DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This is a National Stage Entry under 35 U.S.C. 371 of International Patent Application
No. PCT/US2022/070732, filed February 18, 2022, which claims priority to
US 63/151462, filed February 19, 2021.
Claim Objections
Claim 1 is objected to because of the following informalities: the claim is numbered "1" twice. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 4 recites the limitation "the method of claim 4, wherein the dye is phenol red." Claim 4 does not identify “a” dye and therefor is insufficient antecedent basis for this limitation in the claim.
The examiner is interpreting claim 4 as “the method of claim 3, wherein the dye is phenol red.”
Claim 10 recites the limitation "A kit for the method of claim 1 comprising a reagent.” The specification refers to both “reaction reagents” and “detection reagents.” However, the term “reagent” alone fails to point out what is included or excluded, and can include any common buffer such as water or saline.
The examiner is interpreting “reagent” as any reagent typically used in LAMP assays.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claim 10 is rejected under 35 U.S.C. 101 because the claimed invention is directed to judicial exception without significantly more. This judicial exception is not integrated into a practical application and the claim does not include additional elements that are sufficient to amount to significantly more than the judicial exception because for the reasons set forth below. See MPEP § 2106 for analysis parameters.
The instant claims are drawn to a kit comprised of any reagent, which is a statutory category of invention, i.e., a composition of matter (Step 1: YES).
The instant claims are directed to a kit comprised of any reagent. Water is a commonly included reagent used in biomedical research. Water is found naturally on plants, as evidenced by McElrone et al. (Nature, 2013). Packaging water into a kit would not, absent evidence to the contrary, result in any markedly different characteristics with respect to structure, function, or any other property to distinguish the water from its naturally occurring counterpart. As such, claim 10, which can be comprised of only water, recites a judicial exception (JE) in the form of a natural phenomenon (STEP 2A, Prong One: YES).
The claims are limited to the JE. As such, the claim does not recite any additional elements that integrate the JE into a practical application (STEP 2A, Prong Two: NO).
Since the claim is limited to solely the JE, the claim does not recite any additional elements that amount to significantly more than the JE itself. (STEP2B: NO).
In view of the foregoing, the instant claims do not constitute patent eligible subject matter under 35 U.S.C 101.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim 10 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Tanner et al. (US 11008629 B1, hereinafter, “Tanner”).
Tanner discloses a LAMP assay kit comprised of a reagent (Col. 3, lines 21 – 25).
As such, Tanner anticipates the claimed invention.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1 - 3, 5, and 7 - 9 are rejected under 35 U.S.C. 103 as being unpatentable over Pauli et al. ( US 2021/0381039 A1, hereinafter, "Pauli").
Regarding claims 1 and 8, Pauli teaches the detection of Hops Latent Viroid (HpLVd) of cannabis plants using loop-mediated isothermal amplification (LAMP) (Page 34, ¶ 0288). Pauli also teaches primers with 100% similarity to SEQ ID NO: 2 and 3 (Pauli is “Db” in figure below).
Regarding claim 2, Pauli teaches crushing plant sample in extraction buffer using a DNeasy® Kit (Page 29, ¶ 0254).
Regarding claim 3 and claim 7, Pauli teaches a dye as a visual aid, with the resulting change being a fluorescent signal (Page 34, ¶ 0286).
Regarding claim 5, Pauli teaches contacting the processed plant sample with the detection reagents (Page 34, ¶ 0288).
Regarding claim 9, Pauli teaches conducting LAMP assays on leaf samples (Page 59, ¶ 0447).
In view of the foregoing, all the claimed limitations are found in one reference and are taught to be optional variations to a ‘base’ method they exemplify. As such, the claimed invention is within the scope of Pauli, and thus Pauli renders the invention prima facie obvious. The rationale to support this conclusion of obviousness is that Pauli provides a teaching, suggestion, and motivation to substitute different variables disclosed within the reference. Furthermore, there is no evidence on the record that indicates that the claimed supplement exhibits any unexpected results compared to the prior art.
[AltContent: textbox (SEQ ID NO: 2
Query Match 100.0%; Score 20; Length 22;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGGGAATACACTACGTGACT 20
||||||||||||||||||||
Db 3 GGGGAATACACTACGTGACT 22
SEQ ID NO: 3
Query Match 100.0%; Score 19; Length 19;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CCGGGTAGTTTCCAACTCC 19
|||||||||||||||||||
Db 1 CCGGGTAGTTTCCAACTCC 19)]Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Claims 4, 6, and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Pauli as applied to claims 1 - 3, 5, and 7 - 9 above, and further in view of Tanner.
As discussed above, claims 1 – 3, 5, and 7 – 9 were rendered prima facie obvious by the teachings of Pauli.
The reference fails to teach a phenol red dye, freeze-dried reaction beads, and a kit comprising a reagent.
However, regarding claims 4 and 10, Tanner teaches a LAMP assay kit with a phenol red dye to visually inspect total nucleic acid amount (Col. 2, lines 6 – 19) and freeze-dried reaction beads (Col. 3, lines 21 – 25).
Pauli and Tanner are considered to be analogous to the claim invention because they are in the same field of using LAMP to detect the presence of nucleic acids. Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to utilize the product taught by Tanner in the method taught by Pauli because doing so would advantageously detection of HpLVd quickly in a cost-effective manner using a phenol red based LAMP assay. One of ordinary skill in the art would have had a reasonable expectation of success of using phenol red along with a freeze-dried master mix of LAMP assay reagents to detect HpLVd from cannabis plants given that this method and these reagents were well known, have been successfully demonstrated, and commonly used as evidence by the prior art.
Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary.
Conclusion
NO CLAIMS ARE ALLOWED
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Danyal H Alam whose telephone number is (571)272-1102. The examiner can normally be reached M - F 9am - 5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J. Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DANYAL HASSAN ALAM/Examiner, Art Unit 1672
/THOMAS J. VISONE/Supervisory Patent Examiner, Art Unit 1672