Prosecution Insights
Last updated: October 02, 2026
Application No. 18/549,887

SYSTEMS, METHODS, AND COMPOSITIONS FOR ALTERING THE EXPRESSION OF ENDOGENOUS CIRCULAR RNAS

Non-Final OA §102§103
Filed
Sep 08, 2023
Priority
Mar 11, 2021 — provisional 63/159,798 +2 more
Examiner
LARA, CAROLINE MONSERRAT
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Unm Rainforest Innovations
OA Round
1 (Non-Final)
100%
Grant Probability
Favorable
1-2
OA Rounds
3m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 100% — above average
100%
Career Allowance Rate
4 granted / 4 resolved
+40.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 4m
Avg Prosecution
36 currently pending
Career history
31
Total Applications
across all art units

Statute-Specific Performance

§101
2.5%
-37.5% vs TC avg
§103
44.4%
+4.4% vs TC avg
§102
17.5%
-22.5% vs TC avg
§112
18.1%
-21.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 4 resolved cases

Office Action

§102 §103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority This application is a 371 of PCT/US2022/071110 (filed on 03/11/2022), which is a CIP of PCT/US2022/017936 (filed on 02/25/2022), and which claims benefit of provisional application 63/159,798 (filed on 03/11/2021). Election/Restrictions Applicant's election with traverse of Group I encompassing claims 16-34 in the reply filed on 02/11/2026 is acknowledged. The traversal is on the grounds that restriction requirements are optional in all cases and lack of search burden on the Examiner. This is not found persuasive because Applicant’s assertion that there would be no burden on the Examiner in examining all the claims at once, chapter 800 of MPEP with which Applicant is ultimately relying on, is limited to a discussion of the subject of restriction and double patenting under Title 35 of the United States Code and Title 37 of the Code of Federal Regulations as it relates to national applications filed under 35 U.S.C. 111(a). The discussion of unity of invention under the Patent Cooperation Treaty Articles and Rules as it is applied as an International Searching Authority, International Preliminary Examining Authority, and in applications entering the National Stage under 35 U.S.C 371 as a Designated or Elected Office in the U.S. Patent and Trademark Office is covered in MPEP § 1850 and is dictated by PCT Rules 13.1 and 13.2 (See MPEP § 801). Burden is not a consideration in a finding of lack of inventive unity; rather, according to MPEP §1850, the only consideration is whether the inventions share a special technical feature. Therefore, the requirement is still deemed proper and is therefore made FINAL. The requirement is still deemed proper and is therefore made FINAL. Claim Status Claims 16-34,63-64, and 69-70 are pending. Claims 63-64 and 69-70 are withdrawn per restriction response filed on 02/11/2026. Claims 16-34 have been examined on the merits. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiency – Nucleotide and/or amino acid sequences appearing in the specification are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). The sequences found in the Specification at pages 17-30 are missing required and corresponding SEQ ID NOs. Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 16-18,19-20,24, and 31-34 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Zhang et al (Genome biology, 2021; IDS filed on 09/08/2023). Zhang et al teaches that short hairpin RNAs (shRNAs) are used to deplete circRNAs by targeting back splicing junction sites but they were able to optimize CRISPR/Cas13d tool to enhance specificity of circRNA silencing by targeting the same region (See, Abstract). Regarding claim 16, Zhang et al teaches a method using CRISPR/Cas13d system for depleting circRNAs (See, p3 paragraph 2). This reads on, a method of inhibiting circular RNA formation. Zhang et al used CasRx paired with one unprocessed pre-gRNA and a mature gRNA to target circRNAs (See, p3 paragraph 2). This reads on, providing nucleic acid sequence encoding a target circRNA. Figure 1a of Zhang et al, shows schematic of the length optimization of gRNAs used with CasRx to target the back splicing junction (BSJ) sites of circRNAs and their corresponding knockdown efficiency (See, p4 Figure 1a). The back splicing junction reads on intronic regulatory sequence…that is capable of promoting circRNA backsplicing. The knockdown, reads on, removing or disrupting said intronic regulatory sequence inhibiting backsplicing… The CasRx and the gRNAs read on, contacting the nucleic acid sequence with a nucleic acid editing system configured to target… Regarding claim 17, following the discussion above about claim 16, Zhang et al teaches targeting human hepatocellular carcinoma (HCC) related circRNAs by inhibiting the circRNAs, which led to increased therapeutic efficacy of a sorafenib, a common therapy (See, p2 paragraph 1). To obtain the best circRNA targets, Zhang et al analyzed total RNA sequencing data of paired primary tumors and adjacent normal tissues. Total RNA sequencing includes mRNA, therefore, the identified targets read on, wherein...further encodes functional mRNA that is not interrupted by disruption or removal of the intronic regulatory sequence. This is especially true because mRNA does not have introns, therefore would not be interrupted or disrupted by the method. Regarding claim 18, following the discussion above, Figure 1a of Zhang et al, shows schematic of the length optimization of gRNAs used with CasRx to target the back splicing junction (BSJ) sites of circRNAs and their corresponding knockdown efficiency (See, p4 Figure 1a). Zhang et al provides sequences associated with BSJ site and the sequence at Site 1 of Figure 1a is a fragment of SEQ ID NO: 380 (See, APPENDIX for alignment). Site 1 sequence has 10 matching nucleic tides which is a fragment of the sequence. This reads on, target circRNA…SEQ ID No: 380 a fragment thereof. Regarding claim 19, following the discussion above, Zhang et al teaches a method using CRISPR/Cas13d (CasRx) system for depleting circRNAs (See, p3 paragraph 2). This reads on, wherein said nucleic acid editing system is selected…a CRISPR system. Regarding claim 20, following the discussion above, Figure 1a of Zhang et al, shows schematic of the length optimization of gRNAs used with CasRx to target the backsplicing junction (BSJ) sites of circRNAs and their corresponding knockdown efficiency (See, p4 Figure 1a). Zhang et al used CasRx paired with one unprocessed pre-gRNA and a mature gRNA to target circRNAs (See, p3 paragraph 2). The backsplicing junction reads on said intronic regulatory sequence, and the gRNAs used to guide the CasRx are complementary to the target BSJ site are by virtue complementary to 5’ or 3’ of targets. This reads on, wherein said CRISPR system further comprises one or more guide RNAs complementary to 5’ and or 3’. Regarding claim 24, following the discussion above, Zhang et al teaches targeting human hepatocellular carcinoma (HCC) cells related circRNAs by inhibiting the circRNAs, which led to increased therapeutic efficacy of a sorafenib, a common therapy (See, p2 paragraph 1). This reads on, wherein said nucleic acid sequence encoding a target circRNA sequence is expressed in vitro. Regarding claim 31-34, following the discussion above, Zhang et al teaches targeting human hepatocellular carcinoma (HCC) related circRNAs by inhibiting the circRNAs, which led to increased therapeutic efficacy of a sorafenib, a common therapy (See, p2 paragraph 1). This reads on, a method of treating a disease or condition in a subject in need thereof, comprising inhibiting circRNA formation…of claim 31, wherein said disease is…Hepatocellular carcinoma of claim 32, wherein said subject is a mammal of claim 33, and wherein said subject is a human of claim 34. Therefore, claims 16-20,24,31-34 are anticipated by Zhang et al. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 21-23, and 25-29 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al (Genome biology, 2021; IDS filed on 09/08/2023) as applied to claims 16-18,19-20,24, and 31-34 above, and further in view of Zimmerman et al (Molecular Psychiatry, 2020) and Zhao et al (Journal of cellular biochemistry, 2020). The teachings of Zhang et al are set forth above. Regarding claim 21-22, following the discussion above, Zhang et al further teaches that they compared the specificity of the CRISPR/Cas13d system with shRNA and LNA for knocking down circRNAs in Huh7 cells (See, p5 paragraph 2). The results showed that shRNA had off-target effects on circRNA knockdown and Cas13d method had confirmed knockdown of targeted circRNAs by northern blot (See, p5 paragraph 2, Figure 2). Zhang et al does not the method further comprising endogenously expressing said target circRNA in mammal. Zimmerman et al teaches in vivo knock down of circHomer1a in mice by targeting the splice junctions between exons 5 and 2 with shRNA, that does not directly target linear Homer1 mRNAs (See, p2718-2719, Figure 1d, 3a, 4a and supplementary methods). The mice in the experiment of Zimmerman et al are mammals and endogenously express target circRNA. Zimmerman et al performed circHomer1 depletion in vivo and in vitro with mouse neuronal cultures and demonstrated a two-fold reduction in circHomer1a expression but no change in Homer1 expression in vitro (See, p2721 col1). It would have been prima facie obvious to a person having ordinary skill in the art to substitute the HCC cells of Zhang et al with the mice of Zimmerman et al. Both Zhang et al and Zimmerman et al teach targeting circRNA. The use of in vivo animal models in place of cell culture in vitro would have a predictable result of success evidenced by Zimmerman et al having success in both in vivo and in vitro assays for circRNA knockdown and Zhang et al showing the CasRx has a better specificity than shRNA that is used by Zimmerman et al. This rationale aligns with the principle of KSR for simple substitution of one known element for another to obtain predictable results (See, MPEP 2143). This reads on, wherein said mammal comprises a mouse of claim 22. Regarding claim 23, following the discussion above, Zhang et al does not teach that the human or mouse has or is at risk of developing a variety of disease, disorder, or cancer. Zimmerman et al teaches the use of C57BL/6 mice from Jackson Laboratory, these mice are known in the art to be tools in biomedical research in cancer and tumor models (See, p2714 Animal Methods). Therefore, these mice are at risk of developing Hepatocellular carcinoma, epilepsy or colorectal cancer. Regarding claim 25, following the discussion above about claim 16, Zhang et al teaches the method of inhibiting circRNA formation. Zhang et al does not teach wherein the target circRNA comprises circHomer1 circRNA. Zimmerman et al teaches knock down in vivo assays in mouse orbitofrontal cortex (OFC) to study knockdowns of circHomer1a, then demonstrated its association with psychiatric disease and its regulation of synaptic gene expression (See, Abstract). Zimmerman et al teaches in vivo knock down of circHomer1a in mice by targeting the splice junctions between exons 5 and 2 with shRNA, that does not directly target linear Homer1 mRNAs (See, p2718-2719, Figure 1d, 3a, 4a and supplementary methods). Zhao et al teaches circHOMER1 promoted Hepatocellular carcinoma (HCC) cell growth and aggressiveness by miR-1322/CXCL6 and would be a therapeutic target for patients (See, Abstract). It would have been prima facie obvious to a person having ordinary skill in the art to have modified the method of Zhang et al to target circHomer1 circRNA as taught by Zimmerman et al. One would have been motivated to make this modification because it would have been advantageous to target circHomer1 for treating HCC, as taught by Zhao et al (See, abstract). Both Zhang et al and Zimmerman et al teach methods of targeting circRNA. This conclusion of obviousness is based on teaching suggestion motivation rationale. One would have had a reasonable expectation of success targeting circHomer1 of Zimmerman et al with the method of Zhang et al to treat HCC. Regarding claim 26, following the discussion above, Zhang et al does not teach circHomer1 circRNA with SEQ ID NO: 440 or 446, or a fragment or variant thereof. Zimmerman et al provides sequence in supplemental table 4 (h_circHomer1a-F) that is used to target circRNA, that is a 100% match for a fragment of SEQ ID NO: 440 (See, APPENDIX for alignment). It would have been prima facie obvious to a person having ordinary skill in the art to substitute the circRNA of Zhang et al with the circRNA with sequence from supplemental table 4 (h_circHomer1a-F) of Zimmerman et al. Both Zhang et al and Zimmerman et al teach targeting circRNA, therefore there would be a reasonable expectation of success to target circHomer1. Regarding claim 27-29, following the discussion above, Zhang et al does not teach CRISPR system with one or more intronic regulatory sequence of circHomer1 circRNA. Zimmerman et al teaches in vivo knock down of circHomer1a in mice by targeting the splice junctions between exons 5 and 2 with shRNA, that does not directly target linear Homer1 mRNAs (See, p2718-2719, Figure 1d, 3a, 4a and supplementary methods). This reads on, gRNA targeting at least one intronic regulatory sequence of said circHomer1 circRNA of claim 27 and …configured to target intron 5 of said circHomer1 circRNA of claim 28. Zimmerman et al teaches the shRNA used to target circHomer1 was designed to bind asymmetrically within exon5/exon2 splice junction to avoid miRNA mediated inhibitory effects on linear HOMER1 mRNA transcripts. The sequence of the targeting shRNA is provided in the supplemental materials (See, Supplemental p2 paragraph 2). The shRNA sequence provide is a variant of SEQ ID NO: 441 (See, APPENDIX for alignment). This reads on, wherein said one or more gRNAs targeting… are SEQ ID NO: 441 of claim 29. It would have been prima facie obvious to a person having ordinary skill in the art to substitute the targeting gRNAs of Zhang et al with the targeting gRNAs for circHomer1 with sequence from supplemental methods (circHomer1a TGCTCCCTATGTGGAAATGGC) of Zimmerman et al to achieve the same purpose. Both Zhang et al and Zimmerman et al teach targeting circRNA, therefore there would be a reasonable expectation of success to target circHomer1 with gRNA from Zimmerman et al in the CRISPR/Cas system of Zhang et al. Therefore, claims 18,21-23, and 25-29 are rendered obvious by Zhang et al in view of Zimmerman et al and Zhao et al. Claims 30 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al (Genome biology, 2021; IDS filed on 09/08/2023, Zimmerman et al (Molecular Psychiatry, 2020), and Zhao et al (Journal of cellular biochemistry, 2020) as applied to claims18,21-23, and 25-29 above, and further in view of Mellios (WO 2019/210033 A1; IDS filed on 09/08/2023). The teachings of Zhang et al, Zimmerman et al, and Zhao et al are set forth above. Regarding claim 30, Zhang et al teaches a method of inhibiting circRNA formation but does not teach targeting circHomer1. Zimmerman et al teachings a method of inhibiting circRNA targeting circHomer1. Neither Zhang et al , Zimmerman et al or Zhao et al wherein the circHomer1 circRNA has SEQ ID NO: 438 or 445 or a fragment or variant thereof. Mellios et al disclosed circular RNAs (circRNAs) are useful for compositions, kits, assays and methods for the identification, diagnosis, screening, treatment, and or monitoring of brain disorders, including bipolar disorder (BD), schizophrenia (SCZ), depression, ADHD, OCD, and others (See, Abstract). Mellios et al disclosed sequence validation for unique splice junction for human HOMER1 (SEQ ID NO: 4,5,6) (See, ¶065). Figure 8B further discloses underlined portions for targeting of SEQ ID NO 4, the double underlined portion of SEQ ID NO 4 is a variant of SEQ ID NO: 438 (See, APPENDIX for alignment). It would have been prima facie obvious to a person having ordinary skill in the art to substitute the circRNA of Zhang et al and Zimmerman et al with the circHomer1 with sequence from supplemental methods (circHomer1a TGCTCCCTATGTGGAAATGGC) of Zimmerman et al to achieve the same purpose. Both Zhang et al and Mellios et al teach targeting circRNA, therefore there would be a reasonable expectation of success of circHomer1 with sequence from Mellios et al in the method with the CRISPR/Cas system of Zhang et al. Therefore, claim 30 is rendered obvious over Zhang et al, Zimmerman et al, and Zhao et al and in further view of Mellios et al. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to Caroline M Lara whose telephone number is (571)272-4262. The examiner can normally be reached 7:00 to 4:30pm M-Th. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CAROLINE M LARA/Examiner, Art Unit 1633 /ALLISON M FOX/Primary Examiner, Art Unit 1633 APPENDIX SEQUENCE ALIGNMENT Query, ‘Qy’ (SEQ ID NO: 380) vs Database, ‘Db’ (Zhang et al , Figure 1a Site 1 5’-3’) PNG media_image1.png 202 616 media_image1.png Greyscale Query, ‘Qy’ (SEQ ID NO: 440) vs Database, ‘Db’ (Zimmerman et al, Supplemental table 4) PNG media_image2.png 198 618 media_image2.png Greyscale Query, ‘Qy’ (SEQ ID NO: 441) vs Database, ‘Db’ (Zimmerman et al, Supplemental p2 shRNA for circHomer1) PNG media_image3.png 198 625 media_image3.png Greyscale Query, ‘Qy’ (SEQ ID NO: 438) vs Database, ‘Db’ (Mellios et al, SEQ ID NO:4 Double underlined portion in Figure 8B) PNG media_image4.png 196 624 media_image4.png Greyscale
Read full office action

Prosecution Timeline

Sep 08, 2023
Application Filed
May 06, 2026
Non-Final Rejection mailed — §102, §103 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
100%
Grant Probability
99%
With Interview (+0.0%)
3y 4m (~3m remaining)
Median Time to Grant
Low
PTA Risk
Based on 4 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month