variant immunogenic peptides. According to the specification (see, page 19 and 28), the sequences recited in claim 7 SEQ ID NOs: 1 and 13 can comprise variants with a large degree of variation and thus comprise a broad genus comprising a large number of species of variant sequences and thus the claims are very broad. The dependent claims 10-11 inherit the limitations of base claim 1. The claims are intended and directed to a functional limitation of induction of protective immune response against a coronavirus and in dependent claims against SARS-CoV-2.
The level of one of ordinary skills in the art: The required level of skills in art is that of Ph.D. level scientists and medical doctors (D.O. and/or M.D.).
Amount of direction and existence of working examples: The instant application does not provide guidance on at what position the variation in the immunogenic peptide is and what amino acids are substituted or deleted or inserted. The specification does not represent even one working example of an immunogenic peptide comprising variant sequences derived from elected species SEQ ID NO: 11 or non-elected species of SEQ ID NOs.
Working Example: The instant application does not represent even one working example comprising an immunogenic peptide comprising variant sequences derived from elected species SEQ ID NO: 11 or non-elected species of SEQ ID NOs reduced to practice inducing reasonably cross-protective immune response against a coronavirus or SARS-CoV-2. The instant disclosure does not offers reasonable guidance or direction.
State of the prior art and unpredictability in the art: The prior art Meinke et al 2021 (WO2021176434A1) teaches a single species of variant species of SEQ ID NO: 1, and Peiris et al 2009 (US7547512B2) teaches SEQ ID NOs: 2-3, 5, 7, 9 and 11 a single species of variant immunogenic peptide for each sequence. Numerous species of the claimed genus are not taught by the prior art, and thus entire genus is not enabled.
It is not clear to one of the ordinary skills which variations in the elected SEQ ID NOs: 11 sequence or non-elected sequences of claim 7 and claim 12 are claimed. How the mutations/variations could affect/influence induction of a cross-protective immune response against a coronavirus or SARS-CoV-2 coronavirus after immunization/vaccination with the claimed variant immunogenic peptide and thus there is unpredictability in the art.
Quantity of experimentation needed: At a minimum the art teaches that a skilled artisan would consider the predictive function of a variant sequence derived from SEQ ID NOs: 11 (elected species). Thus, one of skills in the art would neither expect nor predict the appropriate function of sequences with a large degree of variation (see, written description above) in the sequence of variant sequence as compared to the reference SEQ ID NO: 11 for induction of protective immune response. Any and all enablement of the claimed variants of SEQ ID NO: 11 variability in sequence must therefore come from the instant disclosure. The claims are clearly not enabled to their full scope. Moreover, the claims not containing elements critical or essential to the practice of the invention, such as specific amino acid residue variation as compared to the reference sequences SEQ ID NO: 11, are not enabled by the disclosure to induce cross-protective immune response against a coronavirus or SARS-CoV-2. Similarly, variants of non-elected sequences SEQ ID NO (claim 7 and 12) are not enabled. In this context, see, claims that contain materials demonstrated not to bind to the critical element of the invention are also not enabled by the disclosure. See In re Mayhew, 527 F.2d 1229, 188 USPQ 356 (CCPA 1976).
For the reasons discussed above, “unreasonable experimentation” is required to practice the claimed invention commensurate with the scope of the claims. Reasonable correlation must exist between the scope of the claims and scope of enablement set forth. It would take undue trials and errors to practice the claimed invention in view of the quantity of experimentation necessary, the limited working examples, the unpredictability of the art, the lack of sufficient guidance in the specification, and the breadth of the claims.
Therefore, the instant disclosure is not enabled for any variant of SEQ ID NOs: 11 (elected species) or non-elected sequence species in claims 7 and 12. As presently written the claims are enabled only for 100% identity to the claimed SEQ ID NOs.
Claim Interpretation
13. The claims in this application are given their broadest reasonable interpretation using the plain meaning of the claim language in light of the specification as it would be understood by one of ordinary skill in the art.
Claim 1. The instant claim 1 is directed to an immunogenic peptide comprising an epitope from a polypeptide encoded by an open reading frame (ORF) encoded by at least part of the reverse complement of the genome of a coronavirus. Under BRI the limitation an immunogenic peptide is interpreted to be any peptide that comprises any epitope that would induce immune response. The claimed immunogenic peptide is encoded by an ORF, of the reverse complement of the genome of a coronavirus, that is undefined for nucleotide sequence (structure) or the ORF not identified by any nucleotide sequence. The claimed an immunogenic peptide encoded by an ORF of the reverse complement of the genome of a coronavirus is a naturally occurring and is interpreted as a product as nature.
Claim 7. The immunogenic peptide of claim 1, wherein the ORF comprises the sequence of SEQ ID NO. 1 or a variant thereof encodes a polypeptide comprising the sequence of SEQ ID NO: 13 or a variant thereof.
Under BRI, the limitation variant thereof reads ona genus of variant sequences that comprise many species that are not defined for its sequences. A variation can comprise insertion, deletion or substitution in the sequence. Variant sequence reads on a fragment of sequence comprised in SEQ ID NO: 1. Instant specification page 28 recites that a variant of SEQ ID NO: 1 having at least 50% sequence identity thereto. In SEQ ID NO: 1 each n is independently selected from t and u. In one aspect, each n may, for example, be t. That is, all of the ns may be t. In another aspect, each n may, for example, be u. That is, all of the ns may be u. In a further aspect, some of the ns may be t and some of the ns may be u. That is, the sequence may contain a combination of t and u. The variant may, for example, have at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or 99% sequence identity to SEQ ID NO: 1.
Claim 12. The immunogenic peptide of claim 1, comprising one or more of the peptides set out in SEQ ID NOs: 2 to 12. The instant claim 12 inherits variant limitations from claim 1. The instant specification page 19 recites that a variant may, for example, have at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 900%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the relevant sequence selected from SEQ ID NOs: 2 to 12. Under BRI in light of instant specification the variant sequences read on fragments of sequences. The phrase, “set out in” is interpreted as “consisting of”.
Claim Rejections - 35 USC § 101
14. 35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-2, and 4-12 are rejected under 35 U.S.C. 101 because according to the broadest reasonable interpretation (BRI) in view of the instant specification (see, page 23), the claim 1 (and dependent claims 2 and 4-12) are interpreted to be directed to a product of nature, an immunogenic peptide comprising an epitope from a polypeptide encoded by an open reading frame (ORF) encoded by at least part of the reverse complement of the genome of a coronavirus, that is naturally derived a coronavirus. The claimed genus of immunogenic peptide is also interpreted to comprise sequence variations due to natural diversity and evolution of a coronavirus and thus naturally give rise to variant species of the claimed immunogenic peptide.
Step 1: According to MPEP § 2106, the claimed invention must be to one of the four statutory categories. According to 35 U.S.C. 101 the eligibility test, the claim 1 (and dependent claims 2 and 4-14) are directed to a statutory category, e.g. composition of matter (the claimed peptide has a function of inducing an immune response (immunogenic), therefore, statutory category eligibility, Step 1: Yes.
Step 2: As described in the instant specification (see, page 24: “natural epitopes”) and the prior art Philip et al 2019 (WO2019220150A1, 11/21/2019), Meinke et al 2021 (WO2021176434A1), and Peiris et al 2009 (US7547512B2) recited below under 35 U.S.C. 102 and 103 rejections and does not have markedly different characteristics or function from what exist in nature or human, and thus is “a product of nature” exception. The epitopes are naturally presented epitopes encoded by the ORF (see, page 24 of specification).
Step 2A: Prong 1- Yes : claim 1 (and dependent claims 2, and 4-12 ) recite a “judicial exception” a product of nature.
The claim 1 (and dependent claims 2-12) fails to integrate (e.g. composition of matter-the claimed neutralizing antibody with a function of neutralizing a SARS-CoV-2 virus the judicial exception into a practical application (e.g method of treatment, diagnostic assay or purification) or contain additional elements that result in a “markedly different” antibody as compared to the natural counterpart, Step 2A: Prong 2-No.
The claim 1 (and dependent claims 2, and 4-12) does/do not include additional elements that are sufficient to amount to significantly more to the claimed composition of matter of the claimed immunogenic peptide and variants encoded by ORF sequence on a reverse complement genome sequence of a coronavirus (a genus) (than the judicial exception because the claims recite immunogenic peptide and variants encoded by ORF sequence on a reverse complement genome sequence of a coronavirus (a genus), as to constitute an “inventive concept” (e.g. improvement) Step 2B: No.
As described in the prior art Philip et al 2019 (WO2019220150A1, 11/21/2019), Meinke et al 2021 (WO2021176434A1), and Peiris et al 2009 (US7547512B2) recited below under 35 U.S.C. 102 and 103 rejections.
Thus, the claim 1 (and dependent claims 2 and 4-12) are rejected under 35 U.S.C. 101 as the claimed antibody is a product of nature without modification of the sequence and the claims are directed to a genus of the claimed immunogenic peptide and variants encoded by ORF sequence on a reverse complement genome sequence of a coronavirus (a genus) as recited supra, and because the claim does not include any additional features that could add significantly more to the exception.
See, MPEP 2106. Alice Corp. Pty. Ltd. v. CLS Bank Int'l, 573 U.S. 208, 216, 110 USPQ2d 1976, 1980 (2014) (citing Ass'n for Molecular Pathology v. Myriad Genetics, Inc., 569 U.S. 576, 589, 106 USPQ2d 1972, 1979 (2013).
Examiner’s suggestion: The Applicant may amend claim 1 to an engineered immunogenic peptide or an immunogenic fusion peptide. The Applicant would be required to indicate support in the specification commensurate with amendment to the claim.
Claim Rejections - 35 USC § 102
15. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-2, 8, 14-16, and 27-28 are rejected under 35 U.S.C. 102(a)(1)/(a)(2) as being anticipated by Philip et al 2019 (WO2019220150A1, 11/21/2019).
Claim 1: Philip et al 2019 anticipated instant claim 1 an immunogenic peptide comprising an epitope from a polypeptide encoded by an open reading frame (ORF) encoded by at least part of the reverse complement of the genome of a coronavirus (See, claims 1-3, abstract). Similarly, the RNA complementary to the genome of positive sense ssRNA viruses may actually be translatable is disclosed (see, page 7 lines 14-15). Reverse peptide vaccines (reads on immunogenic peptide) are disclosed (see, page 6-7). The ssRNA virus Coronavirus is disclosed (family Coronaviridae, see page 21 line 6).
Claim 2. Philip et al 2019 anticipated instant claim 2 the immunogenic peptide of claim 1, wherein the polypeptide enhances the fitness of the coronavirus in humans (see, claim 5). The polypeptide encoded by the ORF may enhance the fitness of the ssRNA virus in humans (see, page 6, lines 18-24). The ssRNA virus Coronavirus is disclosed (family Coronaviridae, see page 21 line 6).
Claim 8. Philip et al 2019 anticipated instant claim 8, the immunogenic peptide of claim 1, wherein the epitope is a CD8+ T cell epitope, a CD4+ T cell epitope, or a B cell epitope (see, claims 1, and 35).
Claim 14. Philip et al 2019 anticipated instant claim 14, a pharmaceutical composition comprising the immunogenic peptide of claim 1, or a polynucleotide encoding the immunogenic peptide of claim 1 (see, page 51, lines 16-18).
Claim 15. Philip et al 2019 anticipated instant claim 15, the pharmaceutical composition of claim 14, which comprises: (a) two or more immunogenic peptides, optionally wherein the two or more immunogenic peptides are immunogenic peptides according to claim 1; or (b) two or more polynucleotides, optionally wherein the two or more polynucleotides are polynucleotides encoding an immunogenic peptide according to claim 1 (see, claims 2-3, page 51, lines 16-18).
Claim 16. Philip et al 2019 anticipated instant claim 16, the pharmaceutical composition of claim 14, which comprises: (a) at least one immunogenic peptide that interacts with at least two different HLA supertypes, or at least two immunogenic peptides that each interact with a different HLA supertype; or (b) at least one polynucleotide that encodes an immunogenic peptide that interacts with at least two different HLA supertypes, or at least two polynucleotides that each encode a different immunogenic peptide wherein each immunogenic peptide interacts with a different HLA supertype (see, page 51, lines 16-18, claim 4).
Claim 27. Philip et al 2019 anticipated instant claim 27, the pharmaceutical composition of claim 14, wherein the immunogenic peptide is attached to a gold nanoparticle (see, page 6 lines 25-30).
Claim 28. Philip et al 2019 anticipated instant claim 28, the pharmaceutical composition of claim 27, wherein the gold nanoparticle is coated with alpha-galactose (see, page 48 lines 30-34, page 49 lines 1-3).
Claim Rejections - 35 USC § 103
16. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
17. Claims 4-7 are rejected under 35 U.S.C. 103 as being unpatentable over Philip et al 2019 (WO2019220150A1, 11/21/2019) as applied to claims 1-2, 8, 14-16, and 27-28 above and further in view of Meinke et al 2021 (WO2021176434A1, 09/10/2021, with an earlier priority to US 62/983,737 filed on 03/01/2020).
The disclosures of Philip et al 2019 (WO2019220150A1) that anticipated claims 1-2, 8, 14-16, and 27-28 as per the disclosures as recited supra are incorporated here in entirety to render the claims obvious.
Philip et al 2019 does not teach limitations of claims 4-7 comprising SARS-CoV-2.
Claims 4-7: Meinke et al 2021 teaches SARS-CoV-2 protein, RNA and DNA vaccines (See, abstract, claims 15-16, 25-27).
Meinke et al 2021 taught claim 6 limitation by disclosing SARS CoV-2 ORF1ab sequence that has 303 nucleotides (101 codons) sequence (SEQ ID NO: 26) that has 100% query match to the instant SEQ ID NO: 1 and can be interpreted 100% identity match under BRI of the instant claim 7 limitation “a variant thereof” because under BRI the “N” in the claimed instant SEQ ID NO: 1 can comprise A or T or C or G base, as recited below.
Meinke et al 2021 taught claim 7 limitation the SEQ ID NO: 1 that has 100% identity with the prior art SEQ ID NO: 26, because under BRI it is interpreted that “N” = A/T/G/C. In addition, under BRI of the instant claim 7 limitation “a variant thereof” the “N” in the claimed instant SEQ ID NO: 1 can comprise A or T or C or G base.
Query Match 100.0%; Score 303; Length 29816;
Best Local Similarity 64.7%;
Matches 196; Conservative 107; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ANGNCNCCNACAACNNCGGNAGNNNNCACANNACACNCAAGAACGNCNNNCNGNANGGNA 60
|:|:|:||:|||||::|||:||::::||||::||||:||||||||:|:::|:|:|:||:|
Db 6451 ATGTCTCCTACAACTTCGGTAGTTTTCACATTACACTCAAGAACGTCTTTCTGTATGGTA 6392
Qy 61 GGANNNNCCACNACNNCNNCAGAGACNGGNNNNAGANCNNCGCAGGCAAGANNANCCANN 120
|||::::||||:||::|::|||||||:||::::|||:|::|||||||||||::|:|||::
Db 6391 GGATTTTCCACTACTTCTTCAGAGACTGGTTTTAGATCTTCGCAGGCAAGATTATCCATT 6332
Qy 121 CCCNGCGCGNCCNCNGACNNCAGNACANCAAACGAANNNGANGNNNCAACNGGNNNNGNG 180
|||:|||||:||:|:|||::|||:|||:||||||||:::||:|:::||||:||::::|:|
Db 6331 CCCTGCGCGTCCTCTGACTTCAGTACATCAAACGAATTTGATGTTTCAACTGGTTTTGTG 6272
Qy 181 CNCCAAAGACAACGNANACACCAGGNANNNGGNNNANACGNGGCNNNANNAGNNGCANNG 240
|:||||||||||||:|:||||||||:|:::||:::|:|||:|||:::|::||::|||::|
Db 6271 CTCCAAAGACAACGTATACACCAGGTATTTGGTTTATACGTGGCTTTATTAGTTGCATTG 6212
Qy 241 NNAACANGCCAAACAANAGGNNNANGNAACAANNNAGCNCCNNNCNNAAAAGAGGGNGNG 300
::||||:|||||||||:|||:::|:|:|||||:::|||:||:::|::|||||||||:|:|
Db 6211 TTAACATGCCAAACAATAGGTTTATGTAACAATTTAGCTCCTTTCTTAAAAGAGGGTGTG 6152
Qy 301 NAG 303
:||
Db 6151 TAG 6149
It would have been obvious to one of the ordinary skills before the effective filing date of the claimed invention to modify the prior art teachings of Philip et al 2019 with additional teachings of Meinke et al 2021 to incorporate the ORF sequence with 100% identity to the instant SEQ ID NO: 1 from SARS-CoV-2 to arrive at the inventions of claims 4-7 to obtain the immunogenic peptide encoded by instant SEQ ID NO: 1 to develop vaccine against SARS-CoV2 that induces cross reactive CD8+T and CD4+ B cell immune response for commercial success. There would have been a reasonable expectation of success to develop the composition comprising the immunogenic polypeptide encoded by the SARS CoV-2 ORF sequence that has 100% identity to SEQ ID NO: 1. The motivation would be to develop an efficacious cross reactive CD8+T and CD4+ B cell immune response inducing vaccine for commercial success. This is analogous to some teaching, suggestions, or motivation in prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention as claimed in claims 4-7. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A-G).
18. Claims 9-11 are rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Philip et al 2019 (WO2019220150A1, 11/21/2019) as applied to claims 1-2, 8, 14-16, and 27-28 above and further in view of Sarkar et al 2021 (Infection, Genetics and Evolution, 88, 104708).
The disclosures of Philip et al 2019 (WO2019220150A1) that anticipated claims 1-2, 8, 14-16, and 27-28 as per the disclosures as recited supra are incorporated here in entirety to render the claims obvious.
Philip et al 2019 does not teach limitations of claims 9-11 comprising cross reactive epitopes between coronaviruses SARS-CoV-1 and SARS-CoV-2.
However, Philip et al 2019 teaches methodology for identification of conserved and cross- reactive epitope in the ORF among human H1N1 influenza A viruses that teachings can be applied to the instant claims 9-11.
Sarkar et al 2021 teaches full length nucleotide sequences of SARS-CoV-2, SARS-CoV-1 and MERS-CoV (see, abstract, entire article).
It would have been obvious to one of the ordinary skills before the effective filing date of the claimed invention to modify the prior art teachings of Philip et al 2019 with additional teachings of Sarkar et al 2021 to identify the cross-reactive and conserved epitopes between SARS-CoV-2, SARS-CoV-1 and MERS-CoV using the sequences of Sarkar et al 2021 to arrive at the inventions of instant claims 9-11 to obtain the immunogenic peptide that are cross-reactive among the coronaviruses SARS-CoV-2, SARS-CoV-1 and MERS-CoV to develop an immunogenic peptide composition to induces cross reactive CD8+T and CD4+ B cell immune response for commercial success. There would have been a reasonable expectation of success to develop the claimed immunogenic peptide composition given the prior art teachings from art. The motivation would be to develop an efficacious cross reactive CD8+T and CD4+ B cell immune response inducing vaccine for cross-protection among the claimed coronaviruses SARS-CoV-2, SARS-CoV-1 and MERS-CoV to the extended limited to the disclosed species of sequences (not entire genus) and commercial success. This is analogous to some teaching, suggestions, or motivation in prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention as claimed in claims 9-11. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A-G).
19. Claim 12 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Philip et al 2019 (WO2019220150A1, 11/21/2019) as applied to claims 1-2, 8, 14-16, and 27-28 above and further in view of Peiris et al 2009 (US7547512B2, 06/16/2009).
Claim 12: The disclosures of Philip et al 2019 (WO2019220150A1) that anticipated claims 1-2, 8, 14-16, and 27-28 as per the disclosures as recited supra are incorporated here in entirety to render the claims obvious.
Philip et al 2019 does not teach limitations of claim 12 comprising the SEQ ID NOs: 2-12.
Under BRI the claim 12 comprises variant immunogenic peptide.
SEQ ID NO: 2. Peiris et al 2009 (US7547512B2, 06/16/2009) teaches SEQ ID NO: 1893 that has 73% identity with instant SEQ ID NO: 2.
ORGANISM: Human severe acute respiratory syndrome virus
Query Match 73.8%; Score 48; Length 68;
Best Local Similarity 75.0%;
Matches 9; Conservative 1; Mismatches 2; Indels 0; Gaps 0;
Qy 1 ALLTCQTIGLCN 12
| | |||||||:
Db 47 AWLMCQTIGLCS 58
SEQ ID NO: 3. Peiris et al 2009 (US7547512B2, 06/16/2009) teaches SEQ ID NO: 1892 that has 85.7% identity with instant SEQ ID NO: 3.
Query Match 85.7%; Score 60; Length 47;
Best Local Similarity 91.7%;
Matches 11; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 2 HSRTSFCMVGFS 13
|| |||||||||
Db 28 HSMTSFCMVGFS 39
SEQ ID NO: 5. Peiris et al 2009 (US7547512B2, 06/16/2009) teaches SEQ ID NO: 1893 that has 86.9% identity with instant SEQ ID NO: 5.
Query Match 86.9%; Score 73; Length 68;
Best Local Similarity 86.7%;
Matches 13; Conservative 1; Mismatches 1; Indels 0; Gaps 0;
Qy 1 LTCQTIGLCNNLAPF 15
| |||||||:|||||
Db 49 LMCQTIGLCSNLAPF 63
SEQ ID NO: 7. Peiris et al 2009 (US7547512B2, 06/16/2009) teaches SEQ ID NO: 23 that has 73.3% identity with instant SEQ ID NO: 7.
Query Match 73.3%; Score 44; Length 1240;
Best Local Similarity 70.0%;
Matches 7; Conservative 2; Mismatches 1; Indels 0; Gaps 0;
Qy 1 QTIGLCNNLA 10
||:| |||:|
Db 1176 QTVGWCNNIA 1185
SEQ ID NO: 9. Peiris et al 2009 (US7547512B2, 06/16/2009) teaches SEQ ID NO: 1893 that has 88.1% identity with instant SEQ ID NO: 9.
Query Match 88.1%; Score 74; Length 68;
Best Local Similarity 92.9%;
Matches 13; Conservative 1; Mismatches 0; Indels 0; Gaps 0;
Qy 2 CQTIGLCNNLAPFL 15
|||||||:||||||
Db 51 CQTIGLCSNLAPFL 64
SEQ ID NO: 10. Peiris et al 2009 (US7547512B2, 06/16/2009) teaches SEQ ID NO: 1892 that has 79.7% identity with instant SEQ ID NO: 10.
Query Match 79.7%; Score 47; Length 47;
Best Local Similarity 81.8%;
Matches 9; Conservative 0; Mismatches 2; Indels 0; Gaps 0;
Qy 1 TLHSRTSFCMV 11
| || ||||||
Db 26 TSHSMTSFCMV 36
SEQ ID NO: 11. Peiris et al 2009 (US7547512B2, 06/16/2009) SEQ ID NO 1893 with instant elected species SEQ ID NO: 11
Query Match 75.4%; Score 52; Length 68;
Best Local Similarity 76.9%;
Matches 10; Conservative 1; Mismatches 2; Indels 0; Gaps 0;
Qy 1 VALLTCQTIGLCN 13
|| | |||||||:
Db 46 VAWLMCQTIGLCS 58
It would have been obvious to one of the ordinary skills before the effective filing date of the claimed invention to modify the prior art teachings of Philip et al 2019 with additional teachings of Peiris et al 2009 to modify the composition of immunogenic peptide by incorporating variant sequences with identity to instant claimed SEQ ID NOs: 2-3, 5, 7, 9 and 11
to arrive at the inventions of instant claim 12 to obtain the immunogenic peptide composition that comprise more than one peptide for broad cross-reactive among the coronavirus strains to develop an immunogenic peptide composition to induce cross reactive CD8+T and CD4+ B cell immune response for commercial success. There would have been a reasonable expectation of success to develop the claimed immunogenic peptide composition given the prior art teachings from art. The motivation would be to develop an efficacious cross reactive CD8+T and CD4+ B cell immune response inducing vaccine for cross-protection among the coronavirus strains to the extended limited to the disclosed species of the sequences (not entire genus) and commercial success. This is analogous to some teaching, suggestions, or motivation in prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the invention as claimed in claim 12. See KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007) (see MPEP § 2143, example of rationales, A-G).
Examiners suggestion: The applicant may narrow the claim to the specific sequence species represented by searchable SEQ ID NO so that the scope of the claim is commensurate with the support in the instant specification (e.g. 100% identity to the elected SEQ ID NO: 11 or 100% identity to other non-elected SEQ ID NOs as recited in the claim. The recited SEQ ID are free of prior art for 100% identity).
20. Relevant Prior Art:
Nomburg, J., Meyerson, M. & DeCaprio, J.A. Pervasive generation of non-canonical subgenomic RNAs by SARS-CoV-2. Genome Med 12, 108 (2020).
Kim et al 2020. The Architecture of SARS-CoV-2 Transcriptome. Cell. 2020 May 14;181(4):914-921.e10.
Firth AE, Brierley I. Non-canonical translation in RNA viruses. J Gen Virol. 2012 Jul;93(Pt 7):1385-1409. doi: 10.1099/vir.0.042499-0.
Yoshimoto FK. The Proteins of Severe Acute Respiratory Syndrome Coronavirus-2 (SARS CoV-2 or n-COV19), the Cause of COVID-19. Protein J. 2020 Jun;39(3):198-216.
Conclusion
21. No claim is allowed.
22. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAMADHAN J JADHAO whose telephone number is (703)756-1223. The examiner can normally be reached M-F 8:00-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SAMADHAN JAISING JADHAO/Examiner, Art Unit 1672
/BENNETT M CELSA/Primary Examiner, Art Unit 1600
