Prosecution Insights
Last updated: April 19, 2026
Application No. 18/554,972

RECOMBINANT NEWCASTLE DISEASE VIRUS RNDV-VEGF-TRAP, GENOME THEREOF, PREPARATION METHOD THEREFOR, AND USE THEREOF

Non-Final OA §103§112§DP
Filed
Oct 11, 2023
Examiner
BARRERA, IMMACULADA
Art Unit
1671
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Jiangsu Kanion Pharmaceutical Co. Ltd.
OA Round
1 (Non-Final)
32%
Grant Probability
At Risk
1-2
OA Rounds
3y 11m
To Grant
99%
With Interview

Examiner Intelligence

Grants only 32% of cases
32%
Career Allow Rate
6 granted / 19 resolved
-28.4% vs TC avg
Strong +81% interview lift
Without
With
+81.3%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
40 currently pending
Career history
59
Total Applications
across all art units

Statute-Specific Performance

§101
4.6%
-35.4% vs TC avg
§103
32.5%
-7.5% vs TC avg
§102
14.0%
-26.0% vs TC avg
§112
27.6%
-12.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 19 resolved cases

Office Action

§103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Preliminary Amendment The preliminary amendment dated 10/11/2023 has been entered. Claims 1 and 16-30 are pending and under examination. Information Disclosure Statement The submitted Information Disclosure Statement(s) (IDS) dated 10/11/1013 and 02/21/2025 have been considered by the examiner. Priority Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. The earliest possible effective filing date for the instant claims is April 13, 2021 based on the filing date of the Chinese application CN202110393844.7 Should applicant desire to obtain the benefit of foreign priority under 35 U.S.C. 119(a)-(d) prior to declaration of an interference, a certified English translation of the foreign application must be submitted in reply to this action. 37 CFR 41.154(b) and 41.202(e). Failure to provide a certified translation may result in no benefit being accorded for the non-English application. Objections – Claim and Specification Claims 17, 18, 25 and 26 are objected to because of the following informalities: “SEQ ID NO.” should be written as “SEQ ID NO:” with a colon (:). Appropriate correction is required. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. Hyperlink is found on p.11, line 10: “https://doi.org/10.1073/pnas.172398299” Appropriate correction is required. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings (Figures 9 and 10) are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. Required response – Applicant must provide: Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 16-18, 20 and 24-26 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 16 recites the limitation “The recombinant Newcastle disease virus genome of claim 1, wherein the VEGF-Trap encoding gene is in a form of DNA or RNA.” This limitation is unclear because NDV genome is a negative-sense, single-stranded RNA genome. Claims 17-18 and 24-26 are drawn to DNA sequences but it is unclear if the viral genome is DNA or RNA, because the NDV genome found in nature is an RNA molecule. Claim 18 recites the limitation “The recombinant Newcastle disease virus genome of claim 1, wherein the sequence of the recombinant Newcastle disease virus genome is set forth in SEQ ID NO. 2 or SEQ ID NO. 5.” Claim 26 recites the limitation “The pharmaceutical composition of claim 21, wherein the sequence of the recombinant Newcastle disease virus genome is set forth in SEQ ID NO. 2 or SEQ ID NO. 5.”. It is unclear what these sequences refer to. SEQ ID NO: 2 and 5 are about 18,931 nucleotides long (see below) but NDV has a non-segmented, negative-sense RNA genome that is either approximately 15,186, 15,192, or 15,198 nucleotides in length, VGEF-trap has about 1,300 to 1,400 base pairs in length, therefore additional sequences must be found in SEQ ID NO: 2 and 5 that are not viral genome sequences or VGEF-trap sequences. PNG media_image1.png 312 675 media_image1.png Greyscale PNG media_image2.png 311 773 media_image2.png Greyscale It appears that the additional sequence is the pUC57 plasmid (see alignment below). SEQ ID NO: 2 and 5 need to be clearly defined. A better description of the limitation would be “A recombinant pUC plasmid comprising a recombinant Newcastle disease virus genome…as set forth in SEQ ID NO. 2 or SEQ ID NO. 5.” defining for both sequences: the NDV genome strain, the starting and ending nucleotide positions of the viral genome, the starting and ending of nucleotide positions the VGEF-trap insert and if the F protein has been replaced, the starting and ending nucleotide positions of the F protein, the strain it belongs to and the nucleotide position in pUC57 where the rNDV vector was inserted. SEQUENCE ALIGNMENT BETWEEN SEQ ID NO: 2 AND pUC57 GenScript (pUC57 plasmid DNA, Wayback machine August 20, 2019). The mismatches are possibly due to the cloning process. Title: US-18-554-972-2 Perfect score: 18931 Sequence: 1 agttctgctatgtggcgcgg..........gcacatccccccttcgccag 18931 Scoring table: IDENTITY_NUC Database : NASEQ2_02272026_165804.seq:* ALIGNMENTS RESULT 1 NASEQ2_02272026_165804/c Query Match 9.6%; Score 1814; DB 1; Length 2710; Best Local Similarity 99.2%; Matches 1823; Conservative 0; Mismatches 15; Indels 0; Gaps 0; Qy 1 AGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2298 AGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCG 2239 Qy 61 CCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2238 CCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCT 2179 Qy 121 TACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAAGCATGAGTGATAACAC 180 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Db 2178 TACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACAC 2119 Qy 181 TGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTTCA 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Db 2118 TGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCA 2059 Qy 241 CAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2058 CAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCAT 1999 Qy 301 ACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1998 ACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACT 1939 Qy 361 ATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1938 ATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGC 1879 Qy 421 GGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1878 GGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGA 1819 Qy 481 TAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1818 TAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGG 1759 Qy 541 TAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGCAGTCAGGCAACTATGGATGAACG 600 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Db 1758 TAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACG 1699 Qy 601 AAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1698 AAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCA 1639 Qy 661 AGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1638 AGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTA 1579 Qy 721 GGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1578 GGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCA 1519 Qy 781 CTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1518 CTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCG 1459 Qy 841 CGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1458 CGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGA 1399 Qy 901 TCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1398 TCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAA 1339 Qy 961 TACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCC 1020 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1338 TACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCC 1279 Qy 1021 TACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1278 TACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTG 1219 Qy 1081 TCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAAC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1218 TCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAAC 1159 Qy 1141 GGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1158 GGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCT 1099 Qy 1201 ACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC 1260 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Db 1098 ACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC 1039 Qy 1261 GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGGAACGCCTG 1320 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Db 1038 GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTG 979 Qy 1321 GTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 978 GTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATG 919 Qy 1381 CTCGTCAGGGGGGCCGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCT 1440 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Db 918 CTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCT 859 Qy 1441 GGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 858 GGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGA 799 Qy 1501 TAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 798 TAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCG 739 Qy 1561 CAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 738 CAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGC 679 Qy 1621 GCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 678 GCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAG 619 Qy 1681 TGAGCGCAACGCAATTAATGTGAGTTACCTCACTCATTAGGCACCCCAGGCTTTACACTT 1740 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Db 618 TGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTT 559 Qy 1741 TATGCTTCCGGCTCCTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAA 1800 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Db 558 TATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAA 499 Qy 1801 CAGCTATGACCATGATTACGCCAAGCTCGGAAGCGGCC 1838 ||||||||||||||||||||||||||| | | || | | Db 498 CAGCTATGACCATGATTACGCCAAGCTTGCATGCAGGC 461 Claim 20 recites the limitation “…the starting strain….”. There is insufficient antecedent basis for the “the starting strain” limitation to identify which of the potential starting NDV strains it refers to. In addition, the recited Markush groups are unclear. For example, it is not clear that they mean “low virulent” to be selected from “LaSota, Hitchner B1, or V4”, etc. For purposes of expedited prosecution, claim 20 has been interpreted as: “The recombinant Newcastle disease virus of claim 19, wherein a starting strain of the Newcastle disease virus is selected from a low, medium, or high virulent strain or a chimeric strain, wherein the low virulent strain is LaSota, Hitchner B1, or V4; wherein the medium virulent strain is Mukteswar or Anhinga; and wherein the high virulent strain is F48E9, JS/7/05/Ch, Italien, Herts/33, or NDV-BJ.” Appropriate corrections are required. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 16-30 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. In making a determination of whether the application complies with the written description requirement of 35 U.S.C. 112, first paragraph, it is necessary to understand what Applicant has possession of and what Applicant is claiming. The instant claims are drawn to a recombinant Newcastle disease virus (NDV) genome, wherein the genome comprises a VEGF-Trap encoding gene, and, wherein the VEGF-Trap encoding gene is located between P gene and M gene of the NDV genome and a recombinant NDV virus (rNDV), wherein the virus comprises the rNDV genome. This rNDV, wherein a starting strain of the NDV is selected from a low virulent strain LaSota, Hitchner B1, or V4; a medium virulent strain Mukteswar, or Anhinga; a high virulent strain F48E9, JS/7/05/Ch, Italien, Herts/33, or NDV-BJ; or any chimeric strain based on the starting strain, and pharmaceutical compositions thereof. These rNDVs and rNDV genomes are capable of treating or inhibiting cancer, which encompasses a genus of agents. Claims 16-30 are dependent from claim 1 and do not materially limit the genus of agents, especially regarding the nature of the rNDVs and rNDV genomes and which strains and combination of strains, or chimeric strains based on the starting strains, and all the corresponding genomes, and of all these possibilities which rNDVs or rNDV genomes would be the ones capable of treating or inhibiting cancer and are therefore included in the rejection. These claims do not require that the genus of the claims possess any particular structure or other distinguishing feature that is characteristic of the genus as a whole. Therefore, the claims are drawn to a genus of “rNDV and rNDV genomes capable of treating cancer” for which there is inadequate written description. In addition a sequence inserted (in this case a sequence at least 80% identical to SEQ ID NO: 1) between the P and M genes needs to take into account “the rule of six”. Not any sequence can be inserted and lead to a functional virus unless the sequence has the proper length. Huang (A recombinant Newcastle disease virus (NDV) expressing VP2 protein of infectious bursal disease virus (IBDV) protects against NDV and IBDV. J Virol. 2004 Sep;78(18):10054-63) teaches in Fig. 1 that the replacement of an entire section is possible when making sure the length of the replacement adheres to the “rule of 6”. Peeters (Genome replication of Newcastle disease virus: involvement of the rule-of-six. Arch Virol. 2000;145(9):1829-45) teaches that if the final engineered genome length is not a multiple of six, the virus will not be properly encapsidated, resulting in poor or no recovery of the recombinant virus. Studies have shown that while some non-multiples of six can be rescued, they do so less efficiently and may not be stable over several passages. (title and entire article). So the art frequently replaces the entire set of nucleotides 1-for-1 to ensure efficient replication. Moreover, there is inadequate written description as to which cancer, including any of the cancers listed in instant claim 30, will actually be treated successfully by any of the thousands of rNDV and rNDV genomes claimed. The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice (see MPEP 2163(II)(3)(a)(i)(A), reduction to drawings MPEP 2163(II)(3)(a)(i)(B), or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus MPEP 2163(II)(3)(a)(i)(C). In the instant case, the only identifying characteristic present in the claim is a recitation of requisite activity (------------------capable of treating and inhibiting cancer). There is not even identification of any particular portion of a structure that must be conserved for said activity or even which type of cancer could be effectively treated.. Regarding the genus of the claims the specification describes two specific species within the genus claimed. One species was constructed by recombining the plasmids pUC57-VEGF-Trap with pBrNDV (applicant discloses pBrNDV was purchased from NEB although it is not in the current catalog) to obtain pBrNDV-VEGF-Trap expressing rNVD-VGEF-Trap (page 11) and the other one was an oncolytic virus rClone30-Anh-(F) obtained via the following modification: starting from the NDV LaSota strain (purchased from Harbin Veterinary Epidemic Prevention Station), replacing F gene of the LaSota strain with F gene of the medium virulent strain Anhinga of NDV (page 18). Only the rClone30-Anh-(F) virus was tested for tumor size reduction in a H22 tumor-bearing liver model. From the specification, it is clear that Applicant is in possession of species of these two species and that a model for liver cancer was used for cancer treatment. The claims, however are not limited to those species but also includes hundreds of rNDVs and rNDV genomes from different strains and chimeric rNVDs and rNDV genomes and the specification fails to provide a representative number of species within the recited genus. In addition only liver cancer was tested among the hundreds of different types of cancers claimed. Accordingly, in the absence of sufficient recitation of distinguishing identifying characteristics, or representative number of species, the specification does not provide adequate written description of the claimed genus for treating any cancer. Claims 28-30 are rejected under 35 U.S.C. § 112 (a), or 35 U.S.C. § 112 (pre-AIA ) first paragraph, because the specification, while being enabling for a method of treating colon and liver cancer in an animal model using a rNDV LaSota strain with a replaced F gene from F48E9 strain and a VGEF-Trap insert, it does not reasonably provide enablement for a method of treating and inhibiting cancer. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims. The instant specification fails to provide information that would allow the skilled artisan to fully practice the instant invention without undue experimentation. Attention is directed to In re Wands, 8 USPQ2d 1400 (CAFC 1988) at 1404 where the court set forth the eight factors to consider when assessing if a disclosure would have required undue experimentation. Citing Ex parte Forman, 230 USPQ 546 (BdApls 1986) at 547 the court recited eight factors: (1) the nature of the invention; (2) the state of the prior art; (3) the relative skill of those in the art; (4) the predictability or unpredictability of the art; (5) the breadth of the claims; (6) the amount of direction or guidance presented; (7) the presence or absence of working examples; and (8) the quantity of experimentation necessary. All of the Wands factors have been considered with regard to the instant claims, with the most relevant factors discussed below. Nature of the invention: Claims 28-30 of the instant application are drawn to a method of treating and inhibiting cancer in a subject, the method comprising administering to a subject in need thereof the recombinant Newcastle disease virus genome, wherein the genome comprises a VEGF-Trap encoding gene, and, wherein the VEGF-Trap encoding gene is located between P gene and M gene of the Newcastle disease virus genome. Breadth of the claims: The complex nature of the subject matter of this invention is greatly exacerbated by the breadth of the claims. The rejected claims are extremely broad. Applicant claims that the rNDV of the instant application can treat or inhibit ANY cancer. State of the Prior Art: While the state of the art with regard to the treatment of cancer is relatively high, the state of the art with regard to the inhibition (which can be also interpreted as prevention) of cancer is underdeveloped. This is because there would be no way to determine that cancer would have predictably occurred (inhibited) without treatment. Regarding prevention/inhibition of cancer, the American Cancer Society maintains that “There's no sure way to prevent cancer, but you can help reduce your risk by making healthy choices like eating right, staying active, and not smoking” (American Cancer Society. Cancer Risk and Prevention. https://www.cancer.org/cancer/risk-prevention.html). Predictability/Unpredictability in the Art: It is noted that the art is unpredictable, requiring each embodiment to be individually assessed for physiological activity in treating or preventing diseases. In re Fisher, 427 F.2d 833, 166 USPQ 18 (CCPA 1970) indicates that the more unpredictable an area is, the more specific enablement is necessary in order to satisfy the statute. In the instant case, the instant claimed invention is highly unpredictable since one skilled in the art would recognize that the recitation encompasses the inhibition of cancer and treating subjects that could be at risk of developing and those subjects suspected of having cancer. Thus, the skilled artisan would view that the treatment or inhibition of any cancer encompassed by the claims is highly unpredictable. Guidance of the Specification/Working Examples: Applicant has only provided working examples for the method of treating colon and liver cancer in an animal model using a rNDV LaSota strain with a replaced F gene from F48E9 strain and a VGEF-Trap insert . Thus, the specification fails to provide sufficient evidence in support of prevention of those suspected of having or at risk of developing any type of cancer and recited in the instant claims. Additionally, the examples provided do not demonstrate the prevention of any type of cancer. Additionally, the disclosure does not discuss, or demonstrate through working examples, a method that could be used to determine that recurrence of diseases/disorders was inhibited using the claimed agents as there is no disclosed method to determine that recurrence of any cancer would have predictably occurred without treatment. The Quantitation of Experimentation Required: In order to practice Applicants invention, it would be necessary for one to design and conduct an exhaustive amount of complex experiments to demonstrate that the claimed compounds could be administered to a subject at risk of developing cancer. The population of subjects could include any subject, and thus the quantitation of experimentation is unreasonably large. Therefore, in order to practice the claimed invention, the amount of experimentation required would be considered undue and burdensome. In conclusion, Genentech, 108 F.3d at 1366, states that “a patent is not a hunting license. It is not a reward for search, but compensation for its successful conclusion” and “[p]atent protection is granted in return for an enabling disclosure of an invention, not for vague intimations of general ideas that may or may not be workable”. The treatment or inhibition of any cancer is not enabled by the instant specification. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 4. Claims 1, 16-17, 19-25, and 27-30 are rejected under 35 U.S.C. 103 as being unpatentable over Liao (CN109627336A, machine generated translation, published 4/16/2019, IDS citation: Foreign patent application 2) in view of Liu (WO 2022/217110 A1, priority date April 09, 2021) and Skobe (US2023/0151070A1 Priority date 02/27/2020) Liao teaches a recombinant LaSota Newcastle disease virus (NDV), (instant claim 19) wherein the F (fusion) protein from the LaSota strain has been replaced with an F protein from a “strong strain” NDV (rNDV) ([0020], the “strong strain” language has been interpreted as a more virulent strain than the LaSota strain) as required by instant claim 20. Liao also teaches that the (wild-type) LaSota strain NDV does not have oncolytic ability but the rNDV, created by the replacement of the LaSota F protein by an F protein from a virulent strain, has oncolytic activity [0020]. Oncolytic viruses can infect tumor cells, replicate and proliferate in tumor cells, eventually leading to the death of host tumor cells. Oncolytic viruses are released to continue infecting and killing other tumor cells, thereby playing a role in clearing tumors (first paragraph in [0005]). The LaSota strain is a vaccine strain with low oncolytic ability and can only infect locally. It can be used as an optimal vector for preparing new oncolytic viruses [0006]. Therefore, the increase of oncolytic activity of the rNDV can function as (a) treating a tumor; (b) inhibiting tumor cell proliferation; and/or (c) killing tumor cells as required by instant claims 28 and 29. Liao also teaches their rNDV can be used for treatment of lung cancer [0002] (instant claim 30). Liao teaches the insertion of an exogenous gene (in this case, a gene encoding a PDL-1 antibody) between the P and M protein genes of the rNDV thereby increasing the clinical effect of the virus in treating tumors [0020] as required in instant claim 1 and 28-29. Liao does not teach that the exogenous gene to be inserted is VEGF-trap or SEQ ID NO: 1. Liu teaches that Aflibercept (VEGF-Trap) is a recombinant fusion protein that acts as a decoy receptor for vascular endothelial growth factor subtypes A (VEGF-A), VEGF-B, and placental growth factor (PIGF). By binding to these ligands, aflibercept is able to prevent these ligands from binding to vascular endothelial growth factor receptors (VEGFR), VEGFR-1 and VEGFR-2, to suppress neovascularization and decrease vascular permeability. Aflibercept consists of domain 2 of VEGFR-1 and domain 3 of VEGFR-2 fused with the Fc fragment [0003] Several gene therapy studies using AAV vectors (the viral genome) carrying the coding sequence for VEGF-Trap (that is the DNA as required by instant claim 16) has been investigated for long term treatment of the neovascularization (that is inhibiting neovascularization helps reduce tumor size).[0004] (instant claims 1 and 28). Liu also disclosed a plurality of adeno-associated viral (AAV) particles comprising the isolated, non-naturally occurring nucleic acid (claim 93) as required by instant claims 19- 20, 23 and 29. The pharmaceutical compositions can also comprise an excipient. Such excipients, carriers, diluents, and buffers include any pharmaceutical agent that can be administered without toxicity [0163] as required by instant claims 21-25 and 27). Liu also teaches a method of treating a disease, which, based on the VGEF-trap mechanism of action described above, includes cancer (instant claim 28-29). Liu also teaches a sequence comprising VGEF-Trap with more than 80% identity (instant claims 1, 16-17, 24-25), (see below) SEQUENCE ALIGNMENT BETWEEN CLAIMED SEQ ID NO: 1 AND LIU’S SEQ ID NO: 20 Title: US-18-554-972-1 Sequence: 1 tccccgcggggagccaccat..........cgggtagaaggtttaaaccc 1410 PCT-US22-24101-20 Sequence 20, PC/TUS2224101 GENERAL INFORMATION APPLICANT: AVIRMAX, INC. TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR OCULAR TRANSGENE EXPRESSION FILE REFERENCE: 59561-703.601 CURRENT APPLICATION NUMBER: PCT/US22,24101 CURRENT FILING DATE: 2022-04-08 PRIOR APPLICATION NUMBER: 63/173,280 PRIOR FILING DATE: 2021-04-09 NUMBER OF SEQ ID NOS: 70 SEQ ID NO 20 LENGTH: 6968 TYPE: DNA Query Match 92.0%; Score 1297.8; Length 6968; Best Local Similarity 99.1%; Matches 1305; Conservative 0; Mismatches 12; Indels 0; Gaps 0; Qy 74 CTGGTAGTGATACAGGTAGACCTTTCGTAGAGATGTACAGTGAAATCCCCGAAATTATAC 133 | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1595 CAGGTTCAGATACAGGTAGACCTTTCGTAGAGATGTACAGTGAAATCCCCGAAATTATAC 1654 Qy 134 ACATGACTGAAGGAAGGGAGCTCGTCATTCCCTGCCGGGTTACGTCACCTAACATCACTG 193 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1655 ACATGACTGAAGGAAGGGAGCTCGTCATTCCCTGCCGGGTTACGTCACCTAACATCACTG 1714 Qy 194 TTACTTTAAAAAAGTTTCCACTTGACACTTTGATCCCTGATGGAAAACGCATAATCTGGG 253 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1715 TTACTTTAAAAAAGTTTCCACTTGACACTTTGATCCCTGATGGAAAACGCATAATCTGGG 1774 Qy 254 ACAGTAGAAAGGGCTTCATCATATCAAATGCAACGTACAAAGAAATAGGGCTTCTGACCT 313 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1775 ACAGTAGAAAGGGCTTCATCATATCAAATGCAACGTACAAAGAAATAGGGCTTCTGACCT 1834 Qy 314 GTGAAGCAACAGTCAATGGGCATTTGTATAAGACAAACTATCTCACACATCGACAAACCA 373 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1835 GTGAAGCAACAGTCAATGGGCATTTGTATAAGACAAACTATCTCACACATCGACAAACCA 1894 Qy 374 ATACAATCATAGATGTGGTTCTGAGTCCGTCTCATGGAATTGAACTATCTGTTGGAGAAA 433 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Db 1895 ATACAATCATAGATGTCGTTCTGAGTCCGTCTCATGGAATTGAACTATCTGTTGGAGAAA 1954 Qy 434 AGCTTGTCTTAAATTGTACAGCAAGAACTGAACTAAATGTGGGGATTGACTTCAACTGGG 493 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1955 AGCTTGTCTTAAATTGTACAGCAAGAACTGAACTAAATGTGGGGATTGACTTCAACTGGG 2014 Qy 494 AATACCCTTCTTCGAAGCATCAGCATAAGAAACTTGTAAACCGAGACCTAAAAACCCAGT 553 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2015 AATACCCTTCTTCGAAGCATCAGCATAAGAAACTTGTAAACCGAGACCTAAAAACCCAGT 2074 Qy 554 CTGGGAGTGAGATGAAGAAATTTTTGAGCACCTTAACTATAGATGGTGTAACCCGGAGTG 613 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2075 CTGGGAGTGAGATGAAGAAATTTTTGAGCACCTTAACTATAGATGGTGTAACCCGGAGTG 2134 Qy 614 ACCAAGGATTGTACACCTGTGCAGCATCCAGTGGGCTGATGACCAAGAAGAACAGCACAT 673 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2135 ACCAAGGATTGTACACCTGTGCAGCATCCAGTGGGCTGATGACCAAGAAGAACAGCACAT 2194 Qy 674 TTGTCAGGGTCCATGAAAAAGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAAC 733 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2195 TTGTCAGGGTCCATGAAAAAGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAAC 2254 Qy 734 TCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCT 793 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2255 TCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCT 2314 Qy 794 CCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCA 853 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2315 CCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCA 2374 Qy 854 AGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGCGAGG 913 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Db 2375 AGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGG 2434 Qy 914 AGCAGTACAACAGCACGTACCGGGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGC 973 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Db 2435 AGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGC 2494 Qy 974 TGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGA 1033 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2495 TGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGA 2554 Qy 1034 AAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCAT 1093 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2555 AAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCAT 2614 Qy 1094 CCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATC 1153 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2615 CCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATC 2674 Qy 1154 CCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCA 1213 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2675 CCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCA 2734 Qy 1214 CGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACA 1273 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2735 CGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACA 2794 Qy 1274 AGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACA 1333 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2795 AGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACA 2854 Qy 1334 ACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAATGATTAAGAAAAAATA 1390 |||||||||||||||||||||||||||||||||||||||||||||| ||| || | Db 2855 ACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAATGATTCGAAAATAAAA 2911 Skobe teaches oncolytic viruses for the treatment of cancer (title) including a rNDV Lasota strain with a mVGEF-C (a member of the family of VGEF factors involved in angiogenesis which also include VGEF-A and VGEF-B [0004] that are part of VGEF-Trap) (RNA as per instant claim 16) inserted between the P and M proteins. (Fig. 2 see below) (instant claim 1). Skobe also discloses the sequence of such a rNDV with the mVGEF-C insert (SEQ ID NO; 88) the protocol used for the construction of the plasmid pNDV-LaSota-L289AmVEGF-C [0037], pharmaceutical compositions and excipients [0205] and can treat many cancers such as melanoma [0262] (instant claims 21-30) : PNG media_image3.png 903 601 media_image3.png Greyscale It would have been obvious to one of ordinary skill in the art to combine Liao and Liu and Stokes to construct an oncolytic rNDV vector, wherein the F protein is derived from a more virulent NDV strain than the starting strain as taught by Liao and to insert an exogenous gene involved in the VEGF pathway into this oncolytic rNDV vector as taught by Liu (VGEF-Trap in an AAV vector) or by Stokes (a VEGF-C in an rNDV vector) as required by the instant application. One of ordinary skill would have been motivated to do so because a more virulent strain of NDV would be more effective as an oncolytic virus (Liao) and the VGEF pathway is widely recognized as relevant for an effective and practical therapy for cancer immunotherapy as disclosed by both Liu and Stokes. There would be a reasonable expectation of success because an rNDV oncolytic vector and a molecule involved in the VEGF pathway that can inhibit angiogenesis (and thus reduce tumor size) are known to be effective strategies to fight cancer and successful therapies involving VGEF-Trap are already found in clinical trials and in the market place. From the combined teachings of the references, it is apparent that one of ordinary skill in the art would have had a reasonable expectation of success in producing the claimed invention. Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the time the invention was made, as evidenced by the references, especially in the absence of evidence to the contrary. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 17-20 and 28 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 15 and 24 of copending application No. 17/914,868 over Liao, Liu, Skobe and Bartee (Cancer Res; 77(11) June 1, 2017). The claims of 18/554,972 are drawn to the rNDV vector with a low virulent (such as LaSota) F protein being replaced by the F protein of a more virulent strain and with VGEF-Trap inserted into the vector as required by instant claim 1, 17-20 and this rNDV with the VGEF-Trap insert is used in a method to treat or inhibit cancer (instant claim 28). The claims of 17/914,868 are drawn to the rNDV vector with the LaSota F protein being replaced by the F protein of a more virulent strain and with PD-1 inserted into the vector as required by claim 15. This rNDV with the PD-1 insert functions as treating a tumor, inhibiting a tumor cell proliferation and killing tumor cells (which reads on a method of treating and inhibiting cancer). The teachings of Liao, Liu and Skobe have been discussed above and incorporated herein, including but not limited to the disclosure of a rNDV inserted with members of the VGEF family and a method of treating a disease, which, based on the VGEF-trap mechanism of action (inhibiting neovascularization helps reduce tumor size), includes cancer and members of the PDL-1 and PD-1 family being inserted in the rNDV vector are also known to help reduce tumors. Bartee teaches the combination of virus with an inserted PD-1 and that PD-1 blockade was capable of inducing long-term tumor regression (that is reducing tumor size) (page 2955, first column first paragraph). It would have been obvious to combine the teachings of Liao, Liu and Skobe with Bartee and substitute PD-1 with VGEF-Trap in a rNDV vector to generate an oncolytic rNDV vector with any insert to treat cancer. The artisan would have been motivated to do so because both inserts, VGEF-Trap and PD-1 are known to reduce tumor size and thus treat or inhibit cancer. There would be a reasonable expectation of success because standard recombinant DNA technology has been successfully used for decades and both, VGEF and PD-1 have been successful in reducing tumor size in animal models. From the combined teachings of the references, it is apparent that one of ordinary skill in the art would have had a reasonable expectation of success in producing the claimed invention. Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the time the invention was made, as evidenced by the references, especially in the absence of evidence to the contrary. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Claims 1, 17-20 and 28 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 13, 17-19 and 24 of copending application No. 17/914,882 over Liao, Liu, Skobe , Li (CN104357409, machine generated translation, published 2/18/2015), and AB451325 (GenBank AB451325: Homo sapiens IL2 mRNA for interleukin 2 precursor, complete cds, PRI 02-SEP-2008, https://www.ncbi.nlm.nih.gov/nuccore/AB451325), The claims of 18/554,972 are drawn to the rNDV vector with a low virulent (such as LaSota) F protein being replaced by the F protein of a more virulent strain and with VGEF-Trap inserted into the vector as required by instant claim 1, 17-20, and this rNDV with the VGEF-Trap insert is used in a method to treat or inhibit cancer (instant claim 28). The 17/914,882 claims are drawn to the rNDV vector with the LaSota F protein being replaced by the F protein of the Anhinga strain which in is more virulent than the LaSota and with hIL-2 inserted into the vector (claim 13). The teachings of Liao, Liu and Skobe have been discussed above and incorporated herein, including but not limited to the disclosure of a rNDV inserted with members of the VGEF family and a method of treating a disease, which, based on the VGEF-trap mechanism of action (inhibiting neovascularization helps reduce tumor size), includes cancer. Li discloses a NDV strain and methods for generating a recombinant pBrLosata plasmid (Li, para 1-14). Li discloses SEQ ID NO: 3, which is a pBrLosata plasmid that contains an exogenous gene (chicken IL2) between a P and M gene of the recombinant NDV genome (Li, claim 2). AB451325 teaches the human IL-2 sequence. It would have been obvious to combine the teachings of Liao, Liu and Skobe with Li and AB451325 and substitute hIL-2 with VGEF-Trap in a rNDV vector to generate an oncolytic rNDV vector with any insert capable of treating cancer. It would have been a matter of combining prior art elements according to known methods to yield predictable results since the sequence of the NDV LaSota strain genome, the anhinga F protein gene, the sequence of hIL-2, the sequence of VGEF-Trap and the sequence of pBR322 were known in the art and Liao teaches the engineering of the viral vector with the F protein from LaSota being swapped by a more virulent F protein to increase the oncolytic properties as discussed above. In addition, there are predictable means for generating recombinant plasmids following standard recombinant DNA methods known for decades and commonly used in labs all over the world. The artisan would have been motivated to do so because both inserts, IL-2 and VGEF-Trap are known to reduce tumor size and thus treat or inhibit cancer. There would be a reasonable expectation of success because standard recombinant DNA technology has been successfully used for decades and both, Il-2 and PD-1 have been successful in reducing tumor size in animal models. From the combined teachings of the references, it is apparent that one of ordinary skill in the art would have had a reasonable expectation of success in producing the claimed invention. Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the time the invention was made, as evidenced by the references, especially in the absence of evidence to the contrary. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to IMMA BARRERA whose telephone number is (571) 272-0674. The examiner can normally be reached Monday - Friday 9 to 5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Michael Allen can be reached on (571) 270-3497. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /IMMA BARRERA/ Examiner, Art Unit 1671 /RACHEL B GILL/Primary Examiner, Art Unit 1671
Read full office action

Prosecution Timeline

Oct 11, 2023
Application Filed
Mar 12, 2026
Non-Final Rejection — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595313
MODIFIED FC-REGIONS TO ENHANCE FUNCTIONAL AFFINITY OF ANTIBODIES AND ANTIGEN BINDING FRAGMENTS THEREOF
2y 5m to grant Granted Apr 07, 2026
Patent 12552866
INTERNALIZING BINDING MOLECULES TARGETING RECEPTORS INVOLVED IN CELL PROLIFERATION OR IN CELL DIFFERENTIATION
2y 5m to grant Granted Feb 17, 2026
Patent 12545746
ANTI-BCMA CAR ANTIBODIES, CONJUGATES, AND METHODS OF USE
2y 5m to grant Granted Feb 10, 2026
Patent 12527843
IMMUNE-CELL TARGETED BISPECIFIC CHIMERIC PROTEINS AND USES THEREOF
2y 5m to grant Granted Jan 20, 2026
Patent 12441789
DLL3-TARGETING ANTIBODIES AND USES THEREOF
2y 5m to grant Granted Oct 14, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
32%
Grant Probability
99%
With Interview (+81.3%)
3y 11m
Median Time to Grant
Low
PTA Risk
Based on 19 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month