DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s amendments field May 15, 2026, amending claims 3-6, is acknowledged. Claims 1-12 are pending and under examination.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. The effective filing date of the claimed invention is April 13, 2021.
Drawings
The drawings are objected to for two reasons.
First, the drawings were submitted in color, but there is no granted petition to accept color drawings. See 37 CFR 1.84(a)(2) (“The Office will accept color drawings in utility patent applications only after granting a petition filed under this paragraph explaining why the color drawings are necessary”). Applicants must either provide that explanation via a petition and comply with all requirements of 37 CFR 1.84(a)(2)(i)-(iii) OR submit replacement sheets in black and white and include a clear instruction to replace the color drawings with the replacement sheets. The examiner takes no position on whether color drawings are necessary as the only practical medium by which to disclose the subject matter sought to be patented in this utility patent application.
Second, the lines, shadings, numbers and letters of FIGs 2 and 4-17 are not sufficient to provide satisfactory reproduction characteristics. 37 CFR 1.84(l) states that “all drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.” In the instant case, the text in the FIGs listed above is light grey, very small, poor resolution and/or otherwise not sufficiently dense and dark to permit satisfactory reproduction characteristics.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-12 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 1, 7 and 11 recite “preferably” and then a species or range within a previously recited genus within the claim, which renders the claim indefinite. It is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Claims 2-12 are also rejected for depending from claim 1 and not remedying the indefiniteness.
Claim 10 recites “Use or the RNA inhibitor… according to claim1 in preparation of a medicament for treatment of a hepatogenic disease…” While the claim provides for the "use” of the RNA inhibitor, the claim does not set forth any steps involved in the method/process, and thus it is unclear what method/process they are intending to encompass. A claim is indefinite where it merely recites a use without any active, positive steps delimiting how this use is actually practiced. Note MPEP 2173.05(q), which states “' Use” claims that do not purport to claim a process, machine, manufacture, or composition of matter fail to comply with 35 U.S.C. 101”, which is explained below.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 10 is rejected under 35 U.S.C. 101 because the claimed recitation of a use/usage, without setting forth any steps involved in the process, results in an improper definition of a process, i.e. results in a claim which is not a proper process claim under 35 USC 101. See for example Ex parte Dunki, 153 USPQ 678 (Bd. App. 1967) and Clinical Products, Ltd. V. Brenner, 255 F. Supp. 131, 149 USPQ 475 (D.D.C. 1966).
Claim Rejections - 35 USC § 102 - Morrissey
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-3, 5 and 10-12 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Morrissey (US 20030206887 A1).
Regarding claim 1, Morrissey teaches an HBV-targeting siRNA (i.e., a RNA inhibitor of inhibiting gene expression of HBV) having a sense strand with SEQ ID NO 300, which is 19 nucleotides, and an antisense strand having SEQ ID NO 946, which is 19 nucleotides (Table II).
Regarding claim 2, the second and third limitations recite “may be replaced” and “may be thiolated”, and therefore are interpreted as being optional. Morrissey teaches the sequence of SEQ ID NOs 300 and 946, which are 100% complementary to each other (Table II).
Regarding claim 3, Morrissey’s siRNAs sense strand comprising SEQ ID NO 300, differs from the claimed sense strand with SEQ ID NO 1 by one nucleotide as shown below with differences bolded. Morrissey’s siRNA antisense strand comprising SEQ ID NO 946 differs from the claimed sense strand with SEQ ID NO 2 by three nucleotide as shown below with differences bolded.
Morrissey SEQ 300: GGGUUUUUCUUGUUGACAA SEQ 946: UUGUCAACAAGAAAAACCC
Claimed SEQ 1: GGGUUUUUCUCGUUGACAA SEQ 2: UUGUCAACGAGAAAAACCCUU
Regarding claim 5, Morrissey’s siRNAs sense strand comprising SEQ ID NO 300 is 100% identical to the claimed sense strand with SEQ ID NO 3 as shown below. Morrissey’s siRNA antisense strand comprising SEQ ID NO 946 differs from the claimed sense strand with SEQ ID NO 4 by two nucleotides as shown below with differences bolded.
Morrissey SEQ 300: GGGUUUUUCUUGUUGACAA SEQ 946: UUGUCAACAAGAAAAACCC
Claimed SEQ 3: GGGUUUUUCUUGUUGACAA SEQ 2: UUGUCAACAAGAAAAACCCUU
Regarding claim 10, Morrissey teaches using the HBV-targeting siRNAs for treating HBV infections (i.e., hepatitis) ([0047]).
Regarding claim 11, “the dosage form of which is an oral agent…” is interpreted as limiting the pharmaceutical auxiliary material only when a dosage form is required. Since the claim does not appear to require any specific form or dosage of the composition, any pharmaceutical composition comprising at least the siRNA and a pharmaceutically acceptable auxiliary material, reads on the claimed composition. Morrissey teaches the siRNAs with a pharmaceutically acceptable carrier or diluent (i.e., a pharmaceutically acceptable auxiliary material) ([0118]).
Regarding claim 12, Morrissey teaches combining the siRNA with another therapeutic drug ([0118]), which includes interferon and nucleoside analogs ([0038]).
Claim Rejections - 35 USC § 102 - Lu
Claims 1-3, 5, 7 and 10-11 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Lu (CN 110846320 A, published February 28, 2020, English translation included for reference to point citations).
Regarding claim 1, Lu teaches an HBV-targeting siRNA (i.e., a RNA inhibitor of inhibiting gene expression of HBV) having a sense strand with SEQ ID NO 208, which is 19 nucleotides, and an antisense strand having SEQ ID NO 2 and an additional 3’ overhang comprising TT, UU or UA, which is 21 nucleotides ([0025]-[0026]).
Regarding claim 2, the second and third limitations recite “may be replaced” and “may be thiolated”, and therefore are interpreted as being optional. Lu teaches the sequence of SEQ ID NOs 208 and 2, which are 100% complementary to each other ([0026]).
Regarding claim 3, Lu’s siRNAs sense strand comprising SEQ ID NO 208, differs from the claimed sense strand with SEQ ID NO 1 by one nucleotide as shown below with differences bolded. Lu’s siRNA antisense strand comprising SEQ ID NO 2 with the UU 3’ overhang differs from the claimed sense strand with SEQ ID NO 2 by one nucleotide as shown below with differences bolded.
Lu SEQ 208: GGGUUUUUCUUGUUGACAA SEQ 2: UUGUCAACAAGAAAAACCCUU
Claimed SEQ 1: GGGUUUUUCUCGUUGACAA SEQ 2: UUGUCAACGAGAAAAACCCUU
Regarding claim 5, Morrissey’s siRNAs sense strand comprising SEQ ID NO 208 is 100% identical to the claimed sense strand with SEQ ID NO 3 as shown below. Morrissey’s siRNA antisense strand comprising SEQ ID NO 946 differs from the claimed sense strand with SEQ ID NO 4 by two nucleotides as shown below with differences bolded.
Lu SEQ 208: GGGUUUUUCUUGUUGACAA SEQ 2: UUGUCAACAAGAAAAACCCUU
Claimed SEQ 3: GGGUUUUUCUUGUUGACAA SEQ 2: UUGUCAACAAGAAAAACCCUU
Regarding claim 7, Lu teaches the HBV siRNAs of the invention further comprise the deliver chains consisting of a linking chain D, a linker B, a branched chain L and a liver targeting specific ligand X and are linked to the interfering nucleic acid through transition points R1/R2, with various examples of the delivery chains provided ([0011]-[0023] and [0043]-[0105]).
Regarding claim 10, Lu teaches pharmaceutical compositions comprising the siRNA of the invention for use in preparing a medicament for treating hepatitis ([0112]-[0113]).
Regarding claim 11, Lu teaches pharmaceutical compositions comprising the siRNA of the invention and a pharmaceutically acceptable auxiliary material and its dosage form is preferably subcutaneous injections ([0115]).
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-3, 5, 7 and 10-12 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-7 of U.S. Patent No. 12509685. Claims 7 and 10-12 are rejected in view of Lu (CN 110846320 A, published February 28, 2020, English translation included for reference to point citations) and Morrissey (US 20030206887 A1).
Patented claim 1 recites A compound comprising an anti-hepatitis B virus interfering nucleic acid that is an anti-hepatitis B virus double stranded nucleic acid comprising a sense strand having the sequence of GGUUUUUCUUGUUGACAAA (SEQ ID NO: 3) and an antisense strand having the sequence of UUUGUCAACAAGAAAAACC (SEQ ID NO: 4); wherein each nucleotide of SEQ ID NOs: 3 and 4 is independently a 2′-methoxy modified nucleotide or 2′-fluoro modified nucleotide; wherein the anti-hepatitis B virus double stranded nucleic acid comprises one or more inter-nucleoside phosphorothioates; and wherein the compound comprises a liver targeting specific ligand. Patented claim 3 recites wherein the liver targeting specific ligand is galactose, galactosamine, or N-acetylgalactosamine. Patented claim 7 recites A pharmaceutical composition comprising the compound of claim 1 and a pharmaceutically acceptable auxiliary material. Therefore, patented claim 1 anticipates examined claims 1-3, 5 and 11.
The patented claims do not recite a use for using the patented composition or the type of linker used to conjugate the GalNAc targeting moiety to the siRNAs.
The teachings of Morrissey are recited above in paragraphs 17-23. The teachings of Lu are recited above in paragraphs 25-31.
Regarding claims 7, 10 and 12, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used the patented siRNAs in a method for treating hepatitis by conjugated the patented GalNAc via the means recited in examined claims 7 and provided with a nucleotide analog. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted the patented siRNA-GalNAc conjugated could include various linkers and transition points because Lu teaches such linkers for attachment to siRNA. It also would have been obvious to include a nucleoside analog for use in a method to treat hepatitis because Morrissey suggests combining siRNAs and nucleoside analogs for HBV infection treatment and Lu teaches using GalNAc-conjugated siRNAs for treatment of HBV infections.
Allowable Subject Matter
Claims 4, 6 and 8-9 recite allowable subject matter.
Regarding claims 4 and 6, the specific 2’-methyl and 2’-fluoro modification patterns appear to be free of the prior art. Although using modified 2’-modified nucleotides in siRNAs is routine in the art, the combination of the specific pattern of modifications of the sense and antisense strands recited in claims 4 and 6 are not taught and suggested in the prior art. Foster teaches optimizing the pattern of methyl and fluorine modifications in siRNAs (Foster et al., Molecular Therapy (2018), 26: 708-717). However, the claimed modification pattern is not tested or suggested in Foster or anywhere in the prior art. As such, it would not have been obvious to include the specific 2’-modification pattern in Lu’s or Morrissey’s HBV-targeting siRNA.
Regarding claims 8-9, the claimed combinations of targeting ligands and linkers is also free of the prior art. Although conjugated GalNAc moieties via branched linkers comprising amide-acyl linkers onto siRNAs is well known in the art (see e.g., US 20230355653 A1, priority to September 17, 2020), a thorough search of the prior art did not produce art comprising the claimed linkers in 3’MVIP09 or 3’MVIP17. As such, it would not have been obvious to include either as the targeting ligand on the 3’ end of sense or antisense strand of Lu’s or Morrissey’s HBV-targeting siRNA.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Prosecution Insights