DETAILED ACTION
Response to Amendment
The amendment filed 02/04/2026 is acknowledged. Claims 1-5, 7, 10-12, and 17-18 were amended. Claims 6, 8, 13-16, and 19-20 have been cancelled. The amendments removed reference to new matter, exemplary claim language, and clarified the mechanism of interaction in claim 18. Additional objections and rejections were addressed as outlined below.
Regarding the office action mailed 01/15/2026 and in light of applicant’s amendments:
Objections to the specification are withdrawn.
Objections to claims 6, 8, 13-15, and 19-20 as being substantial duplicates are moot as they have been cancelled.
Objections to claim 7 as being a substantial duplicate is withdrawn.
Objections to claims 1, 2, 3, and 10 as being substantial duplicates are withdrawn as the corresponding duplicate claims have been canceled or amended.
Objections to claims 1-4, 8, 10, 11, 15, and 17-20 due to the presence of informalities are withdrawn.
Rejections of claims 1-20 under 35 USC § 112(a) are withdrawn as all reference to new matter has been removed.
Rejections of claims 1-20 under 35 USC § 112(b) are withdrawn.
A new rejection is necessitated due to the amendments. See below.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-5, 7, 10-12, and 17-18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Regarding claim 1, the forward and backward internal primers contain SEQ ID NOs: 3-4 and 5-6, respectively. However, the claim does not limit how these sequences are oriented relative to one another. Each sequence could correspond to either strand, resulting in two possible sequences for each primer and four possible primer pair combinations (see table below). While there is support in the specification for the primer sequences disclosed in combination A, there is a lack of support for combinations B-D. Therefore, these possible combinations are considered to be new matter.
Claims 2-5, 7, 10-12, and 17-18 are rejected by virtue of their dependency on claim 1.
Forward Internal Primer
Backward Internal Primer
(A)
5’-[SEQ ID NO: 3] – [SEQ ID NO: 4]-3’
5’-[SEQ ID NO: 5] – [SEQ ID NO: 6]-3’
(B)
5’-[SEQ ID NO: 4] – [SEQ ID NO: 3]-3’
5’-[SEQ ID NO: 6] – [SEQ ID NO: 5]-3’
(C)
5’-[SEQ ID NO: 3] – [SEQ ID NO: 4]-3’
5’-[SEQ ID NO: 6] – [SEQ ID NO: 5]-3’
(D)
5’-[SEQ ID NO: 4] – [SEQ ID NO: 3]-3’
5’-[SEQ ID NO: 5] – [SEQ ID NO: 6]-3’
One possible path of recourse, as discussed in the interview held 02/19/2026, would be to amend claim 1 to make clear the orientation of the sequences. Exemplarily claim language is included below:
Claim 1: A set of primers for amplifying the nucleotide sequence of the Neisseria gonorrhoeae dcm gene, characterized in that the set of primers contains a set of internal primers with the following nucleotide sequences a) and b), as well as a set of external primers containing the following sequences c) and d):
FIP primer comprising a 5’ segment comprising 5' ATCTTTGGGGCTTGCGGGTG 3' (SEQ ID NO: 3) and a 3’ segment comprising 5' TAAAGCGTGGGATGAACAGG 3' (SEQ ID NO: 4);
BIP primer comprising a 5’ segment comprising 5' AAGCACGGGGCAAACGACTA 3' (SEQ ID NO: 5) and a 3’ segment comprising 5' CAACTTCGCGTACCGTCAT 3' (SEQ ID NO: 6);
5' TATGAGCCGGAACCGAGT 3' (SEQ ID NO: 1); and
5' TCGGGAAAGCCTTGGATTC 3' (SEQ ID NO: 2).
Response to Arguments
Applicant’s arguments filed 02/04/2026 have been fully considered but they are not persuasive. Applicant argues the application is in condition for allowance following amendment of the disclosure as prescribed by the office action mail 01/15/2026. However, as discussed above, amendment of claim 1 introduced subject matter lacking support in the specification, thus necessitating new grounds of rejection. Accordingly, the application is not in condition for allowance.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kara N Kovach whose telephone number is (571)272-8134. The examiner can normally be reached Monday - Friday, 9am - 3pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/K.N.K./Examiner, Art Unit 1681
/SAMUEL C WOOLWINE/Primary Examiner, Art Unit 1681