DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Claims 51-53 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 3/9/2026.
Application Status
This action is written in response to applicant’s correspondence received on 7/22/2026. Claims 1-4, 33-36, 50-53, and 69-77 are pending. Claims 1 and 4 have been amended. Claims 5-32, 37-49, and 54-68 have been cancelled. Claims 51-53 are withdrawn. Claims 69-77 are newly added Claims 1-4, 33-36, 50, and 69-77 are currently under examination.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. This Office Action is Final.
Claim Rejections - 35 USC § 103 – New Rejection Necessitated by Amendment
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 33-36, 50, 72-73 are rejected under 35 U.S.C. 103 as being unpatentable over Khalili (US 2019/0032057 A1) in view of Rabbani (EP 2042606 A1, published 2009) and GenBank EU744087 (hereafter ‘087, GenBank Accession number EU744087, HIV Envelope protein, published 2009).
Regarding claim 1, Khalili teaches treatment of HIV using CRISPR (Title, Abstract, and throughout). Khalili teaches CRISPR guide RNAs that are complimentary to an HIV-1 sequence (e.g., paragraph 61). Khalili teaches that the gRNA can be complimentary to a protein coding region of HIV-1 (i.e., a gene, paragraph 62). Khalili teaches the delivery of CRISPR materials with lipid nanovesicles (paragraphs 90, 93-94,102, 104, and 107). Khalili teaches that their compositions for targeting involve at least two gRNAs to target different targets, where such comprise crRNAs (e.g., see claims 1 and 11-12 of Khalili). Khalili teaches that the gRNAs comprise crRNA (e.g., claim 6 of Khali). Khalili teaches that the gRNAs can target consensus sequences found in HIV such as tat, gag, and env, paragraph 62). Khalili teaches that gRNAs can be designed based on consensus sequences of HIV-1 (paragraph 61). Khalili teaches targeting the HIV genome with gRNAs which target tat (paragraph 62). Khalili teaches that Cas9 system, which relies upon PAM site recognition of the sequence NGG (paragraph 196).
Khalili does not specifically teach that the crRNA targets are SEQ ID NOs 2 and 3.
Rabbani is a patent document which focuses on the identification of targets for gene therapy to treat HIV (Abstract, and see Examples 19-26, which use antisense molecules to target HIV). Rabbani teaches that one such antisense target of the HIV genome is a portion of the tat/rev gene, where furthermore not only is this sequence a known target as taught by Rabbani, but targeting this sequence using antisense RNAs is taught by Rabbani to be an effective target for HIV (paragraph 293, “(B) the coding sequence for Tat/Rev,” where the antisense “B” is comprised in the antisense plasmid pDU1 (B), examples 27-28). Furthermore, the antisense targets were shown by Rabbani to be viable targets for the reduction of HIV (e.g., Tables 1-4). Thus, the tat/rev sequence was a known target as taught by Rabbani for targeting the HIV genome.
Furthermore, the “B” sequence (i.e., tat/rev, SEQ ID NO: 25 of Rabbani) is shown below in alignment with instant SEQ ID NO: 2:
GATCACCTTAGGCTCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGACCTCCTCAAG – SEQ ID NO: 25, Rabbani
UCUCCUAUGGCAGGAAGAAG - SEQ ID NO: 2, instant
As shown above, instant SEQ ID NO: 2 is a 100% match for the DNA equivalent of target residues of Rabbani’s SEQ ID NO: 25. Furthermore, SEQ ID NO: 2 is situated immediately upstream of an “NGG” PAM site within Rabbani’s SEQ ID NO: 25 (see bold and underlined NGG sites, above). Thus, as Khalili teaches that gRNA targets used with Cas9 are adjacent to NGG sites, and SEQ ID NO: 25 of Rabbani contains only four such NGG sites, a practitioner is selecting from only a limited number of gRNA designs (i.e., 4) when targeting the known tat/rev target site taught by Rabbani.
Regarding instant SEQ ID NO: 3, this sequence is simply a known sequence of the HIV envelope protein (env), a target region to target HIV as taught by Khalini (paragraph 62). For instance, ‘087 is a published copy of the HIV env protein (page 1 of ‘087). Furthermore, instant SEQ ID NO: 3 is shown in alignment with the RNA equivalent of residues 2203-2228 of ‘087 (below):
GAAGGAAUCGAAGAAGAAGG – Instant SEQ ID NO: 3
GAAGGAAUCGAAGAAGAAGGCGG – RNA equivalent of residues 2203-2228 of ‘087
Note that the RNA equivalent of residues 2203-2225 are 100% identical to instant SEQ ID NO: 3, where furthermore these residues are immediately adjacent to an NGG PAM site (CGG, bold and highlighted above).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the crRNAs which target the HIV genome taught by Khalini to include targeting crRNAs to instant SEQ ID NOs 2 and 3 as taught by Rabbani and ‘087, as such a combination is the simple substitution of one know prior art element for another with predictable results. In the present case, Khalini has already taught targeting the tat gene, where furthermore the specific region is taught by Rabbani to be an effective region to target HIV, where the sequences of SEQ ID NO 2 is a 100% match to the known target region and is furthermore immediately adjacent to the required PAM site NGG to be used with the Cas9 taught by Khalini. Similarly, Khalini has also taught targeting the env gene, where SEQ ID NO 3 is simply a portion of the known env gene which is immediately adjacent to a known PAM site NGG, the PAM site used to target Cas9 to the correct position as taught by Khalini. The results are therefore predictable, where such crRNAs targeting PAM-adjacent sequences were well known in the art and could be designed by a practitioner of ordinary skill given the teachings of Khalini, Rabbani, and ‘087.
Regarding claim 33, Khalili teaches that the gRNA comprises a tracrRNA (e.g., claim 11 of Khalili).
Regarding claims 34-36, Khalili teaches that their systems/nucleic acids can include Cas9 (e.g., paragraph 26).
Regarding claim 50, Khalili teaches that their compositions can be comprised in pharmaceutically acceptable carriers (paragraph 102).
Regarding claim 72-73, Khalini teaches that the nucleic acid can be an mRNA or a vector (paragraph 68).
Claims 2-3, 70-71, and 74-77 are rejected under 35 U.S.C. 103 as being unpatentable over Khalili (US 2019/0032057 A1) in view of Rabbani (EP 2042606 A1, published 2009) and GenBank EU744087 (hereafter ‘087, GenBank Accession number EU744087, HIV Envelope protein, published 2009), as applied to claims 1, 33-36, and 50, above, and further in view of Ciaremella (WO 2015/164674 A1). The rejection is further evidenced by Millipore Sigma (Millipore Sigma product insert for product DMG PEG 2000, published 2026).
The discussion regarding Khalili, Rabbani, and ‘087 regarding claims 1, 33-36, and 50 is incorporated here.
Regarding claim 2, Khalili teaches CRISPR elements to target HIV (Abstract). Khalili teaches the use of lipid nanovesicles for the delivery of CRISPR elements (paragraphs 90, 93-94,102, 104, and 107).
Khalili does not teach that the LNPs comprise the lipids of claim 2.
Ciaremella is a patent document that teaches the use of LNPs to deliver nucleic acid payloads (Abstract). Ciaremella and Khalili therefore directly overlap in subject matter and field of endeavor because both teach the delivery of nucleic acids using nanoparticles. Ciaremella teaches known formulations of LNPs, including LNPs which can comprise cationic lipids, zwitterionic lipids, cholesterol, and PEG-lipid conjugates (page 3, fifth paragraph, page 4 first paragraph, page 669 final paragraph). Thus, formulations of LNPs as recited in claim 2 are simply known formulations of LNPs.
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the nanoparticles taught by Khalili to include a cationic lipid, zwitterionic lipid, PEG-lipid conjugate, and cholesterol, as such an LNP formulation is simply the combination of known prior art elements with predictable effect. In the present case, such LNP formulations are known LNP formulations taught by Ciaremella, who also teaches and reduces to practice LNPs to deliver nucleic acids. Thus, the combination of elements can be viewed as the simple substitution of one known prior art element (the nanoparticles of Khalili) for another (the LNPs of Ciaremella), where the results are predictable because both teach the use of LNPs to deliver nucleic acids and have been reduced to practice.
Regarding claim 3, Ciaremella teaches that the LNP can comprise DMG PEG2000, a cationic lipid (i.e., ionizable), DSPC, and cholesterol (page 4, first paragraph). As evidenced by Millipore Sigma, a post filing product insert for DMG PEG2000 which teaches an inherent characteristic of DMG PEG2000, the molecular weight of the PEG2000 in addition to DMG is ~2500 (page 1, third line from the bottom). Thus, PEG2000 in conjunction with DMG is ~2500 MW. Regarding the limitation “stabilizer,” the specification does not clearly define the term stabilizer. Ciaremella teaches that PEG and PEG-modified lipids reduce aggregation of LNPs, and therefore teaches that such PEG-modified lipids can be stabilizers (page 643, third paragraph).
Regarding claims 70-71, Ciaremella teaches that the cationic lipid is at a ratio of 40-60%, 5-25% non-cationic lipid, 0.5-15% PEG lipid, and 25-55% sterol (page 3, paragraph 5). Thus, the practitioner or ordinary skill could arrive at the presently recited formulations simply by routine optimization and experimentation, where the recited approximate ranges are known in the art and furthermore taught to be known to be adjusted (i.e., simply by teaching such ranges, Ciaremella inherently teaches that the LNP composition ratios are modular). Furthermore regarding claim 71, Ciaremella teaches both DMG-PEG (page 636) and PEG2000 (page 651, paragraph 4), and therefore teach a second PEG-lipid.
Regarding claims 74-75, all of these claim limitations are addressed above in the rejections of claims 1, 2-3, and 70-71, where the species of crRNA recited in claim 1 targets HIV. Claim 74 is reciting a broader genus of crRNA targeting HIV; therefore, the analysis of the crRNA and SEQ ID NOs 2 and 3 as recited and rejected in claim 1 is applicable to the crRNA recited in claim 74. Furthermore, as discussed above, the LNPs and their formulations are rendered obvious by the prior art, where claims 74-75 recite identical lipid formulations as recited in claims 70-71 (see rejections of claims 2-3 and 70-71).
Regarding claim 76, Ciaremella teaches that the LNP can comprise DSPE-PEG (page 674, first paragraph), where PEG can be PEG2000 (page 4, first paragraph), DOPE and cholesterol (page 641, paragraph 6), PEG-DMG (page 642, final paragraph), and DOTAP (page 686, second paragraph). Thus, the Applicant is simply reciting known components of LNPs, where such formulations are known and taught at similar ratios in compositions per Ciaremella (above).
Regarding claim 77, Khalini teaches that the nucleic acid is mRNA (paragraph 68).
Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Khalili (US 2019/0032057 A1) in view of Rabbani (EP 2042606 A1, published 2009) and GenBank EU744087 (hereafter ‘087, GenBank Accession number EU744087, HIV Envelope protein, published 2009), as applied to claims 1, 33-36, and 50, above, and further in view of Wang (Wang P et al. Adv Sci (Weinh). 2017 Sep 7;4(11):1700175).
The discussion regarding Khalili, Rabbani, and ‘087 regarding claims 1, 33-36, and 50 is incorporated here.
Regarding claim 4, Khalili teaches CRISPR elements to target HIV (Abstract). Khalili teaches the use of lipid nanovesicles for the delivery of CRISPR elements (paragraphs 90, 93-94,102, 104, and 107).
Khalili does not teach that the LNPs comprise the lipids of claim 4.
Wang is a research article that teaches the delivery of Cas9/CRISPR agents such as gRNAs using lipid nanoparticles for the effect of therapeutic treatment (Title, Abstract, and throughout). Wang and Khalili therefore overlap is subject matter because they both teach the introduction of CRISPR nucleic acids for therapy using nanoparticles. Furthermore, Wang teaches known LNP formulations that comprise DSPE-PEG2000, DOPE, cholesterol, and DOTAP (page 8 right column, second paragraph).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the nanoparticles taught by Khalili to include DSPE-PEG2000, DOPE, cholesterol, and DOTAP as taught by Wang, as such an LNP formulation is simply the combination of known prior art elements with predictable effect. In the present case, such LNP formulations are known LNP formulations taught by Wang, who also teaches and reduces to practice LNPs to deliver nucleic acids. Thus, the combination of elements can be viewed as the simple substitution of one known prior art element (the nanoparticles of Khalili) for another (the LNPs of Wang), where the results are predictable because both teach the use of LNPs to deliver nucleic acids and have been reduced to practice.
Claim 69 is rejected under 35 U.S.C. 103 as being unpatentable over Khalili (US 2019/0032057 A1) in view of Rabbani (EP 2042606 A1, published 2009) and GenBank EU744087 (hereafter ‘087, GenBank Accession number EU744087, HIV Envelope protein, published 2009), and Wang (Wang P et al. Adv Sci (Weinh). 2017 Sep 7;4(11):1700175), as applied to claims 1, 4, 33-36, and 50, above, and further in view of Finer (WO 2020/102285, A1, published 5/22/2020).
The discussion regarding Khalili, Rabbani, ‘087, and Wang regarding claims 1, 4, 33-36, and 50 is incorporated here,. Wang teaches the delivery of Cas9/CRISPR agents such as gRNAs using lipid nanoparticles for the effect of therapeutic treatment (Title, Abstract, and throughout). Wang teaches known LNP formulations that comprise DSPE-PEG2000, DOPE, cholesterol, and DOTAP (page 8 right column, second paragraph). Wang teaches coating with a PEG layer (page 2, right column, second paragraph).
Wang does not teach that the lipid comprises DMG-PEG.
Finer is a patent document which focuses on the delivery of nucleic acids using lipid nanoparticles (Title, Abstract, and throughout). Finer therefore overlaps in subject matter and field of endeavor with the presently recited prior art. Furthermore, Finer teaches that their LNPs can comprise DOTAP, DOPE, cholesterol, and can furthermore comprise DMG-PEG, where DMG-PEG can be used in combination with DSPE-PEG (paragraphs 17-20, 182). Finer further teaches that DOTAP is formulated at 50%, Cholesterol is 35% (i.e., about 30%), DOPE is at 15%, and where PEG ratios can be formulated at 1.5% (paragraph 183).
It would have been obvious to a person of ordinary skill in the art before the effective filing date to modify the LNPs taught by for instance Wang to further include DMG-PEG because such a combination is the simple combination of known prior art elements with predictable success. In the present case, Finer teaches DMG-PEG, and further teaches DSPE-PEG, DOTAP, cholesterol, and DOPE to be used in formulations with DMG-PEG, where Finer teaches similar orders of magnitude and ranges for such LNP formulations. A practitioner could therefore arrive at the presently recited ratios simply by routine optimization and design choice using known orders of magnitude of such ranges.
Additional 103 Rejection – New Rejection Necessitated by Amendment
Claims 1, 4, 33-36, 50, and 72-73 are rejected under 35 U.S.C. 103 as being unpatentable over Sullivan (Sullivan NT et al. Sci Rep. 2019 Nov 19;9(1):17088) in view of Khalili (US 2019/0032057 A1), Rabbani (EP 2042606 A1, published 2009) and GenBank EU744087 (hereafter ‘087, GenBank Accession number EU744087, HIV Envelope protein, published 2009). The rejection is further evidenced by Wang (Wang P et al. Adv Sci (Weinh). 2017 Sep 7;4(11):1700175) and Wu (Wu X et al. Quant Biol. 2014 Jun;2(2):59-70).
Regarding claim 1, Sullivan is a research article that teaches the development of gRNAs to target the long terminal repeat, LTRs, of HIV viruses (i.e., CRISPR nucleic acids complimentary to HIV, Title, Abstract, and throughout). Sullivan teaches that such targeting methods are effective at targeting HIV viruses in cells (Abstract). Sullivan teaches that nanoparticles are viable delivery vehicles to deliver gRNA payloads, and teaches that such nanoparticles have a capacity to deliver larger payloads of gRNA/CRISPR therapeutics, and are therefore advantageous (page 12, third paragraph). Here, Sullivan references Wang (reference 45 of Sullivan). Wang teaches nanoparticle delivery vessels such as lipid nanoparticles, where Wang also teaches that such lipid nanoparticles are useful for delivering gRNAs/Cas proteins (Title, Abstract, and throughout). Thus, by teaching nanoparticles for the delivery of gRNAs and referencing Wang, who teaches that the nanoparticles are lipid nanoparticles, Sullivan teaches lipid nanoparticles for the delivery of gRNAs/CRISPR nucleic acids (page 12, third paragraph of Sullivan, Title and Abstract of Wang). Furthermore, Wang teaches that the lipid nanoparticles comprises a plurality of lipids (e.g., “anionic lipid shell” and “glycol phospholipid (DSPE-PEG),” (page 2, left column, second paragraph). Furthermore, Sullivan teaches that combination of anti-LTR gRNAs and anti-gag gRNAs is an effective combination to target HIV infection. Thus, Sullivan teaches that the gRNA can be complimentary to an HIV gene (i.e., the gag gene).
Sullivan does not itself teach lipid nanoparticles but references Wang, which teaches lipid nanoparticles. Sullivan does not teach that the targets are SEQ ID NOs 2 and 3.
Khalili teaches treatment of HIV using CRISPR (Title, Abstract, and throughout). Khalili therefore directly overlaps with Sullivan. Khalini teaches CRISPR guide RNAs that are complimentary to an HIV-1 sequence (e.g., paragraph 61). Khalili teaches that the gRNA can be complimentary to a protein coding region of HIV-1 (i.e., a gene, paragraph 62). Khalili teaches the delivery of CRISPR materials with lipid nanovesicles (paragraphs 90, 93-94,102, 104, and 107). Khalili teaches that their compositions for targeting involve at least two gRNAs to target different targets, where such comprise crRNAs (e.g., see claims 1 and 11-12 of Khalili). Khalili teaches that the gRNAs comprise crRNA (e.g., claim 6 of Khali). Khalili teaches that the gRNAs can target consensus sequences found in HIV such as tat, gag, and env, paragraph 62). Khalili teaches that gRNAs can be designed based on consensus sequences of HIV-1 (paragraph 61). Khalili teaches targeting the HIV genome with gRNAs which target tat (paragraph 62). Khalili teaches that Cas9 system, which relies upon PAM site recognition of the sequence NGG (paragraph 196).
Rabbani is a patent document which focuses on the identification of targets for gene therapy to treat HIV (Abstract, and see Examples 19-26, which use antisense molecules to target HIV). Rabbani teaches that one such antisense target of the HIV genome is a portion of the tat/rev gene, where furthermore not only is this sequence a known target as taught by Rabbani, but targeting this sequence using antisense RNAs is taught by Rabbani to be an effective target for HIV (paragraph 293, “(B) the coding sequence for Tat/Rev,” where the antisense “B” is comprised in the antisense plasmid pDU1 (B), examples 27-28). Furthermore, the antisense targets were shown by Rabbani to be viable targets for the reduction of HIV (e.g., Tables 1-4). Thus, the tat/rev sequence was a known target as taught by Rabbani for targeting the HIV genome.
Furthermore, the “B” sequence (i.e., tat/rev, SEQ ID NO: 25 of Rabbani) is shown below in alignment with instant SEQ ID NO: 2:
GATCACCTTAGGCTCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGACCTCCTCAAG – SEQ ID NO: 25, Rabbani
UCUCCUAUGGCAGGAAGAAG - SEQ ID NO: 2, instant
As shown above, instant SEQ ID NO: 2 is a 100% match for the DNA equivalent of target residues of Rabbani’s SEQ ID NO: 25. Furthermore, SEQ ID NO: 2 is situated immediately upstream of an “NGG” PAM site within Rabbani’s SEQ ID NO: 25 (see bold and underlined NGG sites, above). Thus, as Khalili teaches that gRNA targets used with Cas9 are adjacent to NGG sites, and SEQ ID NO: 25 of Rabbani contains only four such NGG sites, a practitioner is selecting from only a limited number of gRNA designs (i.e., 4) when targeting the known tat/rev target site taught by Rabbani.
Regarding instant SEQ ID NO: 3, this sequence is simply a known sequence of the HIV envelope protein (env), a target region to target HIV as taught by Khalini (paragraph 62). For instance, ‘087 is a published copy of the HIV env protein (page 1 of ‘087). Furthermore, instant SEQ ID NO: 3 is shown in alignment with the RNA equivalent of residues 2203-2228 of ‘087 (below):
GAAGGAAUCGAAGAAGAAGG – Instant SEQ ID NO: 3
GAAGGAAUCGAAGAAGAAGGCGG – RNA equivalent of residues 2203-2228 of ‘087
Note that the RNA equivalent of residues 2203-2225 are 100% identical to instant SEQ ID NO: 3, where furthermore these residues are immediately adjacent to an NGG PAM site (CGG, bold and highlighted above).
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to use the gRNAs targeting for instance the HIV tat/env genes as recited in SEQ ID NOs 2 and 3 in combination with a lipid nanoparticle because such a combination is the simple combination of known prior art elements with predictable results. In the present case, Sullivan has already taught the benefit of using anti-HIV gene gRNAs to target HIV infected cells (e.g., anti-gag gRNA) and has also taught by that delivery vehicles such as nanoparticles have advantages because they allow the delivery of systems such as Cas/gRNA by referencing Wang (above). Furthermore, the it was known in the art as taught by Khalini that such lipid vesicle could be used to target multiple HIV genes including tat, env, rev, where Rabbani also teaches that SEQ ID NO: 2 is a known target which can be effectively targeted for HIV. Additionally, given that the art (Khalini) teaches that env can be targeted and ‘087 teaches a known target site within env identical to SEQ ID NO: 3 adjacent to the required PAM motif, the design of a crRNA targeting such a sequence is rendered obvious to a person of ordinary skill. The results are predictable because Wang taught and reduced to practice lipid nanoparticles comprising gRNAs and Cas proteins, where furthermore the sequences are known to be part of the HIV genome and have been taught to be targeted.
Regarding claim 4, Wang teaches that the LNP comprises DSPE-PEG2000, DOPE, cholesterol, and DOTAP (page 8 right column, second paragraph).
Regarding claim 33, Sullivan teaches that they used a sgRNA for their CRISRP Cas9 system (page 15, final paragraph). As evidenced by Wu, sgRNA for Cas9 comprises a tracrRNA (page 1, second paragraph). Thus, the sgRNA used in the Cas9 system taught by Sullivan comprises a tracrRNA.
Regarding claims 34-36, Sullivan teaches that the system comprises a Cas9 encoded on a plasmid (page 15, fourth paragraph). Sullivan also teaches that the gRNA are encoded on a plasmid (page 15, fourth paragraph). A practitioner could at once envision putting both elements onto a single nucleic acid molecule, simply by a matter of design choice, where the combination would be the combination of two known prior art elements with predictable results (i.e., the combination of two elements from separate plasmids onto one).
Regarding claim 50, Sullivan teaches that CRISPR Cas/gRNAs are known to have potential for developing novel therapies to treat HIV (page 2, third paragraph). Thus, given that Sullivan is teaching the application of their systems and methods to be used as a therapeutic, a practitioner could at once envision including the components of Sullivan in a pharmaceutically acceptable carrier, so that the components could be delivered as a therapy as taught b Sullivan.
Regarding claims 72-73, Khalini teaches that the nucleic acid can be mRNA or a vector (paragraph 68).
Claims 2-3, 70-71, and 74-77 are rejected under 35 U.S.C. 103 as being unpatentable over Sullivan (Sullivan NT et al. Sci Rep. 2019 Nov 19;9(1):17088) in view of Khalili (US 2019/0032057 A1), Rabbani (EP 2042606 A1, published 2009) and GenBank EU744087 (hereafter ‘087, GenBank Accession number EU744087, HIV Envelope protein, published 2009) as applied to claims 1, 4, 33-36, and 50, above, and further in view of Ciaremella (WO 2015/164674 A1). The rejection is further evidenced by Wang (Wang P et al. Adv Sci (Weinh). 2017 Sep 7;4(11):1700175) and by Millipore Sigma (Millipore Sigma product insert for product DMG PEG 2000, published 2026).
A discussion of Sullivan/Wang/Khalini/Rabbani/’087 is given above for the rejection of claim 1 and is reiterated here.
Sullivan/Wang teach nanoparticles for the delivery of nucleic acids such as gRNAs (page 12, third paragraph of Sullivan, Abstract of Wang). Wang teaches that the lipid nanoparticles can comprise anionic lipids, PEG/DSPE-PEG, DOTAP, cholesterol, and DOPE (page 2 left column, second paragraph). Wang teaches that DOTAP is a cationic lipid (page 4, right column, second paragraph).
Regarding claim 2, Sullivan/Wang does not teach that the LNP comprises zwitterionic lipids.
Ciaremella is a patent document that teaches the use of LNPs to deliver nucleic acid payloads (Abstract). Ciaremella and Sullivan/Wang therefore directly overlap in subject matter and field of endeavor because both teach the delivery of nucleic acids using nanoparticles. Ciaremella teaches known formulations of LNPs, including LNPs which can comprise cationic lipids, zwitterionic lipids, cholesterol, and PEG-lipid conjugates (page 3, fifth paragraph, page 4 first paragraph, page 669 final paragraph). Thus, formulations of LNPs as recited in claim 2 are simply known formulations of LNPs.
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the nanoparticles taught by Sullivan/Wang to include a cationic lipid, zwitterionic lipid, PEG-lipid conjugate, and cholesterol, as such an LNP formulation is simply the combination of known prior art elements with predictable effect. In the present case, such LNP formulations are known LNP formulations taught by Ciaremella, who also teaches and reduces to practice LNPs to deliver nucleic acids. Thus, the combination of elements can be viewed as the simple substitution of one known prior art element (the LNPs of Wang) for another (the LNPs of Ciaremella), where the results are predictable because both teach the use of LNPs to deliver nucleic acids and have been reduced to practice.
Regarding claim 3, Ciaremella teaches that the LNP can comprise DMG PEG2000, a cationic lipid (i.e., ionizable), DSPC, and cholesterol (page 4, first paragraph). As evidenced by Millipore Sigma, a post filing product insert for DMG PEG2000 which teaches an inherent characteristic of DMG PEG2000, the molecular weight of the PEG2000 in addition to DMG is ~2500 (page 1, third line from the bottom). Thus, PEG2000 in conjunction with DMG is ~2500. Regarding the limitation “stabilizer,” the specification does not clearly define the term stabilizer. Ciaremella teaches that PEG and PEG-modified lipids reduce aggregation of LNPs, and therefore teaches that such PEG-modified lipids can be stabilizers (page 643, third paragraph).
Regarding claims 70-71, Ciaremella teaches that the cationic lipid is at a ratio of 40-60%, 5-25% non-cationic lipid, 0.5-15% PEG lipid, and 25-55% sterol (page 3, paragraph 5). Thus, the practitioner or ordinary skill could arrive at the presently recited formulations simply by routine optimization and experimentation, where the recited approximate ranges are known in the art and furthermore taught to be known to be adjusted (i.e., simply by teaching such ranges, Ciaremella inherently teaches that the LNP compositions are changeable). Furthermore regarding claim 71, Ciaremella teaches both DMG-PEG (page 636) and PEG2000 (page 651, paragraph 4), and therefore teach a second PEG-lipid.
Regarding claims 74-75, all of these claim limitations are addressed above in the rejections of claims 1, 2-3, and 70-71, where the species of crRNA recited in claim 1 targets HIV. Claim 74 is reciting a broader genus of crRNA targeting HIV; therefore, the analysis of the crRNA and SEQ ID NOs 2 and 3 is applicable to the crRNA recited in claim 74. Furthermore, as discussed above, the LNPs and their formulations are rendered obvious by the prior art (see rejections of claims 2-3 and 70-71).
Regarding claim 76, Ciaremella teaches that the LNP can comprise DSPE-PEG (page 674, first paragraph), where PEG can be PEG2000 (page 4, first paragraph), DOPE and cholesterol (page 641, paragraph 6), PEG-DMG (page 642, final paragraph), and DOTAP (page 686, second paragraph). Thus, the Applicant is simply reciting known components of LNPs, where such formulations are known and taught at similar ratios in compositions per Ciaremella (above).
Regarding claim 77, Khalini teaches that the nucleic acid is mRNA (paragraph 68).
Claims 69 is rejected under 35 U.S.C. 103 as being unpatentable over Sullivan (Sullivan NT et al. Sci Rep. 2019 Nov 19;9(1):17088), Khalili (US 2019/0032057 A1), Rabbani (EP 2042606 A1, published 2009) and GenBank EU744087 (hereafter ‘087, GenBank Accession number EU744087, HIV Envelope protein, published 2009), as applied to claims 1 and 4, above, and further in view of Finer (WO 2020/102285, A1, published 5/22/2020). The rejection is further evidenced by Wang (Wang P et al. Adv Sci (Weinh). 2017 Sep 7;4(11):1700175) and Wu (Wu X et al. Quant Biol. 2014 Jun;2(2):59-70).
A discussion of Sullivan, Khalini, Rabbani, ‘087, and Wang is given above with respect to claims 1 and 4 and is incorporated here.
Wang teaches the delivery of Cas9/CRISPR agents such as gRNAs using lipid nanoparticles for the effect of therapeutic treatment (Title, Abstract, and throughout). Wang teaches known LNP formulations that comprise DSPE-PEG2000, DOPE, cholesterol, and DOTAP (page 8 right column, second paragraph). Wang teaches coating with a PEG layer (page 2, right column, second paragraph).
Wang does not teach that the lipid comprises DMG-PEG.
Finer is a patent document which focuses on the delivery of nucleic acids using lipid nanoparticles (Title, Abstract, and throughout). Finer therefore overlaps in subject matter and field of endeavor with the presently recited prior art. Furthermore, Finer teaches that their LNPs can comprise DOTAP, DOPE, cholesterol, and can furthermore comprise DMG-PEG, where DMG-PEG can be used in combination with DSPE-PEG (paragraphs 17-20, 182). Finer further teaches that DOTAP is formulated at 50%, Cholesterol is 35% (i.e., about 30%), DOPE is at 15%, and where PEG ratios can be formulated at 1.5% (paragraph 183).
It would have been obvious to a person of ordinary skill in the art before the effective filing date to modify the LNPs taught by for instance Wang to further include DMG-PEG because such a combination is the simple combination of known prior art elements with predictable success. In the present case, Finer teaches DMG-PEG, and further teaches DSPE-PEG, DOTAP, cholesterol, and DOPE to be used in formulations with DMG-PEG, where Finer teaches similar orders of magnitude and ranges for such LNP formulations. A practitioner could therefore arrive at the presently recited ratios simply by routine optimization and design choice using known orders of magnitude of such ranges.
Response to Arguments
The Applicant’s arguments filed 7/22/2026 have been considered but are not persuasive. The Applicant argues that they have amended the claims to include SEQ ID NOs 2 and 3 into independent claim 1. This argument is sufficient to overcome the 102 rejection. The Applicant argues that claim 1 now recites crRNAs SEQ ID NOs 2 and 3 to be used in combination. As an initial matter, the claims were originally construed to only require one crRNA, and the previous interpretation which only rejected the claims based on the use of one crRNA were apt because the entire claim set was originally only used language directed to one crRNA. Furthermore, with regards to the combination of crRNAs comprising SEQ ID NOs 2 and 3, it was known in the art that crRNAs were used in combinations, where furthermore the targets of SEQ ID NOs 2 and 3 were also already known. Thus, the results are both obvious and predictable. The Applicant’s amendments to the claims required the additional search of SEQ ID NO 3, which is a known sequence in HIV in the env gene, immediately adjacent to a Cas9 PAM site, where prior art references such as Khalini teach that both tat/env targets are viable targets for targeting HIV and also teaches using guide RNAs in combination (see 103 rejection, above). The Applicant’s amendments and arguments are therefore insufficient to overcome the rejections and are obvious in light of the present knowledge of the prior art.
Double Patenting – Updated in Response to Amendment
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-2, 33-36, 50, and 72-73 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-4, 7, 10-12, 14-15, 20, 28, and 35 of copending Application No. 19/113,841 (‘841, reference application) in view of . Although the claims at issue are not identical, they are not patentably distinct from each other.
Regarding ‘841, ‘841 claims the following limitations:
Regarding claim 1, claim 1 of ‘841 claims:
Claim 1. A lipid nanoparticle, comprising:(a) a shell comprising a plurality of lipids and having (i) an exterior surface comprising a CXCR4 targeting moiety linked to a PEG-lipid conjugate; and(ii) an interior surface defining an inner cavity; and (b) a CRISPR nucleic acid complementary to a sequence within an HIV-1 gene encapsulated within the inner cavity of the shell
Claim 1 of ‘841 therefore anticipates instant claim 1 because claim 1 of ‘841 recites an LNP with a CRISP nucleic acid complementary to an HIV-1 gene.
Furthermore, claim 28 of ‘841 recites SEQ ID NOs 2 and 3 which are identical to instant SEQ ID NOs 2 and 3.
Regarding claim 2, claim 2 of ‘841 claims:
Claim 2. The lipid nanoparticle of claim 1, wherein the plurality of lipids comprises cationic lipids, zwitterionic lipids, sterol, and PEG-lipid conjugates.
Claim 2 of ‘841 therefore anticipates claim 2 of the instant application.
Regarding claims 34-36, claim 32 of ‘841 claims the Cas is Cas9.
Regarding claim 50, claim 40 of ‘841 claims that the LNP is in a pharmaceutical carrier.
Regarding claims 72-73, claim 35 of ‘841 claims that the nucleic acid can be mRNA or a vector.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 3-4, 69-71, and 74-77 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-4, 7, 10-12, 14-15, 20, 28, and 35 of copending Application No. 19/113,841 (‘841, reference application), as applied to claims 1-2, 6-7, 9-10, 15, 23, 31-36, and 50, above, and further in view of Wang (Wang P et al. Adv Sci (Weinh). 2017 Sep 7;4(11):1700175), Finer (WO 2020/102285, A1, published 5/22/2020), and Ciaremella (WO 2015/164674 A1). The rejection is further evidenced by Millipore Sigma (Millipore Sigma product insert for product DMG PEG 2000, published 2026).
The discussion regarding ‘841 is incorporated herein regarding claims 1-2.
‘841 recites using LNPs in formulations with CRISPR nucleic acids targeting HIV-1 genes (claims 1-2). ‘841 does not specifically recite the LNP components of claims 3-4.
Regarding claim 3, Ciaremella teaches that the LNP can comprise DMG PEG2000, a cationic lipid (i.e., ionizable), DSPC, and cholesterol (page 4, first paragraph). As evidenced by Millipore Sigma, a post filing product insert for DMG PEG2000 which teaches an inherent characteristic of DMG PEG2000, the molecular weight of the PEG2000 in addition to DMG is ~2500 (page 1, third line from the bottom). Thus, PEG2000 in conjunction with DMG is ~2500. Regarding the limitation “stabilizer,” the specification does not clearly define the term stabilizer. Ciaremella teaches that PEG and PEG-modified lipids reduce aggregation of LNPs, and therefore teaches that such PEG-modified lipids can be stabilizers (page 643, third paragraph).
Regarding claim 4, Wang teaches that the LNP comprises DSPE-PEG2000, DOPE, cholesterol, and DOTAP (page 8 right column, second paragraph).
Regarding claim 69, Finer is a patent document which focuses on the delivery of nucleic acids using lipid nanoparticles (Title, Abstract, and throughout). Finer therefore overlaps in subject matter and field of endeavor with the presently recited prior art. Furthermore, Finer teaches that their LNPs can comprise DOTAP, DOPE, cholesterol, and can furthermore comprise DMG-PEG, where DMG-PEG can be used in combination with DSPE-PEG (paragraphs 17-20, 182). Finer further teaches that DOTAP is formulated at 50%, Cholesterol is 35% (i.e., about 30%), DOPE is at 15%, and where PEG ratios can be formulated at 1.5% (paragraph 183).
Regarding claims 70-71, Ciaremella teaches that the cationic lipid is at a ratio of 40-60%, 5-25% non-cationic lipid, 0.5-15% PEG lipid, and 25-55% sterol (page 3, paragraph 5). Thus, the practitioner or ordinary skill could arrive at the presently recited formulations simply by routine optimization and experimentation, where the recited approximate ranges are known in the art and furthermore taught to be known to be adjusted (i.e., simply by teaching such ranges, Ciaremella inherently teaches that the LNP compositions are changeable). Furthermore regarding claim 71, Ciaremella teaches both DMG-PEG (page 636) and PEG2000 (page 651, paragraph 4), and therefore teach a second PEG-lipid.
Regarding claims 74-75, all of these claim limitations are addressed above in the rejections of claims 1, 2-3, and 70-71, where the species of crRNA recited in claim 1 targets HIV. Claim 74 is reciting a broader genus of crRNA targeting HIV; therefore, the analysis of the crRNA and SEQ ID NOs 2 and 3 is applicable to the crRNA recited in claim 74. Furthermore, as discussed above, the LNPs and their formulations are rendered obvious by the prior art (see rejections of claims 2-3 and 70-71).
Regarding claim 76, Ciaremella teaches that the LNP can comprise DSPE-PEG (page 674, first paragraph), where PEG can be PEG2000 (page 4, first paragraph), DOPE and cholesterol (page 641, paragraph 6), PEG-DMG (page 642, final paragraph), and DOTAP (page 686, second paragraph). Thus, the Applicant is simply reciting known components of LNPs, where such formulations are known and taught at similar ratios in compositions per Ciaremella (above).
Regarding claim 77, claim 35 of ‘841 recites that the nucleic acid is mRNA.
It would have been obvious to a person of ordinary skill in the art to modify ’841 to include LNP components such as those taught by Wang and Ciaremella and Finer, as such a combination is the simple combination of known prior art elements to arrive at predictable results. In the present case, a practitioner could simply substitute the known LNPs recited in ‘841 for other known LNP formulations such as those taught by Wang and Ciaremella/Finer which are known to be useful to deliver nucleic acids in LNPs. The combination is predictable because ‘841, Wang, and Ciaremella all focus on LNPs which are delivering nucleic acid payloads.
Claims 1-4, 33-36, 50, and 69-77 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 83, 85-87 and 91-101, of copending Application No. 17/905,407 (‘407, reference application) in view of Sullivan (Sullivan NT et al. Sci Rep. 2019 Nov 19;9(1):17088), Wang (Wang P et al. Adv Sci (Weinh). 2017 Sep 7;4(11):1700175) Ciaremella (WO 2015/164674 A1), and Finer (WO 2020/102285, A1, published 5/22/2020). The rejection is further evidenced by Millipore Sigma (Millipore Sigma product insert for product DMG PEG 2000, published 2026).
Regarding claims 1:
Claim 83 of ‘407 claims:
Claim 83. A CRISPR/Cas system comprising at least two crRNA sequences that are not complementary to the same sequences, the CRISPR/Cas system comprising: a) a first nucleic acid comprising a first crRNA sequence complementary to a first tat consensus sequence of an HIV-1 gene and comprising the sequence selected from the group consisting of SEQ ID NOs: 1-8; and b) a second nucleic acid comprising a second crRNA sequence complementary to a second tat consensus sequence of the HIV-1 gene and comprising the sequence selected from the group consisting of SEQ ID NOs: 1-8.
SEQ ID NOs 2 and 3 of ‘407 are identical to instant SEQ ID NOs 2 and 3.
SEQ ID NO: 2, ‘407: ucuccuauggcaggaagaag
SEQ ID NO: 2, instant: ucuccuauggcaggaagaag
SEQ ID NO: 3, ‘407: gaaggaaucgaagaagaagg
SEQ ID NO: 3, instant gaaggaaucgaagaagaagg
Regarding claim 33, claim 98 of ‘407 recites that the nucleic acid comprises a tracRNA.
Regarding claims 34-36, claim 93 of ‘407 recites the Cas9 protein, where furthermore claim 94 recites that the nucleic acid components can be part of the same vector.
Regarding claim 50, claim 100 of ‘407 that the components are formulated with a pharmaceutical acceptable carrier.
Regarding the claims of ‘407, the claims, while reciting the same crRNA and CRISPR components for HIV targeting, and that such components are in a pharmaceutical carrier, do not recite that the CRISPR nucleic acid components are in a lipid nanoparticle with the instantly recited features (e.g., claims 1-4).
Regarding claim 1, Sullivan teaches gRNAs to target HIV, and therefore directly overlaps with ‘407. that nanoparticles are viable delivery vehicles to deliver gRNA payloads, and teaches that such nanoparticles have a capacity to deliver larger payloads of gRNA/CRISPR therapeutics, and are therefore advantageous (page 12, third paragraph). Here, Sullivan references Wang (reference 45 of Sullivan). Wang teaches nanoparticle delivery vessels such as lipid nanoparticles, where Wang also teaches that such lipid nanoparticles are useful for delivering gRNAs/Cas proteins (Title, Abstract, and throughout). Thus, by teaching nanoparticles for the delivery of gRNAs and referencing Wang, who teaches that the nanoparticles are lipid nanoparticles, Sullivan teaches lipid nanoparticles for the delivery of gRNAs/CRISPR nucleic acids (page 12, third paragraph of Sullivan, Title and Abstract of Wang). Furthermore, Wang teaches that the lipid nanoparticles comprises a plurality of lipids (e.g., “anionic lipid shell” and “glycol phospholipid (DSPE-PEG),” (page 2, left column, second paragraph). Furthermore, Sullivan teaches that combination of anti-LTR gRNAs and anti-gag gRNAs is an effective combination to target HIV infection. Thus, Sullivan teaches that the gRNA can be complimentary to an HIV gene (i.e., the gag gene).
Regarding claims 2, Ciaremella is a patent document that teaches the use of LNPs to deliver nucleic acid payloads (Abstract). Ciaremella and Sullivan/Wang therefore directly overlap in subject matter and field of endeavor because both teach the delivery of nucleic acids using nanoparticles. Ciaremella teaches known formulations of LNPs, including LNPs which can comprise cationic lipids, zwitterionic lipids, cholesterol, and PEG-lipid conjugates (page 3, fifth paragraph, page 4 first paragraph, page 669 final paragraph). Thus, formulations of LNPs as recited in claim 2 are simply known formulations of LNPs.
Regarding claim 3, Ciaremella teaches that the LNP can comprise DMG PEG2000, a cationic lipid (i.e., ionizable), DSPC, and cholesterol (page 4, first paragraph). As evidenced by Millipore Sigma, a post filing product insert for DMG PEG2000 which teaches an inherent characteristic of DMG PEG2000, the molecular weight of the PEG2000 in addition to DMG is ~2500 (page 1, third line from the bottom). Thus, PEG2000 in conjunction with DMG is ~2500. Regarding the limitation “stabilizer,” the specification does not clearly define the term stabilizer. Ciaremella teaches that PEG and PEG-modified lipids reduce aggregation of LNPs, and therefore teaches that such PEG-modified lipids can be stabilizers (page 643, third paragraph).
Furthermore, regarding claim 4, Wang teaches that the LNP comprises DSPE-PEG2000, DOPE, cholesterol, and DOTAP (page 8 right column, second paragraph).
Regarding claim 69, Finer is a patent document which focuses on the delivery of nucleic acids using lipid nanoparticles (Title, Abstract, and throughout). Finer therefore overlaps in subject matter and field of endeavor with the presently recited prior art. Furthermore, Finer teaches that their LNPs can comprise DOTAP, DOPE, cholesterol, and can furthermore comprise DMG-PEG, where DMG-PEG can be used in combination with DSPE-PEG (paragraphs 17-20, 182). Finer further teaches that DOTAP is formulated at 50%, Cholesterol is 35% (i.e., about 30%), DOPE is at 15%, and where PEG ratios can be formulated at 1.5% (paragraph 183).
Regarding claims 70-71, Ciaremella teaches that the cationic lipid is at a ratio of 40-60%, 5-25% non-cationic lipid, 0.5-15% PEG lipid, and 25-55% sterol (page 3, paragraph 5). Thus, the practitioner or ordinary skill could arrive at the presently recited formulations simply by routine optimization and experimentation, where the recited approximate ranges are known in the art and furthermore taught to be known to be adjusted (i.e., simply by teaching such ranges, Ciaremella inherently teaches that the LNP compositions are changeable). Furthermore regarding claim 71, Ciaremella teaches both DMG-PEG (page 636) and PEG2000 (page 651, paragraph 4), and therefore teach a second PEG-lipid.
Regarding claims 72-73 and 77, Ciaremella teaches that the nucleic acid can be an mRNA or vector (page 790, second paragraph, page 535, paragraph 5).
Regarding claims 74-75, all of these claim limitations are addressed above in the rejections of claims 1, 2-3, and 70-71, where the species of crRNA recited in claim 1 targets HIV. Claim 74 is reciting a broader genus of crRNA targeting HIV; therefore, the analysis of the crRNA and SEQ ID NOs 2 and 3 is applicable to the crRNA recited in claim 74. Furthermore, as discussed above, the LNPs and their formulations are rendered obvious by the prior art (see rejections of claims 2-3 and 70-71).
Regarding claim 76, Ciaremella teaches that the LNP can comprise DSPE-PEG (page 674, first paragraph), where PEG can be PEG2000 (page 4, first paragraph), DOPE and cholesterol (page 641, paragraph 6), PEG-DMG (page 642, final paragraph), and DOTAP (page 686, second paragraph). Thus, the Applicant is simply reciting known components of LNPs, where such formulations are known and taught at similar ratios in compositions per Ciaremella (above).
Regarding claims 77, Ciaremella teaches that the nucleic acid can be an mRNA or vector (page 790, second paragraph, page 535, paragraph 5).
Thus, Sullivan teaches a motivation to use nanoparticles such as lipid nanoparticles taught by Wang to deliver gRNAs because they are known to be useful for such purposes, where furthermore Ciaremella teaches known formulations of LNPs to be used to deliver nucleic acids such as those recited in instant claims 2-3, where Wang teaches the formulation taught in instant claim 4.
It would have been obvious to a person of ordinary skill in the art before the effective filing date to combine the crRNA components taught ‘407 with LNP formulations such as those taught and rendered obvious by Sullivan, Wang, and Ciaremella, as such a combination would be the simple combination of known prior art elements with predictable results. Furthermore, a practitioner would be motivated to use nanoparticles, and lipid nanoparticles such as those taught by Sullivan/Wang, as Sullivan has already taught that such delivery vehicles are useful to deliver gRNAs such as those recited in ‘407. Furthermore, a practitioner would be able to arrive at the embodiments of LNPs presently recited because they are simply known formulations of LNPs to be used to deliver nucleic acids such as those recited in ‘407.
Response to Arguments
The Applicant’s arguments filed 7/22/2026 have been considered but are not persuasive. Regarding ‘841, the Applicant argues that ‘841 requires the presence of a CXCR4 targeting moiety, where the present claims do not. This argument is not persuasive because the instant claims are directed to lipid nanoparticles which comprise elements. The claim is therefore drafted with open-ended language, where the addition of a moiety is encompassed by the claim. ‘841 therefore recites a species of the invention which is encompassed by the claim and therefore renders obvious the genus as a whole in light of the teachings of ‘841 and the prior art references.
The Applicant makes similar arguments with respect to the rejection using ‘407, where ‘407 is directed to Cas9 crRNA complexes and does not recite nanoparticles. This argument is not persuasive because it does not address what would be obvious to a person of ordinary skill in the art, namely, to use the teachings of ‘407 in a nanoparticle, as taught by the art. The question is whether or not a person would combine ‘407 with other teachings to render obvious the claimed invention. In light of the teachings of the art, that such Cas complexes and crRNAs were known to be delivered in payloads using LNPs, a skilled person would find it obvious to use the ’407 compositions with LNPs, as this is known in the art. Furthermore, the fact that the other references also teach other elements, such as decorated LNPs which are not recited in the present claims is irrelevant because 1) the claims are recited with open-ended language (“comprise”) and could include LNP decorations, and 2) just because the prior art teaches additional embodiments does not mean that the LNPs they teach and the compositions could not be used to deliver crRNAs. To the contrary, the prior teaches that this is the purpose of such LNPs (above).
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.C.R./Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
