Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
Election/Restrictions
Applicant’s election without traverse of Invention I, claims 4, 6 and 8-11, in the reply filed on is acknowledged.
Claims 4, 6, 8-12, 27-28, 31, 48, 55, 57, 89, 95, 146 and 148 remain pending in the current application, claims 12, 27-28, 31, 48, 55, 57, 89, 95, 146 and 148 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention.
The requirement for the restriction of Inventions I-VIII is still deemed proper and is therefore made FINAL.
Claims 4, 6 and 8-11 have been considered on the merits.
Status of the Claims
Claims 4, 6, 8-12, 27-28, 31, 48, 55, 57, 89, 95, 146 and 148 are currently pending.
Claims 12, 27-28, 31, 48, 55, 57, 89, 95, 146 and 148 have been withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Invention, there being no allowable generic or linking claim.
Claims 1-3, 5, 7, 13-26, 29-30, 32-47, 49-54, 56, 58-88, 90-94, 96-145, 147 and 149-179 are cancelled.
Claims 4, 6 and 8-11 have been considered on the merits.
Drawings
The disclosure is objected to because of the following informalities:
The drawings are objected to because of the following informalities: illegible text in illegible text in Fig. 3A and Fig. 15A-G; there is description of color in the Specification for Fig. 1 in 0037, Fig. 2 in 0038, Fig. 3 in 0039, Fig. 4 in 0040, Fig. 5 in 0041, Fig. 6 in 0042, Fig. 8 in 0044, Fig. 8 in 0044, Fig. 9 in 0045, Fig. 10 in 0046, Fig. 12 in 0048, Fig. 13 in 0049, Fig. 14 in 0050, Fig. 15 in 0051, and Fig. 16 in 0052 and the various colors cannot be distinguished from each other since the figures are in black and white.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The disclosure is objected to because of the following informalities: the use of trademarks.
The use of the terms DirectPCR® cell lysis reagent in 00256; DNeasy® Blood and Tissue Kit in 00256; RNeasy® Mini Kit in 00256; iScript™ cDNA Synthesis Kit in 00256; PrimeStar® GXL DNA Polymerase in 00256; Edit-R® in 00256; Millipore Amicon® filter unit in 00257; 2916 Teklad Global Diets® in in 00258; Leica® CM3050 cryostat in 00261; Martigel® in 00262, 00264; mTeSR™ Plus media in 00262; Accutase® in 00262; P3 Primary Cell 4D-Nucleofector® X Kit in 00262; Primocin® in in 00262; TrypLE™ Express in 00263; Microsoft Excel® in in 00265; and GraphPad Prism® Software in 00266, which are a trade names or a marks used in commerce, have been noted in this application. The terms should be accompanied by the generic terminology; furthermore the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the terms.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Appropriate correction is required.
Claim Objections
The disclosure is objected to because of the following informalities: minor grammatical error in claims.
Claim 1 is objected to because of the following informalities: the first time an acronym is utilized in a claim-set, said acronym should be spelled out in its entirety followed by said acronym in parenthesis (e.g. Duchenne muscular dystrophy (DMD)).
Appropriate corrections are appreciated.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 6 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 6 is rendered indefinite for the limitation of “wherein the gRNA comprises a targeting nucleic acid sequence selected from those disclosed in Table 3. “Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience." Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted).” See MPEP 2173.05(s).
Appropriate correction is required.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 4, 6 and 8-11 are rejected under 35 U.S.C. 103 as being unpatentable over Chang et al. (EP 3712272 A1) (ref. of record) as evidenced by BLASTN alignment (Query: SEQ ID NO: 1, Date: Sept. 17, 2026) in view of Hanson et al. (RNA Biology, published online Jan. 20, 2021).
With respect to claims 4 and 6, Chang teaches a composition containing a fusion protein containing a cytosine deaminase (cytosine base editor) that mutates the AG at the 3’splice site to AA to induce exon skipping and activating alternative splice sites, and a single-molecule guide RNA (sgRNA) to modify RNA splicing in the human Duchenne muscular dystrophy gene to repair the reading frame (0001, 0005, 0007, 0011, 0048, 0061, 0066 and 0075). Further with respect to claims 4 and 6, Chang teaches the sgRNA with the sequence of SEQ ID NO. 17 which targets exon 50 (target binding region of sgRNA DMD EXON50 S'SS), and which has 100% homology with SEQ ID NO. 11 (See Blast Alignment below, instant SEQ ID NO. 11 is Query).
Score:40.1 bits(20), Expect:2e-10, Identities:20/20(100%), Gaps:0/20(0%), Strand: Plus/Plus
Query
1
ATACTTACAGGCTCCAATAG
||||||||||||||||||||
20
Sbjct
1
ATACTTACAGGCTCCAATAG
20
It is noted that claim 6 recites that the gRNA can optionally be a single-molecule guide RNA (sgRNA) for modifying a splice site in human dystrophin gene and the term “optionally” does not require that the correction of the analysis be performed.
With respect to claim 8, Chang teaches the cytosine deaminase is linked to a CRISPR/Cas nuclease (0039). With respect to claim 9, Chang teaches the CRISPR/Cas nuclease has partial or no nuclease activity (catalytically impaired) (0040 and 0043). With respect to claims 10 and 11, Chang teaches the CRISPR/Cas nuclease is a Cas9 nuclease from Streptococcus pyogenes (spCas9) (0041-0042).
Although, Chang teaches a cytosine base editor (0005), Chang does not teach the composition where the base editor is an adenine base editor as recited in claim 4.
However, Hanson teaches a similar composition containing an ABE (adenosine deaminase base editor) packaged with a gRNA targeting an exon 20 of DMD to correct Duchenne muscular dystrophy by splice modulation (pg. 1056 para. 2-3 and Fig. 5). Hanson further teaches gRNA targeting exons 45 and 51 of DMD (Fig. 3). Hansen teaches that adenine base editor cause an adenosine to be converted to an inosine which is either read as guanosine by the case excision repair pathway allowing for an A:T to G:C base change.
Accordingly, at the effective time of filing of the claimed invention, one of ordinary skill in the art would have been motivated to modify the composition of Chang so that the base editor is an adenine base editor for the benefit of enabling an A:T to G:C base change as needed. It would have been obvious to one of ordinary skill in the art to modify the composition containing the CBE and gRNA targeting DMD, to use another base editor such as ABE which is also known to be use edited for dystrophin reading frame restoration as taught by Hanson. Furthermore, one of ordinary skill in the art would have has a reasonable expectation of success in making such a modification to the composition of Chang, since similar compositions containing base editors targeting and gRNAs were known to containing ABE as taught by Hanson.
Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the effective time of filing of the invention, especially in the absence of evidence to the contrary.
Conclusion
No claims are allowed.
Pertinent Prior Art
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
Koblan et al. "Improving cytidine and adenine base editors by expression optimization and ancestral reconstruction." Nature Biotechnology 36.9 (2018): 843-846.
Koblan teaches optimized cytidine (BE4) and adenine (ABE7.10) base editors (abstract).
Perez-Pinera et al. (US 2021/0309986 A1)
Perez-Pinera discloses a method of treating Duchenne Muscular Dystrophy in a subject comprising contacting a cell in the subject with (i) a single guide RNA (sgRNA) molecule having complementarity to a target sequence in the dystrophin gene and (ii) a cytidine deaminase base editor (0011).
Liu et al. (US 12,473,543 B2)
Liu teaches adenine base editors with gRNAs (abstract).
Examiner Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to EMILY ANN CORDAS whose telephone number is (571)272-2905. The examiner can normally be reached on M-F 9:00-5:30 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached on 571-272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EMILY A CORDAS/Primary Examiner, Art Unit 1632
Prosecution Insights