Prosecution Insights
Last updated: September 17, 2026
Application No. 18/555,113

APTAMER-TYPE MULTI-WARHEAD COVALENT DRUG

Non-Final OA §103§DP
Filed
Oct 12, 2023
Priority
Apr 13, 2021 — JP 2021-067753 +1 more
Examiner
VANHORN, ABIGAIL LOUISE
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Yang Jay
OA Round
1 (Non-Final)
47%
Grant Probability
Moderate
1-2
OA Rounds
9m
Est. Remaining
69%
With Interview

Examiner Intelligence

Grants 47% of resolved cases
47%
Career Allowance Rate
569 granted / 1217 resolved
-13.2% vs TC avg
Strong +22% interview lift
Without
With
+22.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
76 currently pending
Career history
1292
Total Applications
across all art units

Statute-Specific Performance

§101
1.6%
-38.4% vs TC avg
§103
41.9%
+1.9% vs TC avg
§102
8.5%
-31.5% vs TC avg
§112
24.1%
-15.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1217 resolved cases

Office Action

§103 §DP
DETAILED ACTION Claims 1-16 are pending. Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority This application is a 371 of PCT/JP2022/017487 (04/11/2022) which claims FOR priority to JAPAN 2021-067753 (04/13/2021) as reflected in the filing receipt issued on March 13 2024. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Information Disclosure Statement The information disclosure statement (IDS) submitted on October 12 2023 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. The information disclosure statement filed October 26 2023, specifically NPL 10 fails to comply with 37 CFR 1.98(b), which requires that each item of information in an IDS be identified properly. Each publication must have the date of publication supplied. NPL item 10 fails to provide a publication date. Drawings The drawings are objected to for the following reasons: 37 CFR 1.84 (u)(1) states “Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter.” In the current case, the view numbers for the partial views for Figures 1-6 are followed a lower-case letter instead of a capital letter such as FIG. 1A, FIG. 1B, etc. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-16 are rejected under 35 U.S.C. 103 as being unpatentable over Song et al. (Anal. Chem., 2020, cited on PTO Form 1449) in view of Ehrat (WO2021224264, effectively filed May 4 2020), Dong et al. (Angewandte Reviews, 2014) and Narayanan et al. (Chem. Sci, 2015, cited on PTO Form 1449). Applicant Claims The instant application claims a multiwarhead nucleic acid aptamer having multiple fluorosulfonyl groups, wherein the multiple fluorosulfonyl groups are linked to multiple nucleic acid residues in the nucleic acid sequence of the nucleic acid aptamer via linkers. The instant application claims a method of producing a nucleic acid aptamer having an enhanced efficiency for binding to a target protein, the method comprising reacting: a) a nucleic acid aptamer specific for the target protein, wherein multiple nucleic acid residues within the nucleic acid sequence of the aptamer are each modified to be linked or bound to a first reactive group; and b) a warhead compound having a structure in which a second reactive group corresponding to the first reactive group is linked or bound to a fluorosulfonyl group to obtain a multiwarhead structure in which the multiple nucleic acid residues of the nucleic acid aptamer are each linked to the fluorosulfonyl group via a linker comprising a linking moiety formed by the reaction between the first reactive group and the second reactive group. Determination of the Scope and Content of the Prior Art (MPEP §2141.01) Song et al. is directed to the discovery of Aptamers targeting the receptor-binding domain of the SARS-CoV-2 Spike Glycoprotein. Specifically taught is CoV2-RBD-1C aptamer against receptor binding domain (RBD) which has a Kd value of 5.8 nM (abstract, page 9895-9896). CoV2-RBD-1C is a 51 base aptamer 5′-CAG-CAC-CGA-CCT-TGT-GCT-TTG-GGA-GTG-CTG-GTC-CA-AGG-GCG-TTA-ATG-GA-CA-3′ (page 9898) which as 100% identity to instantly claimed SEQ ID NO: 1. Ascertainment of the Difference Between Scope the Prior Art and the Claims (MPEP §2141.02) While Song et al. teaches an aptamer which specifically binds to a SARS-CoV-2 spike glycoprotein, Song et al. does not expressly teach multiple warheads on the aptamer which are linked via azide-alkyne click chemistry. However, these deficiencies are cured by Ehrat, Narayanan et al. and Dong et al. Ehrat is directed to an antipathogen vesicle. Claimed is a vesicle displays on its surface two or more different binding sites to one or more different docking domains on a pathogen (claim 1). One of the two or more different binding sites to one or more different docking domains on the pathogen is a chemical warhead for covalent binding to a reactive residue of a docking domain on the surface of the pathogen (claim 3). Higher affinities of the interaction partners are achieved by multiple site attachment by fostering an interaction of multiple docking domains of the pathogen with the corresponding binding sites displayed or by formation of a covalent bond between the pathogen and the vesicle (page 10). Biomolecular probes include aptamers (page 4). Chemical warheads include those are used for covalent binding to a reactive residue of a docking domain on the surface of the pathogen. These include threonine, lysine, tyrosine, cysteine, histidine and arginine. They are arranged in spatial proximity to allow covalent binding of the vesicle to at least one of the one or more different docking domains on the pathogen (page 8). It is taught that for SARS-CoV spike, mutagenesis, structural and lipid mixing studies have suggested a motif SFIEDFFFNKVTFADAGF which is conserved across the coronavirus family (page 5). Narayanan et al. is directed to sulfonyl fluorides as privileged warheads in chemical biology. Covalent protein modifiers are extremely useful in the chemical biology arena. Sulfonyl fluorides are privileged covalent warheads that can probe enzyme binding sites and assess functionally important protein residues. They possess desirable electrophilicity that enables capture of context specific amino acid reactivity whilst retaining appropriate aqueous stability (introduction). Fig. 1 shows various probes that react with serine (and threonine). Histidine and cysteine also react with sulfonyl fluorides (other residues section; page 2656). As shown in Fig. 1 sulfonyl fluorides include aryl sulfonyl fluoride (AEBSF). As shown in Figure 7, an alkyne can be connected to an aryl sulfonyl fluoride which can then be reacted with an N3 on a nucleobase (DAS1 and 5’-FSBazA). It is taught that in a more sophisticated approach, a clickable kinase inhibitor bearing the SF warhead was developed to label kinase targets in intact cells (page 2653, right column). Dong et al. is directed to sulfur(VI) fluoride exchange (SuFEx): another good reaction for click chemistry. Click chemistry was introduced as a conceptual framework for functional molecular assembly 15 years ago, emphasizing the importance of carbon–heteroatom linkages in joining modular building blocks. Taking inspiration from nature, click reactions were identified as processes that work under operationally simple, oxygen- and water-tolerant conditions, and generate products in high yields with minimal requirements for product purification. Such reactions invariably have an unusual combination of strong thermodynamic driving forces and consistent, well-controlled reaction pathways. In tandem, these two features allow the use of widely varying substrates with great reliability. The azide–alkyne cycloaddition reaction is especially useful because of the unobtrusive nature of its participating functional groups and the ability to turn on their ligating ability (to different extents, and for different purposes) by Cu catalysts installing strain in the alkyne component or holding them in close spatial proximity. Thus, this click reaction emerged by finding ways to induce two functional groups to react with each other that otherwise have little propensity to do so, in spite of their highly energetic nature (page 9431). As shown in Figure 1, the properties of sulfonyl fluorides are shown. They are resistant to both oxidation and reduction, much greater stability toward thermolysis (page 9433). Figure 6 shows how to synthesis either N3 sulfonyl fluorides or alkyne sulfonyl fluorides. Figure 10 also shows compounds with alkyne and azide. It is taught that azide- and alkyne-modified sulfonyl fluorides will also be useful since the SO2F group does not interfere with any form of the catalyzed or strain-promoted azide-alkyne ligation methods (page 9438, section 6.). Finding of Prima Facie Obviousness Rationale and Motivation (MPEP §2142-2143) Regarding claim 1, It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Song et al., Ehrat, Narayanan et al. and Dong et al. and attach chemical warheads such as sulfonyl fluorides to the aptamer of Song et al. One skilled in the art would have been motivated to attach multiple chemical warheads to afford chemical binding of the aptamer to the SARS-CoV-2 pathogen. One skilled in the art would have been motivated to utilize a chemical warhead to improve the affinity of the aptamer as taught by Ehrat. One skilled in the art would have been motivated to utilize multiple chemical warheads as Ehrat teaches the amino acid sequence of the coronaviruses include SFIEDFFFNKVTFADAGF and Narayanan et al. teaches the chemical warheads can react with serine (S) and threonine (T). Therefore, one skilled in the art would have been motivated to attach sulfonyl fluorides on the aptamer in order to bind both of these amino acids. Regarding claims 2 and 10, as taught by Ehrat there are several amino acids in between the S and the T of the coronavirus sequence. Therefore, one skilled in the art would have been motivated to manipulate the spacing of the warheads on the aptamer in order to have the chemical warhead spaced apart so it could bind both of these amino acids. Regarding claims 3, 9 and 11, It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Song et al., Ehrat, Narayanan et al. and Dong et al. and utilize click chemistry in order to bind the sulfonyl fluoride group to the aptamer. One skilled in the art would have been motivated to utilize this type of chemistry because of the simple chemistry involved in formation as taught by Dong et al. Since as taught by Dong et al. that azide- and alkyne-modified sulfonyl fluorides will also be useful since the SO2F group does not interfere with any form of the catalyzed or strain-promoted azide-alkyne ligation methods. Therefore, one skilled in the art would have been motivated to modify a SO2F group with either an azide or alkyne and then modify an aptamer with either an azide or alkyne (depending on what group is chosen for the SO2F) to create an azide-alkyne pair for click chemistry. Regarding claims 4-5 and 16, the aptamer of Song et al. is expressly taught as binding SARS-CoV-2 and CoV2-RBD-1C is a 51 base aptamer 5′-CAG-CAC-CGA-CCT-TGT-GCT-TTG-GGA-GTG-CTG-GTC-CA-AGG-GCG-TTA-ATG-GA-CA-3′ (page 9898) which as 100% identity to instantly claimed SEQ ID NO: 1. Regarding claims 6 and 12-14, both Dong et al. and Narayanan et al. teach aryl sulfonyl fluorides. Regarding claims 7-8 and 15-16, Ehrat teaches pharmaceutical formulations such as aerosols, suspensions, emulsions (page 14). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Song et al., Ehrat, Narayanan et al. and Dong et al. and utilize known compositions forms for delivering the aptamer. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-3, 6-7 and 9-15 are provisionally rejected on the grounds of nonstatutory double patenting as being unpatentable over claims 1-19 of copending Application No. 18265458 (USPGPUB No. 20240033361) in view of Ehrat (WO2021224264). Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. The instant application claims a multiwarhead nucleic acid aptamer having multiple fluorosulfonyl groups, wherein the multiple fluorosulfonyl groups are linked to multiple nucleic acid residues in the nucleic acid sequence of the nucleic acid aptamer via linkers. The instant application claims a method of producing a nucleic acid aptamer having an enhanced efficiency for binding to a target protein, the method comprising reacting: a) a nucleic acid aptamer specific for the target protein, wherein multiple nucleic acid residues within the nucleic acid sequence of the aptamer are each modified to be linked or bound to a first reactive group; and b) a warhead compound having a structure in which a second reactive group corresponding to the first reactive group is linked or bound to a fluorosulfonyl group to obtain a multiwarhead structure in which the multiple nucleic acid residues of the nucleic acid aptamer are each linked to the fluorosulfonyl group via a linker comprising a linking moiety formed by the reaction between the first reactive group and the second reactive group. Copending ’458 claims a neutralizable covalent drug compound, comprising a nucleic acid aptamer; and a fluorosulfonyl group linked to the nucleic acid aptamer via an azide-alkyne click chemistry reaction, wherein the aptamer and the fluorosulfonyl group are linked via a linker comprising a linking moiety formed by the azide-alkyne click chemistry reaction. Claimed is a method of producing a neutralizable covalent drug capable of forming a covalent bond to a target protein, the method comprising reacting: a) a nucleic acid aptamer specific to the target protein, wherein an alkynyl, cycloalkynyl, or heterocycloalkynyl group (al)or an azide group (a2) is linked or bound to the aptamer; and b) a warhead compound having a structure in which a corresponding azide group (bl) or alkynyl, cycloalkynyl, or heterocycloalkynyl group (b2) is linked or bound to a fluorosulfonyl group to carry out an azide-alkyne click chemistry reaction, and obtaining a structure in which the nucleic acid aptamer and the fluorosulfonyl group are linked via a linker comprising a linking moiety formed by the azide-alkyne click chemistry reaction. Aryl SO2F is claimed. Pharmaceutical composition is claimed. The difference between the instant claims and copending ‘458 is that copending ‘458 claims multiple fluorosulfonyl groups. However, this deficiency is cured by Ehrat. Ehrat is directed to an antipathogen vesicle. Claimed is a vesicle displays on its surface two or more different binding sites to one or more different docking domains on a pathogen (claim 1). One of the two or more different binding sites to one or more different docking domains on the pathogen is a chemical warhead for covalent binding to a reactive residue of a docking domain on the surface of the pathogen (claim 3). Higher affinities of the interaction partners are achieved by multiple site attachment by fostering an interaction of multiple docking domains of the pathogen with the corresponding binding sites displayed or by formation of a covalent bond between the pathogen and the vesicle (page 10). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending ‘458 and Ehrat and utilize multiple fluorosulfonyl groups (i.e. chemical warheads) on the aptamer. One skilled in the art would have been motivated to utilize multiple fluorosulfonyl groups in order to achieve higher affinity of the aptamer as taught by Ehrat. Regarding claim 2 and 10, Ehrat teaches binding different docking domain of the pathogen. Therefore, one skilled in the art would manipulate the distance on the aptamer of the various fluorosulfonyl groups in order to achieve covalent binding of various different docking domains on the pathogen. Claims 4-5, 8 and 16 are provisionally rejected on the grounds of nonstatutory double patenting as being unpatentable over claim 1-19 of copending Application No. 18265458 (USPGPUB No. 20240033361) in view of Ehrat as applied to claims above 1-3, 6-7 and 9-15 and in further view of Song et al. (Anal. Chem. 2020, cited on PTO Form 1449). Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. This is a provisional nonstatutory double patenting rejection. The instant application claims the fluorosulfonyl groups are linked to multiple nucleic acid residues within a nucleic acid sequence of a SARS-CoV-2 spike protein binding nucleic acid aptamer via respective linkers, wherein the multiwarhead nucleic acid aptamer is capable of covalently binding to a SARS- CoV-2 spike protein. As claimed the aptamer has the nucleic acid sequence of 5'- CAGCACCGACCTTGTGCTTTGGGAGTGCTGGTCCAAGGGCGTTAATGGACA-3' (SEQ ID NO:1), wherein the fluorosulfonyl groups are linked to multiple nucleic acid residues within the nucleic acid sequence via respective linkers. The teachings of copending ‘458 and Ehrat are set forth above. Ehrat teaches that the vesicle can be used to target SARS-CoV and SARS-CoV-2 (claim 13). It is taught that corona virus exhibit glycoprotein “spikes” from the virus surface (page 5). While copending ‘458 claims an aptamer, copending ‘458 does not expressly claim an aptamer which binds SARS-CoV-2. However, this deficiency is cured by Song et al. Song et al. is directed to the discovery of Aptamers targeting the receptor-binding domain of the SARS-CoV-2 Spike Glycoprotein. Specifically taught is CoV2-RBD-1C aptamer against receptor binding domain (RBD) which has a Kd value of 5.8 nM (abstract, page 9895-9896). CoV2-RBD-1C is a 51 base aptamer 5′-CAG-CAC-CGA-CCT-TGT-GCT-TTG-GGA-GTG-CTG-GTC-CA-AGG-GCG-TTA-ATG-GA-CA-3′ (page 9898) which as 100% identity to instantly claimed SEQ ID NO: 1. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending ‘458, Ehrat and Song et al. and utilize CoV2-RBD-1C as the aptamer in copending ‘458. One skilled in the art would have been motivated to utilize this aptamer with fluorosulfonyl chemical warheads in order to bind to and inactive SARS-CoV-2. Ehrat teaches the use of chemical warheads to bind to pathogens, including SARS-CoV-2, for inactivation. Copending ‘458 generically teaches an aptamer with a chemical warhead. Song et al. teaches a specific aptamer which is known to bind to SARS-CoV-2. Therefore, when desiring the aptamer to be on which binds SARS-CoV-2, it would have been obvious to choose this specific aptamer. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to ABIGAIL VANHORN whose telephone number is (571)270-3502. The examiner can normally be reached M-Th 6 am-4 pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Oct 12, 2023
Application Filed
Sep 01, 2026
Non-Final Rejection mailed — §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735702
ENDOSOMAL CLEAVABLE LINKERS
4y 7m to grant Granted Sep 15, 2026
Patent 12685766
MODIFIED GENE VACCINES AGAINST AVIAN CORONAVIRUSES AND METHODS OF USING THE SAME
3y 8m to grant Granted Jul 21, 2026
Patent 12678400
IMPLANTABLE DEVICES FOR DRUG DELIVERY WITH REDUCED BURST RELEASE
3y 7m to grant Granted Jul 14, 2026
Patent 12678401
IMPLANTABLE DEVICES FOR DRUG DELIVERY WITH REDUCED BURST RELEASE
3y 2m to grant Granted Jul 14, 2026
Patent 12667626
COMPOSITIONS AND METHODS RELATING TO ERYTHROCYTES WITH ADHERED PARTICLES
4y 6m to grant Granted Jun 30, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
47%
Grant Probability
69%
With Interview (+22.4%)
3y 8m (~9m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1217 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month