Prosecution Insights
Last updated: October 04, 2026
Application No. 18/555,477

METHOD AND COMPOSITIONS FOR PREVENTING TUMOR DEVELOPMENT AND METASTASIS

Non-Final OA §112
Filed
Oct 13, 2023
Priority
Apr 13, 2021 — provisional 63/174,527 +2 more
Examiner
YU, DELPHINUS DOU YI
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Administrators of the Tulane Educational Fund
OA Round
1 (Non-Final)
33%
Grant Probability
At Risk
1-2
OA Rounds
0m
Est. Remaining
33%
With Interview

Examiner Intelligence

Grants only 33% of cases
33%
Career Allowance Rate
2 granted / 6 resolved
-26.7% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 9m
Avg Prosecution
36 currently pending
Career history
36
Total Applications
across all art units

Statute-Specific Performance

§101
5.2%
-34.8% vs TC avg
§103
34.4%
-5.6% vs TC avg
§102
11.7%
-28.3% vs TC avg
§112
33.8%
-6.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 6 resolved cases

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Based on the disclosure in claim 6, SEQ ID NO: 2 should have the base sequence of GGUGGGCACATGCTCCUUCU for a 20nt antisense oligonucleotide. However, the current listing is not compliant with the PCT ST.25 Sequence Listing Standard. See MPEP 2422. Each nucleotide without modification is represented by a single symbol, the symbol “m” is only used to represent either A or C, “Nucleotides are intended to embrace only those nucleotides that can be represented using the symbols set forth in Appendix A to this subpart. Modifications (e.g., methylated bases) may be described as set forth in Appendix B to this subpart but shall not be shown explicitly in the nucleotide sequence”. see MPEP §2422, 37 CFR 1.821(a)(1), and MPEP §2422(I) Appendix A to Subpart G of Part 1 - List of Nucleotides. As a result of the non-compliance, the currently listed SEQ ID NO: 2 is mistaken as a 30nt nucleotide comprising 10 “m” symbols that are mistaken as nucleotide A or C. Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 replacing the incorrect SEQ ID NO: 2 sequence with the corrected sequence, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Application Status This action is written in response to applicant’s correspondence received on 07/29/2026. Claims 1-12, 14-15, 18, 27-29 and 31-33 are currently pending. Claims 27-29 and 31-33 are withdrawn from prosecution as being drawn to nonelected subject matter. Accordingly, claims 1-12, 14-15, 18 are examined herein. Election/Restrictions Applicant's election with traverse of Group I in the reply filed on 07/29/2026 is acknowledged. The traversal is on the ground(s) that “the claims relate to detection of cancer cells with increased TRAF3IP2 expression. A search of one group would suffice to include both. Thus, there is no undue burden on the Examiner to search the complete claim set”. This is not found persuasive because the standard for unity of invention under PCT Rule 13.2 is not search burden, but whether the groups share a same or corresponding special technical feature. The active steps of Group I involve administering a therapeutic composition and performing a clinical procedure, while the active steps of Group II involve sample collection and nucleic acid detection. Because there is no technical feature common to both groups, the groups necessarily lack a special technical feature, the requirement for unity of invention is maintained. The recitation “Group I, claims 1-12, 14-25, 28” in the Restriction Requirement mailed on 04/29/2026 contains typographical errors, i.e. “25, 28” should have been “15, 18” and has been corrected herein. The requirement is still deemed proper and is therefore made FINAL. Claim 27-29 and 31-33 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected Group II, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 07/29/2026. Information Disclosure Statement The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered, e.g. References 41-44 listed on pages 35-36. Priority Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. This application is a 371 of PCT/US22/24700 filed on 04/13/2022, claiming priority to PRO 63/174,527 filed on 04/13/2021. Drawings The drawing is objected to because 37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG.”. In the current case, the view number for Figure 1 is preceded by the word "FIGURE" instead of the abbreviation "FIG.". Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The disclosure is objected to because of the following informalities: The use of the terms Qiagen, QIAmp (should be spelled as QIAamp), BioRad (should be spelled as Bio-Rad), ChemiDoc, on page 15, ¶[0085] of the Specification, Seahorse on page 18, which are trade names or marks used in commerce, has been noted in this application. The terms should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Appropriate correction is required. On page 21, lines 1-2, the recitation “In other words, the COMBINATION OF” should be deleted. Claim Objections Claims 1, 3, 10, 12, 14, 15 are objected to because of the following informalities: Regarding claim 1, the recitation “micrometastasis on a subject” should be “in a subject”. Furthermore, the recitation “c)” should be deleted because the ensuing “wherein …” clause is not a step. Regarding claim 3, the recitation “siRNA” should be “an siRNA”. The recitation “or an antisense…” should be “and an antisense…”. Regarding claim 10, the recitation “having increase in…” should be “having an increase in …” or “having increased …”. The recitation “one of the following procedure” should be “one of the following procedures”. Furthermore, the recitation “the steps of” should be either “the step of” or deleted, and the recitation of “b)” should be deleted, because the “wherein …” clause following “b)” is not a step. Regarding claim 12, the recitation “or of an antisense …” should be “and an antisense …”. Regarding claim 14, the recitation “SEQ ID NOs. 1 or 2” should be “SEQ ID NO: 1 or 2”. Regarding claim 15, the recitation “step (a)” should be “step a)” to be consistent with the antecedent basis in claim 10 upon which it depends. Appropriate corrections are required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-12, 14-15, 18 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 1, it is noted that the claim recites “increased TRAF3IP2 expression in comparison with a non-cancer cell”. This language is considered to be indefinite because, under the broadest reasonable interpretation (BRI), a “non-cancer cell” reads on a non-cancer plant cell and a non-cancer microbial cell, wherein there is no TRAF3IP2 expression because it is limited to vertebrate animals based on research by Wu (Dev Comp Immunol. 2011 Nov;35(11):1186-92; Page 1186, Abstract, line 8). Hence, any TRAF3IP2 expression is “increased expression” under BRI. Furthermore, different cell types in humans show heterogeneous TRAF3IP2 expression levels, both RNA and protein, based on profiling by the Human Protein Atlas (See The Human Protein Atlas_TRAF3IP2.pdf listed in PTO-892; Database established by Uhlén Science. 2015 Jan 23;347(6220):1260419). Hence, if a reference non-cancer or normal cell is a human cell, it is unclear which human cell. These facts highlight the ambiguity of the claim as to what levels of TRAF3IP2 expression determine the metes and bounds of the claim. Furthermore, the recitation “intervention-related micrometastasis” is not defined in the claim or the specification. Rock (CA Cancer J Clin. 2020 Jul;70(4):245-271) includes physical activity, weight loss, and diet among many types of cancer interventions (Page 245, introduction, first line). Under BRI, the claimed term encompasses micrometastasis related to diet or physical activity. It is not clear how it is determined that the observed “micrometastasis” is related to a particular intervention as opposed to intervention-unrelated, spontaneous tumor metastasis. The claims and the specification do not teach how is “intervention-related micrometastasis” quantified. No examples are provided to illustrate the term or methodology. Therefore, the metes and bounds of the claim are ambiguous. Regarding claim 6, the symbols “m” and “*” in the claimed antisense oligonucleotide SEQ ID NO: 2 are not defined in the claims or the specification. It further differs from the Sequence Listing. It is unclear that the claimed sequence is because the symbol “m” can be interpreted to represent either A or C. see MPEP §2422, 37 CFR 1.821(a)(1), and MPEP §2422(I) Appendix A to Subpart G of Part 1 - List of Nucleotides. An asterisk “*” in a polynucleotide sequence could represent missing or unknown base in alignments or stop codons. Persons having ordinary skill in the art (PHOSITAs) cannot ascertain the metes and bounds of the claimed subject matter. Regarding claim 7, the recitation “The method of claim 1, … as compared to the same treatment without …” is considered indefinite, because there is insufficient antecedent basis in claim 1 for “treatment”. Furthermore, it is ambiguous whether “same” incorporates all the limitations of claim 1. Moreover, it is unclear whether the limitation “reduced by at least 50% as compared to the same treatment without …” requires an extra step added to the claimed method in claim 1 for the same subject or a comparable group of subjects, i.e. a control group, because without it, PHOSITAs cannot possibly acquire the comparison basis for “the same treatment without …”. Neither the claim nor the specification teaches the comparison basis, hence it is determined to be indefinite. Given that the specification concedes that metastasis is a “time-dependent” process (Page 2, ¶[0006], line 2), it is further unclear what the timing, dosing, and measurement method requirements for the claimed quantification metrics are based on. Regarding claim 9, aside from the same ambiguity regarding the timing, dosing, and measurement method requirements for the claimed quantification metrics, it is further unclear whether is it required to add an extra step in the method in claim 1 to administer a pharmaceutical composition into the same subject or a comparable population of subjects having the same cancer, i.e. a control group, wherein the pharmaceutical composition comprises no targeting sequence for TRAF3IP2 in a pharmaceutically acceptable carrier. On one hand, PHOSITAs would not have any comparison basis to determine “by at least-5 fold” without this extra step in the same subject or a control group. Regarding claim 10, it is noted that the claim recites “increase in TRAF3IP2 expression as compared to a normal cell”. This language is considered to be indefinite because, under the broadest reasonable interpretation (BRI), a “normal cell” reads on a normal plant cell and a normal microbial cell, wherein there is no TRAF3IP2 expression because it is limited to vertebrate animals based on research by Wu (2011; Page 1186, Abstract, line 8). Furthermore, different cell types in humans show heterogeneous TRAF3IP2 expression levels, both RNA and protein, based on profiling by the Human Protein Atlas (See The Human Protein Atlas_TRAF3IP2.pdf listed in PTO-892; Database established by Uhlén 2015, full citation above). In addition, GTEx Consortium (Science. 2020;369(6509):1318-1330) data shows highly variant expression levels of TRAF3IP2 in 838 donors across 54 tissue types (Portal website is gtexportal.org/home/gene/TRAF3IP2; accessed 2026, see data visualization below). These facts highlight the ambiguity of the metes and bounds of the claim. PNG media_image1.png 907 1527 media_image1.png Greyscale Moreover, the recitation “in connection with” is not defined in the claim or the specification. It is not clear what “in connection with” entails when it comes to determine the timing, dosing, and routes with the recited embodiments of procedures. No example is provided to illustrate the term or methodology. Therefore, the metes and bounds of the claim are ambiguous. Regarding claim 12, the recited SEQ ID NO: 2, gmgmumgmgm gcacatgctc cmumumcmum, is a non-compliant sequence listing in view of the sequence recited in claim 6 because the sequence as listed does not align with the target TRAF3IP2 mRNA, however, the sequence in claim 6 without any “m” or “*”, i.e. GGTGGGCACATGCTCCTTCT, does in fact align with the TRAF3IP2 mRNA sequence based on NCBI refseq NM_001164281.3 (See NCBI_2020_RefSeq NM_001164281.3 TRAF3IP2.pdf listed in PTO-892), see alignment below. It is unclear which nucleotide sequence is claimed, the one in the sequence listing (SEQ ID NO: 2), or the one listed in claim 6 without the undefined modification symbols. PNG media_image2.png 257 973 media_image2.png Greyscale Regarding claim 18, the recitations “the NF-κB activity” and “the tumor growth” are considered indefinite, as there is insufficient antecedent basis in the claim. Those claims identified in the statement of rejection but not explicitly referenced in the rejection are also rejected for depending from a rejected claim 1 or 10 but failing to remedy the indefiniteness therein. Claim Rejections - 35 USC § 112 Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-12, 14-15, 18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”. For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. The independent claim 1 directs to an extremely broad genus of method variants wherein the claimed method requires a step encompassing extremely broad genera that rely on functional limitation “diagnostic for the cancer”, or “intervention to treat the cancer”, whereas no common structure that underlie the functional limitations is disclosed. Under BRI, both procedure genera encompass invasive procedures, such as needle biopsy, and non-invasive intervention modalities, such as diet, and certain modalities of imaging, each with distinct tissue-manipulation profiles and undefined relationship to “intervention-related micrometastasis”. The specification demonstrates zero example of either “diagnostic” or “intervention” procedures following step a) in claim 1. Every experimental example in the specification, i.e. breast cancer PDX/intramammary implantation models, GBM intracranial models, administers the TRAF3IP2-targeting composition alone and measures resulting tumor growth or metastasis; none couples the step of TRAF3IP2 targeting sequence composition administration with an actually-performed surgical resection, diagnostic biopsy, or other interventional procedure on the treated subject. The single biopsy appearing in the specification (Page 26, ¶[00131]; FIGs. 14-15) is performed after treatment solely as an assay to measure micrometastatic burden, not as a “diagnostic” or “intervention” method step that follow the administration of the composition. Accordingly, the specification demonstrates zero species of the genera required in step b), not qualifying as examples for the claimed method step a) of administering it before any of the recited “surgery”, “diagnostic”, or “intervention” in step b). Regarding the state of the art, Rock (2020; See full citation above) describes that the term “intervention” in the oncology field encompasses an exceptionally broad spectrum of measures, e.g. dietary, physical-activity, weight-management, and behavioral/lifestyle intervention (Pages 247-248, Table 2), in addition to medical and procedural intervention such as surgical ablation or targeted biologic and pharmacologic intervention. Alieva (Clin Exp Metastasis. 2018;35(4):319-331) and Tohme (Cancer Res. 2017;77(7):1548-1552) each identify multiple independent mechanisms for procedure-related micrometastasis (Alieva, Page 325, Figure 2), such as local inflammatory response, immune suppression, mechanical disruption releasing tumor cells into circulation, by which physical manipulation of a tumor promotes metastatic spread (Tohme, Page 1549, Figure 1). At the other end of the spectrum, non-invasive imaging-based diagnostics (CT, MRI, PET etc.) involve no physical contact with the tumor tissue, as taught by Weissleder (Nature. 2008 Apr 3;452(7187):580-9; Page 588, left column, 5th ¶, lines 1-2), and minimally invasive liquid biopsy, an established diagnostic modality analyzing circulating tumor DNA, circulating tumor cells, or exosomes from a peripheral blood sample, taught by Siravegna (Nat Rev Clin Oncol. 2017;14(9):531-548), likewise does not involve disruption of the primary tumor tissue. Neither imaging nor liquid biopsy can trigger the tumor-manipulation-dependent mechanisms identified by Alieva (2018) and Tohme (2017). The claimed genus “diagnostic” and “intervention” therefore span highly variant species with distinct art-recognized relationships to procedure-triggered micrometastasis. The disclosure of insufficient species of a broad genus, the high degree of variation in the art, and the failure to disclose correlation between structure in the specification and the claimed function led to the determination that claim 1 is overly broad with insufficient evidence of possession at the time of filing to one skilled in the art. Thus, claim 1 does not meet the written description requirement, and the specification demonstrates a clear lack of possession of the full genus as claimed. Claims 2-9 are also rejected for depending from the rejected claim 1 and failing to remedy the lack of written description therein. Claims 10-12, 14-15, 18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. The independent claim 10 directs to an extremely broad genus of method variants wherein the claimed method requires a step encompassing extremely broad genera of cancer interventions defined by functional limitations “surgery, diagnostic or therapeutic intervention, chemotherapy, radiation therapy, immunotherapy or targeted intervention”, whereas no common structure that underlie the functional limitations is disclosed. Each recited category of interventions encompasses highly variant species involving distinct mechanisms and structures. The specification does not teach any embodiment of “surgery, diagnostic or therapeutic intervention, radiation therapy, immunotherapy or targeted intervention” with the exception of “chemotherapy”. However, “chemotherapy” encompasses an extraordinarily broad genus of molecules and structures, see Figures. 1-7 in a review by Mollaei (Transl Oncol. Epub 2021 Mar;14(5):101056), and the examples only used Paclitaxel (Page 20, ¶[00108] & ¶[00109]; FIG. 8E). Regarding the state of the art, all claimed cancer intervention modalities encompass highly variant mechanisms and structures. Take “surgery” for example, Tohme (2017) teaches that “surgery” alone comprises multiple independent, mechanistically distinct pathways by which tumor manipulation can promote metastatic dissemination (Page 1550, left column, last ¶), “countless perioperative variables that can alter the oncological outcomes” (Page 1550, right column, 3rd ¶, lines 2-3). Alieva (2018) further indicates the unpredictability of the art by stating that “Little is known about the effects of surgery on pre-metastatic niche formation” (Page 324, left column, last ¶, lines 1-2). The disclosure of insufficient species of a broad genus, the high degree of variation in the art, and the failure to disclose correlation between structure in the specification and the claimed function led to the determination that claim 10 is overly broad with insufficient evidence of possession at the time of filing to one skilled in the art. Thus, claim 10 does not meet the written description requirement, and the specification demonstrates a clear lack of possession of the full genus as claimed. Claims 11-15, 18 are also rejected for depending from the rejected claim 10 and failing to remedy the lack of written description therein. Claims 1-12, 14-15, 18 are further rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. The recitation “targeting sequence for TRAF3IP2” in both independent claims 1 and 10 encompasses broad genus of structures, including polypeptide sequences, and polysaccharide sequences, such as chitosan. Although claim 10 further requires “wherein the targeting sequence suppresses expression of TRAF3IP2”, the genus remains broad. The specification discloses and exemplifies only nucleic acid-based species. Both sequences exemplified in the specification, SEQ ID NO:1 (shRNA) and SEQ ID NO:2 (a 5-10-5 gapmer antisense oligonucleotide), are nucleic acids, and the specification describes their suppressive mechanism exclusively in terms of sequence-specific hybridization to TRAF3IP2 mRNA, i.e., via RNAi/antisense-mediated gene silencing. No protein, polysaccharide, or synthetic polymer species is disclosed, exemplified, or even mentioned as a “targeting sequence” for TRAF3IP2 anywhere in the specification. The state of art confirms that a protein-based species would also achieve the claimed suppressive function over TRAF3IP2 expression through a structurally and mechanistically distinct paradigm from what is disclosed. Gebelein (Mol Cell Biol. 2001;21(3):928-39) teaches that Krüppel-associated box domain zinc-finger proteins (KRAB-ZFPs) are established in the art as capable of sequence-specific transcriptional repression (Page 928, Abstract, last 3 lines). However, this mechanism operates through direct protein-DNA binding via zinc-finger motifs coupled to KRAB-domain-mediated recruitment of a chromatin-modifying corepressor complex, resulting in heterochromatin formation and blocked transcriptional initiation. This mechanism shares no structural or functional nexus with the mRNA base-pairing/RISC-mediated degradation mechanism disclosed for the specification’s nucleic acid embodiments. A skilled artisan would have no basis to extrapolate possession of a structurally and mechanistically unrelated protein-based species achieving the same claimed function as the disclosed nucleic acid embodiments. On the other hand, no comparable sequence-specific gene-suppression mechanism is known in the art for polysaccharides. To the contrary, Cao (Mar Drugs. 2019 Jun 25;17(6):381) teaches that polysaccharides such as chitosan function exclusively as non-sequence-specific electrostatic carriers that complex with and deliver nucleic acid payloads, i.e. the sequence-specific targeting and silencing function resides entirely in the nucleic acid cargo, not the polysaccharide itself (Page 1, Abstract, lines 6-10). No art-recognized precedent supports a polysaccharide functioning as the sequence-specific “targeting” moiety, and the specification provides no guidance. The disclosure of insufficient species of a broad genus, the high degree of variation in the art, and the failure to disclose correlation between structure in the specification and the claimed function led to the determination that claims 1 and 10 are overly broad with insufficient evidence of possession at the time of filing to one skilled in the art. Thus, claims 1 and 10 do not meet the written description requirement, and the specification demonstrates a clear lack of possession of the full genus as claimed. Claims 2-9, 11-15, 18 are also rejected for depending from the rejected claims 1 & 10 and failing to remedy the lack of written description therein. Claims 1-12, 14-15, 18 are further rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. The recitation “cancer” in both independent claims 1 and 10 encompasses broad genus of cancers with any cell or tissue type and any organ of origin. While the examples demonstrate experiments using xenograft mouse models of human triple negative breast cancer (TNBC) and glioblastoma multiforme (GBM) using human cancer cell lines, these two types of cancers are not representative of all cancer types. The specification discloses and exemplifies only TNBC (FIG. 2-11, 16) and GBM models in immunodeficient mice (FIG. 12-17). The state of art confirms that cancers are highly variant and unpredictable. Hoadley (Cell. 2018; 173(2):291-304.e6) teaches that comprehensive molecular profiling of over 10,000 tumors spanning 33 distinct cancer types reclassifies them into 28 distinct molecular subtypes based on integrated genomic, epigenomic, transcriptomic, and proteomic data. Hence, “cancer” is not a single disease but a vast, molecularly heterogeneous collection of diseases (Figures 1-7). The disclosure of insufficient species of a broad genus, the high degree of variation in the art, and the failure to disclose correlation between structure in the specification and the claimed function led to the determination that claims 1 and 10 are overly broad with insufficient evidence of possession at the time of filing to one skilled in the art. Thus, claims 1 and 10 do not meet the written description requirement, and the specification demonstrates a clear lack of possession of the full genus as claimed. Claims 2-9, 11-15, 18 are also rejected for depending from the rejected claims 1 & 10 and failing to remedy the lack of written description therein. Claim Rejections - 35 USC § 112 Enablement Claims 1-12, 14-15, 18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. The test of enablement is whether one skilled in the art could make and use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics., 8 USPQ2d 1217 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor but rather is a conclusion reached by weighing many factors. These factors were outlined in Ex parte Forman, 230 USPQ 546 (Bd. Pat. App. & Inter. 1986) and again in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988), and the most relevant factors are indicated below: Nature of the Invention The claimed invention, encompassed by claims 1-9, directs to a method of preventing surgery-, diagnostic- or intervention-related micrometastasis in a subject having cancer, wherein the cancer cells have increased TRAF3IP2 expression as compared to a non-cancer cell of the same cell type in the subject, said method comprising the steps of a), b), and c). Thus, the method requires a reliable implementation of: a) administering a pharmaceutical composition into the subject; b) performing interventions known to induce micrometastasis; c) the pharmaceutical composition comprises at least one targeting sequence for TRAF3IP2 in a pharmaceutically acceptable carrier; d) in an amount effective for the prevention of micrometastasis. The claimed invention, encompassed by claims 10-12, 14-15, 18, directs to a method of treating a patient with cancer, the cancer having an increase in TRAF3IP2 expression as compared to a normal cell of the same cell type in the subject or in a comparable group of subjects with the same cancer, said method comprising the singular step of a). Thus, the method requires a reliable implementation of: a) administering a pharmaceutical composition into the subject, before, during or in connection with least one of the procedures … ; b) the pharmaceutical composition comprises at least one targeting sequence for TRAF3IP2 in a pharmaceutically acceptable carrier; c) in an amount effective for the prevention of micrometastasis. The Breadth of the Claims The scope of the independent claim 1 directs to a broad genus of methods preventing the development of procedure-related micrometastasis of a broad genus of cancers without any limitation regarding which intervention it encompasses. Based on the broadest reasonable interpretation, the claimed invention encompasses any diagnostic and therapeutic intervention, regardless of whether the intervention causes metastasis or not, and regardless of which cancer types it involves. The specification shows no example of any intervention to support the breadth of the claim. The scope of the independent claim 10 encompasses distinct types of interventions for cancers of undefined types. Despite brief references to these options in the claims and specification, only examples involving chemotherapy agent Paclitaxel and TNBC are offered to support the breadth of the claim. Accordingly, claims 1 and 10 are unduly broad. Guidance of the Specification Regarding claim 1, the specification is silent as to: how step a) impacts the development of micrometastasis as a result of step b). The specification provides no example of how to evaluate procedure-related micrometastasis and demonstrates no “diagnostic” or “intervention” following step a) in any of the examples provided. The recitation of methods to detect micrometastasis relies on qRT-PCR detection of a human-specific α-satellite region on chromosome 17 (Page 15, ¶[0085], line 3). In human patients, all cells, normal cells and cancer cells, would be positively identified, rendering such a method completely unusable in human patients. PHOSITAs have no way of applying the method as claimed. Regarding claim 10, the specification is silent as to how step a) taken “before, during or in connection” with any of the claimed procedures, except a single working example of applying step a) “during” chemotherapy (Page 20, ¶[00108]; FIG. 8A-D for in vitro experiments on breast cancer cells; ¶[00109]; FIG. 8E for in vivo experiments using flank implantation of human breast cancer cell line 4IC in immunodeficient NSG mice). However, the example does not provide sufficient guidance for PHOSITAs to apply the invention as required by the claim, because there is zero guidance regarding how to use step a) to achieve prevention of micrometastasis. The example only evaluated the size reduction effect of step a) on the breast cancer mass volume of the primary xenograft (FIG. 8E). Furthermore, the example of treatment of late-stage TNBC (FIG. 9; Page 22, ¶[00117] & [00118]), step a) does not involve “at least one of the following procedure: surgery, diagnostic or therapeutic intervention, chemotherapy, radiation therapy, immunotherapy or targeted intervention”, which is required in the claim. In addition, the figure demonstrates the original intra-mammary xenograft sites, i.e. primary tumors (Page 14, ¶[0082]). The tumor signals (luciferase hotspots) shown in the figure are not metastases, rather primary tumor masses. This is not considered a working example. The specification does in fact include an example involving GBM models in mice, however, it is not considered a working example because step a) does not involve “at least one of the following procedure: surgery, diagnostic or therapeutic intervention, chemotherapy, radiation therapy, immunotherapy or targeted intervention”, which is required in the claim. As shown in the specification of the current application, there is zero example of micrometastasis observed in distant organs of the PDX mice that involve the claimed methods required by claim 1 or claim 10. FIGURE 3 shows distal organ metastases, but the cancer cells were pre-treated with TRAF3IP2 knock down agents prior to xenograft in mice. This is not considered a working example because it is not clinically relevant as it is impossible to pre-treat any cancer cells already in the body. The State of the Prior Art With regard to the state of the art, a review article by Steeg (2016) teaches that “In primary tumour xenograft models, the tumour cells have not inter-acted with the metastatic microenvironments at all, and this preclinical experimental design would only be rele-vant for targeting initial oncogenic trunk mutations and any effects they may have on metastasis” (Page 211, 1st ¶, last 6 lines). Steeg further teaches that “Genomically, analyses of matched sets of a patient’s primary tumour and distant metas-tasis reveal mutations common to both and, almost universally, mutations that are distinct to a metastasis” (Page 201, left column, last 4 lines). These facts highlight the unpredictability using xenograft models of primary tumors to validate the efficacy of anti-metastasis effect of a drug candidate on metastases, which harbor mutations that may render the impact unpredictable. Gupta (Cell. 2006 Nov 17;127(4):679-95) teaches that extrinsic selection pressure of the tumor microenvironment lead to unpredictable genomic and phenotypic changes in metastatic cancer cells as compared with the primary tumor (Page 681, Figure 2; Page 683, Figure 3) and that distinct subpopulations of cancer cells form in distant organs with distinct microenvironmental cues (Page 686, Figure. 4). These well-established principles all point to the unpredictability of using xenograft primary tumor to determine therapeutic efficacy against metastatic secondary cancer loci, especially for hard-to detect micrometastasis. Khuu (Cells. 2024 Nov 11;13(22):1869) teaches that “The use of ASOs in glioblastoma remains disappointing despite promising clinical trial results in other cancers” (Page 12, under 4.3 Limits of Antisense Oligonucleotides in Glioblastoma) after discussing the cancelled clinical developments for Ionis’ aprinocarsen (Page 11, under 4.2 Antisense Oligonucleotides Used in Glioblastoma) and Isarna’s trabedersen (Page 12, 2nd ¶). Khuu further teaches that “The first limitation is related to preclinical cellular and animal models. … cell lines mainly used as a model of glioblastoma are commercial cell lines grown in fetal calf serum and have significant molecular differences from clinical glioblastoma cells. Animal models are also often unrepresentative in terms of the tumor microenvironment”(Page 12, last ¶, lines 3-8). Limited accessibility across the blood brain barrier (BBB) and biodistribution of ASOs to tumor cells are also major barriers for clinical success (Page 13, under 4.3). Finally, Khuu teaches that “ASOs that have received approval or are under development focus on a single molecular alteration associated with pathophysiology. However, cancers arise from a multitude of diverse targets, and addressing only one of these may be insufficient for effective treatment” (Page 13, 3rd ¶). Zhu (Jpn J Clin Oncol. 2026;56(5):503-517) teaches that despite the recent FDA approvals for several ASO-based therapeutics, only one ASO was approved for cancer therapy thus far (Page 508, Table 2, Imetelstat, a first-in-class telomerase inhibitor), highlighting the challenge and unpredictability of such endeavors. Regarding shRNA, Goel (Front Mol Neurosci. 2022;15:914430) summarizes that “factors contributing to the shRNA technology’s neurotoxicity and poor efficiency make it highly unlikely that the system will see significant improvements in the coming years”. The Level of Predictability in the Art In the review articles by Gupta (2006) and Steeg (2016; full citation see above), complex interactions between cancer cells with the metastatic microevironment (Steeg, Page 208, Figure 2) and multiple stages of metastatic progression (Gupta, Page 680, Figure 1) are required to establish the heterogeneity of metastatic populations of cancer cells. The specification lacks any assay in the disclosed examples to assess the impact of the claimed step a) on any metastatic cell population, further demonstrating the unpredictability of the claimed inventions. Based on the dataset presented by the Human Protein Atals (See The Human Protein Atlas_TRAF3IP2_Cancer.pdf listed in PTO-892, page 2), the expression levels of TRAF3IP2 in multiple cancer types are not significantly different between the cancerous and normal samples (see below), e.g. Glioblastoma. At least in this dataset, only Renal Cell Carcinoma samples show significant elevation in TRAF3IP2 expression levels. This indicates, it is highly unpredictable in the art to identify suitable therapeutic candidates since the expression levels of TRAF3IP2 in various cancer cells are not significantly increased compared with normal cell types from comparable populations. PNG media_image3.png 496 1240 media_image3.png Greyscale Furthermore, it is entirely unpredictable what is “an amount effective for prevention of micrometastasis” required for both claims 1 and 10, because there is zero example in the disclosure providing any guidance for PHOSITAs to ascertain such a functional limitation. Because of the absence of art-recognized reference range, prior art does not establish predictability. The Quantity of Experimentation necessarily Needed In light of the high level of unpredictability in the art, and the limited amount of direction provided by the inventor regarding whether TRAF3IP2 expression inhibitors can be effective in prevention of development of micrometastasis, and the noticeable absence of working examples, the quantity of experimentation necessarily needed to make or use the invention as claimed, especially with respect to treating diverse clinical types of cancers with complex multiomics profiles, based on the disclosure is considerably high. For example, it would be necessary for one skilled in the art to first determine whether the claimed TRAF3IP2 targeting sequences can actually prevent micrometastasis. With zero guidance in the disclosure, skilled artisans would need to perform complete in vitro, ex vivo, and in vivo experiments to asertain the potential impact on micrometastasis. There would be an unreasonable amount of experimentation required by a person of ordinary skill in the art. Conclusion of 35 U.S.C. 112(a) Enablement Analysis After applying the Wands factors and analysis to claims 1 and 10, taking into consideration the factors outlined above, including the nature of the invention, the breadth of the claims, the state of the art, the guidance provided by the applicant and the specific examples, in view of the applicant’s entire disclosure, it is concluded that the specification is not enabled for the full scope as discussed above. Therefore, claims 1 and 10 are rejected under 35 U.S.C. §112(a) for failing to disclose sufficient information to enable a person of skill in the art to use the invention commensurate in scope with these claims. Claims 2-9, 11-12, 14-15, 18 are also rejected for depending from claim 1 or 10 and failing to remedy the lack of enablement therein. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DELPHINUS DOU YI YU/Examiner, Art Unit 1636 /NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Oct 13, 2023
Application Filed
Sep 14, 2026
Non-Final Rejection mailed — §112 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
33%
Grant Probability
33%
With Interview (+0.0%)
2y 9m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 6 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month