Prosecution Insights
Last updated: April 19, 2026
Application No. 18/547,428

LOSS-OF-FUNCTION TRANSCRIPTION FACTOR-LIKE GENE AND SELF-PROPAGATING FAGOPYRUM PLANT USING SAME

Non-Final OA §102§103§112
Filed
Aug 22, 2023
Examiner
MEADOWS, CHRISTINA L
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Nissey Delica Corp.
OA Round
1 (Non-Final)
73%
Grant Probability
Favorable
1-2
OA Rounds
2y 10m
To Grant
99%
With Interview

Examiner Intelligence

Grants 73% — above average
73%
Career Allow Rate
43 granted / 59 resolved
+12.9% vs TC avg
Strong +26% interview lift
Without
With
+26.2%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
34 currently pending
Career history
93
Total Applications
across all art units

Statute-Specific Performance

§101
8.8%
-31.2% vs TC avg
§103
27.2%
-12.8% vs TC avg
§102
16.2%
-23.8% vs TC avg
§112
42.0%
+2.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 59 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of Claims Claims 1-6 are pending. Claims 1-6 are examined in this Office action. Priority Acknowledgment is made of applicant's claim for foreign priority based on an application filed in Japan on 02/22/2021. It is noted, however, that applicant has not filed a certified copy, in English, of the JP2021-026492 application as required by 37 CFR 1.55. Failure to provide a certified translation may result in no benefit being accorded for the non- English application. Information Disclosure Statement Initialed and dated copy of Applicant’s information disclosure statement (IDS) filed on 11/06/2023 is attached to the instant Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Nucleotide and/or Amino Acid Sequence Disclosures Specific deficiency - Sequences appearing in the specification are not identified by sequence identifiers (i.e., “SEQ ID NO:X” or the like) in accordance with 37 CFR 1.831(c) (see instant Specification at page 8, paragraph 0025; and page 11, paragraph 0035). Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers, consisting of: • A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); • A copy of the amended specification without markings (clean version); and • A statement that the substitute specification contains no new matter. Specific deficiency - Sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.831(c). Sequence identifiers for sequences (i.e., “SEQ ID NO:X” or the like) must appear either in the drawings or in the Brief Description of the Drawings (see Figures 1-10). Required response – Applicant must provide: Amended drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers (i.e., “SEQ ID NO:X” or the like) into the Brief Description of the Drawings, consisting of: • A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); • A copy of the amended specification without markings (clean version); and • A statement that the substitute specification contains no new matter. Specification The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01 (see page 3, paragraph 0009). The use of the terms Nextera XT, Hiseq X, and Varscan (see page 9, lines 1, 2, and 11, respectively) which are trade names or marks used in commerce, has been noted in this application. The terms should be accompanied by the generic terminology; furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the terms. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Objections Claims 2 and 3 are objected to because of the following informalities: in regard to claim 2, the full name of the S-ELF3 gene should be written out the first time it is used in a claim; in regard to claim 3, the full name of the S-ELF3-PS1 gene should be written out the first time it is used in a claim. Appropriate correction is required. Claim Interpretation The S-ELF3 gene recited in claim 2 will be interpreted as SEQ ID NO: 1 in the Sequence Listing file; the S-ELF3-PS1 gene recited in claim 3 will be interpreted as SEQ ID NO: 2 in the Sequence Listing file. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Indefiniteness Claims 1-6 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. All dependent claims are included in these rejections unless they include a limitation that overcomes the deficiencies of the parent claim. Claims 1-6 are rendered indefinite for the recitation of “transcription factor-like”. The term “transcription factor-like” is not defined by the claim or in the instant Specification. One of ordinary skill in the art will recognize a transcription factor gene as a gene encoding a protein that regulates the transcription of other genes by binding to specific DNA sequences. However, it is unclear what makes a gene “transcription factor-like”. What are the differences and similarities between a transcription factor gene and a “transcription factor-like” gene? A review of the instant specification shows no express definition for the term “transcription factor-like”. Additionally, a review of the prior art shows that the term “transcription factor-like” is not a well-recognized term as it relates to Fagopyrum stamen and pistil length control. Written Description Claim 1 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. All dependent claims are included in these rejections unless they include a limitation that overcomes the deficiencies of the parent claim. Claim 1 recites “[a] loss-of-function transcription factor-like gene produced by: identifying a transcription factor-like gene formed by a linked gene group that controls lengths of stamen and pistil of a Fagopyrum plant from mapping results of a genomic sequence of the Fagopyrum plant; and allowing the transcription factor-like gene thus identified to lose a function by mutagenesis”. Claim 1 is broadly drawn to any transcription factor-like gene associated with the control of the lengths of the stamen and pistil of a Fagopyrum plant. Applicant has described one transcription factor-like gene associated with the control of the lengths of the stamen and pistil of a Fagopyrum plant – transcription factor-like gene S-ELF3 represented by instant SEQ ID NO: 1. Applicant has not described any other transcription factor-like gene associated with the control of the lengths of the stamen and pistil of a Fagopyrum plant. YASUI (Yasui et al., 2012, PLOS One, Vol. 7(2), pp. 1-9; included on IDS dated 11/06/2023) describes S-ELF3 as the most promising candidate gene for controlling heteromorphic self-incompatibility (SI) in buckwheat. The presence of a functional S-ELF3 gene is found only in the S haplotype (self-compatible); and, floral organ-specific expression of S-ELF3 suggests that it has an important role for the formation of the S phenotype. Specifically, expression of S-ELF3 before flowering raised the possibility that S-ELF3 is involved in the development of pistils and stamens of short-styled flowers (Yasui, 2012, page 6, left column, first paragraph). Thus, the prior art does not disclose any transcription factor-like gene associated with the control of the lengths of the stamen and pistil of a Fagopyrum plant other than S-ELF3 (instant SEQ ID NO: 1). The instant claims encompass a large genera of transcription factor-like genes, and the Applicant has only reduced to practice the transcription factor-like gene S-ELF3 (SEQ ID NO: 1), which is associated with the control of the lengths of the stamen and pistil of a Fagopyrum plant. Given that there have not been an adequate number of species reduced to practice to be representative of the broad genera of claimed transcription factor-like genes, and there is no description of structures that are correlated with the required function, there is not an adequate written description to support the breadth of the claims. Scope of Enablement Claim 1 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for transcription factor-like gene S-ELF3 represented by instant SEQ ID NO: 1 associated with the control of the lengths of the stamen and pistil of a Fagopyrum plant, does not reasonably provide enablement for all possible transcription factor-like genes associated with the control of the lengths of the stamen and pistil of a Fagopyrum plant. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. All dependent claims are included in these rejections unless they include a limitation that overcomes the deficiencies of the parent claim. The instant Specification does not describe any transcription factor-like gene associated with the control of the lengths of the stamen and pistil of a Fagopyrum plant other than S-ELF3 (SEQ ID NO: 1). In the instant case, the specification does not provide sufficient guidance with respect to how to identify and alter any other transcription factor-like gene associated with the control of the lengths of the stamen and pistil of a Fagopyrum plant other than S-ELF3 (SEQ ID NO: 1). Absent such guidance one skilled in the art would have to search the genomic sequence of the Fagopyrum plant to identify other possible transcription factor-like genes associated with the control of the lengths of the stamen and pistil, and make each of the loss-of-function transcription factor-like genes, and then test the ability of each transcription factor-like variant to control of the lengths of the stamen and pistil, in order to determine whether and how a transcription factor-like variant can be used as a loss-of-function transcription factor-like gene associated with the control of the lengths of the stamen and pistil of a Fagopyrum plant. Such a trial-and-error approach to practicing the claimed invention would constitute undue experimentation. Claim Rejections - 35 USC § 102/103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-3 and 5 are rejected under 35 U.S.C. 102(a)(1) as anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over YASUI (Yasui et al., International Publication Number WO 2013/047736 A1, International Publication Date 04/04/2013). Claim 1 recites “[a] loss-of-function transcription factor-like gene produced by: identifying a transcription factor-like gene formed by a linked gene group that controls lengths of stamen and pistil of a Fagopyrum plant from mapping results of a genomic sequence of the Fagopyrum plant; and allowing the transcription factor-like gene thus identified to lose a function by mutagenesis”. In regard to claim 1, Yasui (2013) teaches and claims a nucleic acid comprising a nucleotide sequence encoding a self-incompatibility regulation factor; a nucleic acid comprising a mutant gene in which a loss-of-function mutation is introduced into a gene encoding a self-incompatibility regulator contained in the nucleic acid; said mutation is introduced via ethyl methanesulfonate; and a self-incompatible plant belonging to the genus Fagopyrum (i.e., a loss-of-function transcription factor-like gene; a Fagopyrum plant; allowing the transcription factor-like gene to lose a function by mutagenesis) (Yasui 2013, Abstract; claims 1 and 2; paragraph 0049). In regard to claim 2, Yasui (2013) teaches SSC7 (SEQ ID NO: 3), a base sequence of chromosomal DNA encoding a normal buckwheat self-incompatibility control factor, which shares 100% sequence identity with instant sequence SEQ ID NO: 1 (see alignment below). YASUI 2013 SSC7 GENE (SEQ ID NO: 3) ALIGNED WITH INSTANT S-ELF3 GENE (SEQ ID NO: 1) Qy 1 ATGAGGTGGGTTTTATTGCCTGTTACATTGCCTAGTTGAAAAAGGGTCACTTTGTATTTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 80 ATGAGGTGGGTTTTATTGCCTGTTACATTGCCTAGTTGAAAAAGGGTCACTTTGTATTTT 139 Qy 61 CTTTGCAAAATTTGTCTTTATAAGGTTGCTGAATGTTGGTCCTGCTAATTTGACTGTGCT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 140 CTTTGCAAAATTTGTCTTTATAAGGTTGCTGAATGTTGGTCCTGCTAATTTGACTGTGCT 199 Qy 121 GCAGGAATTGGATGATTATGGGTGTTATAGTTTTTTCAAACACTTGAGTAGAAAATTTAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 200 GCAGGAATTGGATGATTATGGGTGTTATAGTTTTTTCAAACACTTGAGTAGAAAATTTAG 259 Qy 181 GCCTCAATCTAATACATTTTGGTGGGGGTTATCAGATTTGAGTTCAATTGCAATTTTATC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 260 GCCTCAATCTAATACATTTTGGTGGGGGTTATCAGATTTGAGTTCAATTGCAATTTTATC 319 Qy 241 CACTTTTTATCTTCCTTCTGCTGTAAAAACTGATGTTTTCTAAAATTGGGTTCTAGTTAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 320 CACTTTTTATCTTCCTTCTGCTGTAAAAACTGATGTTTTCTAAAATTGGGTTCTAGTTAT 379 Qy 301 ATGTCCTAATTTGAAAGTTTAAGTGGCTGAAGAGTTTGAGTCAATAGTAGAATGGAACCT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 380 ATGTCCTAATTTGAAAGTTTAAGTGGCTGAAGAGTTTGAGTCAATAGTAGAATGGAACCT 439 Qy 361 CTGTTTACTAGGTTGCATCTGAAAACTACCGAGAAAGGAGGGCCAAAGCCGCCTCCCAGA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 440 CTGTTTACTAGGTTGCATCTGAAAACTACCGAGAAAGGAGGGCCAAAGCCGCCTCCCAGA 499 Qy 421 AACAAAATGGCTGTTCATGAAGAGCCTATTGCTTCCTCTAGTAGGTTCAGCAATGGATCA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 500 AACAAAATGGCTGTTCATGAAGAGCCTATTGCTTCCTCTAGTAGGTTCAGCAATGGATCA 559 Qy 481 ATAACCATGATGCAACTTCATCCTATTGGCGGTGTGCCGATCTCACAAGTGGGTTCTTCA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 560 ATAACCATGATGCAACTTCATCCTATTGGCGGTGTGCCGATCTCACAAGTGGGTTCTTCA 619 Qy 541 CAACAGGCCAGTTTCGTACATTTTATTCACTTTTTTCTTGTGCTTCCTAGCATATGGATT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 620 CAACAGGCCAGTTTCGTACATTTTATTCACTTTTTTCTTGTGCTTCCTAGCATATGGATT 679 Qy 601 TGAAGCTTCTGCTTGTACTTGATAAATGCTCTTCATTGTTAATGTGTTCATATTTGTATC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 680 TGAAGCTTCTGCTTGTACTTGATAAATGCTCTTCATTGTTAATGTGTTCATATTTGTATC 739 Qy 661 TTTATTTTTTGTACATATCATCTTATACTGTTTTATTCAAGTGCTATTTCTGATATATAT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 740 TTTATTTTTTGTACATATCATCTTATACTGTTTTATTCAAGTGCTATTTCTGATATATAT 799 Qy 721 GGACTTCAAAAAATGTGTTACACTCTCCTTAAATGTTTAAACTAACAGTTAGTTTTGCAT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 800 GGACTTCAAAAAATGTGTTACACTCTCCTTAAATGTTTAAACTAACAGTTAGTTTTGCAT 859 Qy 781 GCTTTTTAAGGATCATCTTTTCTTGTCTGTCAATTTTATCAGATTTTTATGGATAAAAAT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 860 GCTTTTTAAGGATCATCTTTTCTTGTCTGTCAATTTTATCAGATTTTTATGGATAAAAAT 919 Qy 841 GTGAAATTACTTCTTTCCCAGACTAAAGGCCCCATATATATTATGAATTTCTGATATGCA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 920 GTGAAATTACTTCTTTCCCAGACTAAAGGCCCCATATATATTATGAATTTCTGATATGCA 979 Qy 901 AGTAATGAAACAACGACTCTGGCTACGGACATCCAATAAACTTCCTGATTCATTCCAGCT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 980 AGTAATGAAACAACGACTCTGGCTACGGACATCCAATAAACTTCCTGATTCATTCCAGCT 1039 Qy 961 TGGACCATAAATAGAATTTTAAAAATGAAAAGTTGGGTGATGGTGGCTCAACGGCCAACA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1040 TGGACCATAAATAGAATTTTAAAAATGAAAAGTTGGGTGATGGTGGCTCAACGGCCAACA 1099 Qy 1021 ATGAAGCGTGCTATTCTTAAGCATCTTACAAAATCGTACTGTTCCGTGGGTAAAATTTAA 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1100 ATGAAGCGTGCTATTCTTAAGCATCTTACAAAATCGTACTGTTCCGTGGGTAAAATTTAA 1159 Qy 1081 CCTTGCATAGTTGCATTAATAGTAAACAATGGTAAACATCATCTTAATATGTAGTTACAG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1160 CCTTGCATAGTTGCATTAATAGTAAACAATGGTAAACATCATCTTAATATGTAGTTACAG 1219 Qy 1141 AATAATTTCATCCGCTTCATGTAATTGCCATTTTTAGTACTACAAAATGATATTTCCCTA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1220 AATAATTTCATCCGCTTCATGTAATTGCCATTTTTAGTACTACAAAATGATATTTCCCTA 1279 Qy 1201 GTAAAAATGTTTGCTCAATGTTTATTTTGGCTGATTACAGCAATTAATGAATGCTTACAG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1280 GTAAAAATGTTTGCTCAATGTTTATTTTGGCTGATTACAGCAATTAATGAATGCTTACAG 1339 Qy 1261 GTTAATGGGCCAGAGAGGAAAACTCTTTCTGCCTTCTATAGTCTTCCTGCATCAACTCAT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1340 GTTAATGGGCCAGAGAGGAAAACTCTTTCTGCCTTCTATAGTCTTCCTGCATCAACTCAT 1399 Qy 1321 AGGGCTCCAAGGATTGTCCCTTTGTCTGAATCTGATAGAATCTTGAGTAAAATATCCGAA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1400 AGGGCTCCAAGGATTGTCCCTTTGTCTGAATCTGATAGAATCTTGAGTAAAATATCCGAA 1459 Qy 1381 AATTCAGCTGCTAAACCTCTTGACTATACCATCTCTAGCATTTCCTGTAATTCATTGATC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1460 AATTCAGCTGCTAAACCTCTTGACTATACCATCTCTAGCATTTCCTGTAATTCATTGATC 1519 Qy 1441 ACATCCAGATCCAGGTCCACACCATCAATCTGCCCGTTTGGGTCATCACCTTTGTCTGTG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1520 ACATCCAGATCCAGGTCCACACCATCAATCTGCCCGTTTGGGTCATCACCTTTGTCTGTG 1579 Qy 1501 ACCGCTAGTATTGACAGGCGGGCGGTCGAAGCCCAACGAGCTGGATTTGGTTTCCTCATT 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1580 ACCGCTAGTATTGACAGGCGGGCGGTCGAAGCCCAACGAGCTGGATTTGGTTTCCTCATT 1639 Qy 1561 ATCACCGATAATAGTGATGGTACTGGAAATAATAGTCAGTGTCTTGCGGGTGAAAATTAT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1640 ATCACCGATAATAGTGATGGTACTGGAAATAATAGTCAGTGTCTTGCGGGTGAAAATTAT 1699 Qy 1621 TCCATGCATCCTAGAATTGTCCACAGAAATGAGGATGGTTCGGGCACTAGAAAGGTAGGT 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1700 TCCATGCATCCTAGAATTGTCCACAGAAATGAGGATGGTTCGGGCACTAGAAAGGTAGGT 1759 Qy 1681 TATGTAACGAGTGTCAGAATCTCCCCAGATGATGTTGTGCTAAAGATAGGGCAGGAAAAT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1760 TATGTAACGAGTGTCAGAATCTCCCCAGATGATGTTGTGCTAAAGATAGGGCAGGAAAAT 1819 Qy 1741 TTCTGGAAAATAAGGCGAATCCTTGTCAAGTAAGCATATTTTGCATCACAGAATCATTTT 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1820 TTCTGGAAAATAAGGCGAATCCTTGTCAAGTAAGCATATTTTGCATCACAGAATCATTTT 1879 Qy 1801 CTGTTGTTTATCCTGATAATGAAGGTCTTTTTTTTTCTGTCCACTCTGCATTTATGGAAA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1880 CTGTTGTTTATCCTGATAATGAAGGTCTTTTTTTTTCTGTCCACTCTGCATTTATGGAAA 1939 Qy 1861 CGATTAGAGCGTCCATATTGATCGATCTTGTAGTATTCTGCACGTAGGAGAGTCAAAAAA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1940 CGATTAGAGCGTCCATATTGATCGATCTTGTAGTATTCTGCACGTAGGAGAGTCAAAAAA 1999 Qy 1921 AAAAAAAGGCACGAGAATACTTAGGGGTGTTATACGAGCCGAACGAGCCGAGCCTTAGCA 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2000 AAAAAAAGGCACGAGAATACTTAGGGGTGTTATACGAGCCGAACGAGCCGAGCCTTAGCA 2059 Qy 1981 TGCTCAAGCTCGGCTCGTTTATAAACGAGCCGAGTCCGAGTCCGAGCCGAGCTTTTGACG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2060 TGCTCAAGCTCGGCTCGTTTATAAACGAGCCGAGTCCGAGTCCGAGCCGAGCTTTTGACG 2119 Qy 2041 AGCCGAATCCGAGTCGAGCCCGAGTAGTTCGTCTAAAATAATGCTCATATAGTGTTATTT 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2120 AGCCGAATCCGAGTCGAGCCCGAGTAGTTCGTCTAAAATAATGCTCATATAGTGTTATTT 2179 Qy 2101 TAGACGAACGAGCCGAGCTTTACCCGAACGAGCCGAGCTTTGGCGTGTTTAAGCTCGACT 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2180 TAGACGAACGAGCCGAGCTTTACCCGAACGAGCCGAGCTTTGGCGTGTTTAAGCTCGACT 2239 Qy 2161 CGTTTATAAACGAGCCGAGCTTTTAACGAGCCGAATGCGAGCCGAGCCCGAGAAGCTTGT 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2240 CGTTTATAAACGAGCCGAGCTTTTAACGAGCCGAATGCGAGCCGAGCCCGAGAAGCTTGT 2299 Qy 2221 CTCATGTATCAGCCCTAAGAATACTGGATGAATTAGTCTTCTCTTTTTTTTTTTTTTTTT 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2300 CTCATGTATCAGCCCTAAGAATACTGGATGAATTAGTCTTCTCTTTTTTTTTTTTTTTTT 2359 Qy 2281 TTGATTAGTCTTCTCCAATACTATGTTCTTCTGTTTTCTCCATTTGACGTATTTTTACTA 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2360 TTGATTAGTCTTCTCCAATACTATGTTCTTCTGTTTTCTCCATTTGACGTATTTTTACTA 2419 Qy 2341 ATTCTTGGTTGTGTTTTTGCTCCATTATACATATAAAAACATAGTATTTATAATTTTGAC 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2420 ATTCTTGGTTGTGTTTTTGCTCCATTATACATATAAAAACATAGTATTTATAATTTTGAC 2479 Qy 2401 GTATAAAATAATTTGTGAACCATAAACATTCATTTAGCATATATAATTATTTCACTTACA 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2480 GTATAAAATAATTTGTGAACCATAAACATTCATTTAGCATATATAATTATTTCACTTACA 2539 Qy 2461 GAAAAAATGATATTTTGTCCATATAAATATACTGTTCTACCACATGTTGGGCTTCCATAT 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2540 GAAAAAATGATATTTTGTCCATATAAATATACTGTTCTACCACATGTTGGGCTTCCATAT 2599 Qy 2521 TTTTAATCGTCTTATTTTATTCACAAAGCATAATTTTTTGTTATTTTTAGTATTATTCTT 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2600 TTTTAATCGTCTTATTTTATTCACAAAGCATAATTTTTTGTTATTTTTAGTATTATTCTT 2659 Qy 2581 TTATATTGTTGTAAAGTGTTTCATTGATATGAATTAAAATAAATGAATTGGGTTCTTGAA 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2660 TTATATTGTTGTAAAGTGTTTCATTGATATGAATTAAAATAAATGAATTGGGTTCTTGAA 2719 Qy 2641 TGATGTAACAGAGTGATGAAATTGTGGAATTGAGAAAAAGTGGATTAAAAACCGTCAGAG 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2720 TGATGTAACAGAGTGATGAAATTGTGGAATTGAGAAAAAGTGGATTAAAAACCGTCAGAG 2779 Qy 2701 AAGTTATATGAATTATTTGATTTTAAGAGAAGTTATATGAATTTATTACCTTCGCTTCTG 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2780 AAGTTATATGAATTATTTGATTTTAAGAGAAGTTATATGAATTTATTACCTTCGCTTCTG 2839 Qy 2761 CATGTTCTAGTATCATTTTCTTTAGCTACTTCGAGTATCCAGCTTGAAGTGCCTTTCTAC 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2840 CATGTTCTAGTATCATTTTCTTTAGCTACTTCGAGTATCCAGCTTGAAGTGCCTTTCTAC 2899 Qy 2821 CTTTTTGATGGTTTTATGTGTGAAGCTTTGAGTTGGTTCATAGAAGGTTGAAAGTATGCA 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2900 CTTTTTGATGGTTTTATGTGTGAAGCTTTGAGTTGGTTCATAGAAGGTTGAAAGTATGCA 2959 Qy 2881 ATAAGACATTCTGAATTGAATATCTTGCATTATGATATGCAGACAGCAAAGGATCTTCTC 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2960 ATAAGACATTCTGAATTGAATATCTTGCATTATGATATGCAGACAGCAAAGGATCTTCTC 3019 Qy 2941 GATTCAAGTTTTTGAATTACACCGTTTAGTTCAGGTGAGTGGTTGAGTTCATCCTTCCTT 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3020 GATTCAAGTTTTTGAATTACACCGTTTAGTTCAGGTGAGTGGTTGAGTTCATCCTTCCTT 3079 Qy 3001 ATTATCATGTCGAACAAAAGCCATTCATTCTAATTCATCGTTGCAGAAATCTCTTGCTGG 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3080 ATTATCATGTCGAACAAAAGCCATTCATTCTAATTCATCGTTGCAGAAATCTCTTGCTGG 3139 Qy 3061 TTCATCCCACCATTATATCAAGGATAGCATATATTTACAAGAACGCCTTGATGAAGTCTC 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3140 TTCATCCCACCATTATATCAAGGATAGCATATATTTACAAGAACGCCTTGATGAAGTCTC 3199 Qy 3121 CAGCAAAGAGGAATCATTACCACCTCAACTTCATCTACAAACACCACCACCGCTATCTAG 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3200 CAGCAAAGAGGAATCATTACCACCTCAACTTCATCTACAAACACCACCACCGCTATCTAG 3259 Qy 3181 TCTACTACGAACTCATCTTCAACCCAGTGAGTGCCCAAAGATTGCAGCTGATAGTTCGCT 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3260 TCTACTACGAACTCATCTTCAACCCAGTGAGTGCCCAAAGATTGCAGCTGATAGTTCGCT 3319 Qy 3241 GGTTAAGACCCCCGTTCCTCCTGTCCTCTACAATTCAATGAGGGTACCACTTCGGAAAAA 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3320 GGTTAAGACCCCCGTTCCTCCTGTCCTCTACAATTCAATGAGGGTACCACTTCGGAAAAA 3379 Qy 3301 AAAAAAAGCTTTATCAATGGTTATGGCCAACAAACCTTGTACGTCTTTCGATTCACCACC 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3380 AAAAAAAGCTTTATCAATGGTTATGGCCAACAAACCTTGTACGTCTTTCGATTCACCACC 3439 Qy 3361 ATCATTGCCACTACCGGGACCTCCACCACCTCCATCACATATTGAATGCAATAGTTTTTC 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3440 ATCATTGCCACTACCGGGACCTCCACCACCTCCATCACATATTGAATGCAATAGTTTTTC 3499 Qy 3421 TCTAAAGAATGCTATAGGTCCTGAAAACTCAGTTGAAAAGCGTTTACTTCCTCTAAGCTG 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3500 TCTAAAGAATGCTATAGGTCCTGAAAACTCAGTTGAAAAGCGTTTACTTCCTCTAAGCTG 3559 Qy 3481 TAACTCTAATAAGCTCTCGTTCTCTGGGCATCAATCCGGCAAATCAATGGCCACATCAGT 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3560 TAACTCTAATAAGCTCTCGTTCTCTGGGCATCAATCCGGCAAATCAATGGCCACATCAGT 3619 Qy 3541 GGGCACAGACAAGAGTATGACACCTTATGGTTATTCCCTCCCAACACCTCCTGGAGATTT 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3620 GGGCACAGACAAGAGTATGACACCTTATGGTTATTCCCTCCCAACACCTCCTGGAGATTT 3679 Qy 3601 GGCTCTCACTCAATCAAGTGTGCCTTGTCCGAAAACTGGAACACCTTCTGGAGAGTCACT 3660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3680 GGCTCTCACTCAATCAAGTGTGCCTTGTCCGAAAACTGGAACACCTTCTGGAGAGTCACT 3739 Qy 3661 CAGATTGATGCTACCAACTACTTGCTTCTACTCTACACCAGAAAAGCATTGGCCGTGTCC 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3740 CAGATTGATGCTACCAACTACTTGCTTCTACTCTACACCAGAAAAGCATTGGCCGTGTCC 3799 Qy 3721 CTTCTTGTCATCGGAAGGACTTGTGTACAAGCCCTACCCTGGACCCTACCCTCCCAATGC 3780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3800 CTTCTTGTCATCGGAAGGACTTGTGTACAAGCCCTACCCTGGACCCTACCCTCCCAATGC 3859 Qy 3781 AGCCAGCTTCACAGCTCATCTCTTTGGAAGTTGTGGGCCCATGATTGTCCGTCCAGGTGG 3840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3860 AGCCAGCTTCACAGCTCATCTCTTTGGAAGTTGTGGGCCCATGATTGTCCGTCCAGGTGG 3919 Qy 3841 CGGATCCTACATCCGGCATTCGGCCTATGGAATTCCACATGCTGCACAACAAGGGAAGGA 3900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3920 CGGATCCTACATCCGGCATTCGGCCTATGGAATTCCACATGCTGCACAACAAGGGAAGGA 3979 Qy 3901 GTTGGTCCCTGGAATCCCCATTAAAATGTCCTTTCTTGATCCCTGTGACTTTTCCTCAAC 3960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3980 GTTGGTCCCTGGAATCCCCATTAAAATGTCCTTTCTTGATCCCTGTGACTTTTCCTCAAC 4039 Qy 3961 CAATCTTTCTCCCTGGGAGCATGAAGTGGTCAAAGACATGAGCTCGAGCCACCAAAAAGG 4020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4040 CAATCTTTCTCCCTGGGAGCATGAAGTGGTCAAAGACATGAGCTCGAGCCACCAAAAAGG 4099 Qy 4021 TGTGTTCTGTAGTGATAGAACCGTTCCAAGGTCTAATGAAGGTGACCGACAAGGTAGCAC 4080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4100 TGTGTTCTGTAGTGATAGAACCGTTCCAAGGTCTAATGAAGGTGACCGACAAGGTAGCAC 4159 Qy 4081 AGGAAGCAGCTCCGTGGGAAGGGGTTCTCTAGACACGCTTCACCCGTTTCAATTGGAACT 4140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4160 AGGAAGCAGCTCCGTGGGAAGGGGTTCTCTAGACACGCTTCACCCGTTTCAATTGGAACT 4219 Qy 4141 GGTTGGAGCTCAAGAGCTGGAGAGTGGGGTTGGCAATGAGAAACTAACGCGAGCAATCAA 4200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4220 GGTTGGAGCTCAAGAGCTGGAGAGTGGGGTTGGCAATGAGAAACTAACGCGAGCAATCAA 4279 Qy 4201 GGCCGTGCCTTGTGATGGGAGACTCGCTTCTGAATCTGCAATGAAAATATTCCGTTCTAT 4260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4280 GGCCGTGCCTTGTGATGGGAGACTCGCTTCTGAATCTGCAATGAAAATATTCCGTTCTAT 4339 Qy 4261 ACAGAAAGAACGAAAACAAAACAACGTTTGA 4291 ||||||||||||||||||||||||||||||| Db 4340 ACAGAAAGAACGAAAACAAAACAACGTTTGA 4370 Further in regard to claim 2, Yasui (2013) teaches that SSC7 is specifically expressed in the short style flower (S/s genotype) (i.e., wherein the transcription factor-like gene is S-ELF3 gene which is present only in a short-styled flower individual having S haplotype and absent in a long-styled flower individual having no S haplotype) (Yasui 2013, paragraph 0076; Figure 1). In regard to claim 3, Yasui (2013) teaches and claims a mutagen is brought into contact with a self-incompatible buckwheat plant that holds the nucleic acid of the present invention, and a loss-of-function mutation is added to the gene. An example of said mutagen includes ethyl methanesulfonate (i.e., wherein the mutagenesis produces S-ELF3-PS1 gene by allowing the transcription factor-like gene to lose a function by ethyl methanesulfonate treatment); (Yasui 2013, paragraph 0049). In regard to claim 5, Yasui (2013) teaches and claims the self-compatible buckwheat plant (i.e., a self-propagating Fagopyrum plant); a gene encoding a self-incompatibility control factor contained in the nucleic acid is destroyed in the self-incompatibility buckwheat plant (i.e., producing a loss-of-function transcription factor-like gene); breeding of plants exhibiting self-compatibility that can quickly and efficiently introduce useful traits (i.e., mating and cultivating an individual having this self-propagation gene) (Yasui 2013, paragraph 0008; claim 3). Based on the teachings of Yasui (2013), it would have been obvious to introduce a loss-of-function mutation into a gene encoding a self-incompatibility control factor contained in the base sequence shown in SEQ ID NO: 3 as taught by Yasui which shares 100% sequence identity with instant sequence SEQ ID NO: 1. One of ordinary skill in the art would have been motivated to introduce a loss-of-function mutation into a gene encoding a self-incompatibility control factor, thus conferring self-compatibility to a buckwheat plant, as taught by Yasui (2013). By following the teachings of Yasui, one of ordinary skill in the art would have a high expectation of success in achieving the loss-of-function transcription factor gene of instant claim 1. The use of introducing mutations in plant genes to lose expression is a technique that was routine in the art at the time the application was filed, as taught by the cited reference and the state of the art in general. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over YASUI (Yasui et al., International Publication Number WO 2013/047736 A1, International Publication Date 04/04/2013) as applied to claims 1-3 and 5 above. Claim 4 recites “[t]he loss-of-function transcription factor-like gene according to claim 3, wherein in the S-ELF3-PS1 gene, a splicing site of intron 3 corresponding to a base at position 3046 of a genomic sequence of the S-ELF3 gene has been altered from G to A so that a codon at positions 2976 to 2978 has become a new stop codon”. Yasui (2013) teaches that ordinary buckwheat is an unusual self-incompatible plant that bears fruit by cross-pollination, and therefore tends to reduce the yield, and it is difficult to carry out cross breeding. The present invention enables self-incompatibility that enables breeding of plants exhibiting self-compatibility that can quickly and efficiently introduce useful traits. It is an object of the present invention to provide a self-compatible buckwheat plant that can quickly and efficiently introduce useful traits (Yasui 2013, paragraphs 0005 and 0006). Yasui (2013) teaches that the gist of the present invention is as follows: in a plant, an isolated nucleic acid encoding a self-incompatibility regulator that positively controls self-incompatibility; a nucleic acid comprising a mutant gene in which a loss-of-function mutation is introduced into a gene encoding a self-incompatibility regulator contained in the nucleic acid; a self-compatible buckwheat plant obtained by the production method (Yasui 2013, paragraph 0007). Yasui (2013) further teaches said loss-of-function mutation is, for example: (i) a loss of a portion corresponding to the active site of the self-incompatibility control factor in any of the base sequences;(ii) a mutation (frame shift mutation) that causes a frame shift with respect to any of the base sequences;(iii) a mutation (nonsense mutation) that causes a stop codon in an open holding frame in any of the base sequences;(iv) a mutation (for example, a mutation at a boundary between an intron and an exon) that causes a splicing abnormality to delete the function of the self-incompatibility control factor (for example, a mutation at a boundary between an intron and an exon);(v) a mutation in which a constituent amino acid residue in any of the base sequences is substituted with an amino acid residue having a different physicochemical property; (vi) a mutation that loses the genomic region on which the self-incompatibility control factor gene is seated;(vii) the combination of (i) to (vi) (Yasui 2013, paragraph 0030). Although Yasui (2013) does not explicitly teach in the S-ELF3-PS1 gene, a splicing site of intron 3 corresponding to a base at position 3046 of a genomic sequence of the S-ELF3 gene has been altered from G to A so that a codon at positions 2976 to 2978 has become a new stop codon, it is the position of this Office that any mutation introduced into the S-ELF3 gene which results in the loss of function of the S-ELF3 gene is rendered obvious by the teachings of Yasui (2013). As such, it would have been obvious to one of ordinary skill in the art to introduce a loss-of-function mutation in the S-ELF3 gene as taught by Yasui (2013) to produce a self-compatible buckwheat plant. Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over YASUI (Yasui et al., International Publication Number WO 2013/047736 A1, International Publication Date 04/04/2013) as applied to claims 1-5 above, in view of MATSUI (Matsui et al., 01/30/2020, Breeding Science Preview, pp. 1-7, doi:10.1270/jsbbs.19083). Claim 6 recites “[t]he self-propagating Fagopyrum plant according to claim 5, wherein in the mating and the cultivation, the breeding is performed by mating the individual having the S-ELF3-PS1 gene with a long-styled flower individual to separate an individual having long stamen and pistil”. Yasui (2013) teaches the self-propagating Fagopyrum plant according to claim 5. Yasui (2013) does not explicitly teach wherein in the mating and the cultivation, the breeding is performed by mating the individual having the S-ELF3-PS1 gene with a long-styled flower individual to separate an individual having long stamen and pistil. Matsui (2020) teaches that buckwheat needs pollination between pin (long style, short stamen; s/s genotype) and thrum (short style, long stamen; S/s genotype) plants by bees or other insects to produce seeds. Pollination, and therefore yield, is strongly affected by environmental conditions. Self-incompatible (SI) plants maintain high heterogeneity, and fixing agricultural traits is time consuming. Attempts to introduce self-compatible (SC) traits from SC species into common buckwheat have been successful with F. homotropicum. However, plants produced by interspecific crosses have undesirable traits such as shattering and lodging. Matsui et al. (2003a) investigated the inheritance of the shattering habit and removed it by backcrossing with a leading SI common buckwheat cultivar, but more such crosses are needed to produce new cultivars desirable for farmers and consumers. The Sh allele, conferring the SC trait, is dominant over the s allele but recessive to the S allele. Thus, to obtain F1 plants with the SC trait, pin plants and SC lines need to be crossed (i.e., the breeding is performed by mating the individual having the S-ELF3-PS1 gene (SC line) with a long-styled flower individual (pin plants – long style, short stamen; s/s genotype) to separate an individual having long stamen and pistil) (page 5, left column). Based on the teachings of Yasui (2013) and Matsui, it would have been obvious to cross plants of an SC line with pin plants (long style, short stamen; s/s genotype) as taught by Matsui to obtain F1 plants with the SC trait. One of ordinary skill in the art would have been motivated to cross plants of an SC line with pin plants as taught by Matsui to obtain F1 plants with the SC trait, thus conferring self-compatibility to a buckwheat plant, as taught by Yasui (2013) and Matsui. By following the teachings of Yasui (2013) and Matsui, one of ordinary skill in the art would have a high expectation of success in achieving the self-propagating Fagopyrum plant of instant claim 6. Summary No claim is allowed. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA MEADOWS whose telephone number is (703)756-1430. The examiner can normally be reached Monday - Friday 9:00 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at 571-270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. CHRISTINA MEADOWS Examiner Art Unit 1663 /CHRISTINA L MEADOWS/Examiner, Art Unit 1663 /Amjad Abraham/SPE, Art Unit 1663
Read full office action

Prosecution Timeline

Aug 22, 2023
Application Filed
Feb 05, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12599093
SOYBEAN CULTIVAR 20372402
2y 5m to grant Granted Apr 14, 2026
Patent 12588612
PARTHENOCARPIC WATERMELON PLANTS
2y 5m to grant Granted Mar 31, 2026
Patent 12590317
POLYNUCLEOTIDES AND METHODS FOR TRANSFERRING RESISTANCE TO ASIAN SOYBEAN RUST
2y 5m to grant Granted Mar 31, 2026
Patent 12588613
Wheat Variety G18C2097
2y 5m to grant Granted Mar 31, 2026
Patent 12577579
Cytoplasmic Male-Sterile Rudbeckia Plants and a Method of Production
2y 5m to grant Granted Mar 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
73%
Grant Probability
99%
With Interview (+26.2%)
2y 10m
Median Time to Grant
Low
PTA Risk
Based on 59 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month