DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s election without traverse of group I, as well as SEQ ID NOs: 102 and 1011, in the reply filed on 9/10/26 is acknowledged.
Claims 175-188 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 9/10/26. Claim 188 is in group III and is withdrawn.
Drawings
The drawings filed on 10/16/23 are objected to for the following reasons:
37 C.F.R. 1.84 states “Character of lines, numbers, and letters. All drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.”
In the current case, Figures 5, 9, 16-18, 19A, 22, 26, 30, 31, 32A, 33A, 33B, 34-37C, 39, 40, 43A, and 44 are not completely legible.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Improper Markush Rejection
Claims 170-174 are rejected on the judicially-created basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). The improper Markush grouping includes species of the claimed invention that do not share both a substantial structural feature and a common use that flows from the substantial structural feature. The members of the improper Markush grouping do not share a substantial feature and/or a common use that flows from the substantial structural feature for the following reasons: The claims are directed to 403 targeting domains that are complementary to 403 different target sequences. Each of the gRNAs target a specific sequence dependent upon the specific sequence of the targeting domain. The activity of each is dependent upon the specific sequence of nucleotides.
Doench et al. (Nature Biotechnology, 2014, 32, 12, 1262-1269) teach experimental testing of 1,841 sgRNAs tiled across six mouse and three human genes and found substantial different in sgRNA activity depending on the guide/target sequence. Therefore, sgRNAs targeted to the same gene do not necessarily have identical activity.
For example, Doench et al. teach that sgRNA activity differed significantly with guanine being strongly preferred over cytosine (page 1265). It is noted that the instantly recited genus includes both.
In response to this rejection, Applicant should either amend the claim(s) to recite only individual species or grouping of species that share a substantial structural feature as well as a common use that flows from the substantial structural feature, or present a sufficient showing that the species recited in the alternative of the claims(s) in fact share a substantial structural feature as well as a common use that flows from the substantial structural feature. This is a rejection on the merits and may be appealed to the Board of Patent Appeals and Interferences in accordance with 35 U.S.C. 134 and 37 CFR 41.31(a)(1).
When the Markush grouping is for alternatives of chemical compounds, they shall be regarded as being of a similar nature where the following criteria are fulfilled:
(A) All alternatives have a common property or activity; and
(B) (1) A common structure is present, i.e., a significant structural element is shared by all of the alternatives; or
(B) (2) In cases where the common structure cannot be the unifying criteria, all alternatives belong to a recognized class of chemical compounds in the art to which the invention pertains.
In paragraph (B)(1), above, the words “significant structural element is shared by all of the alternatives” refer to cases where the compounds share a common chemical structure which occupies a large portion of their structures, or in case the compounds have in common only a small portion of their structures, the commonly shared structure constitutes a structurally distinctive portion in view of existing prior art, and the common structure is essential to the common property or activity. The structural element may be a single component or a combination of individual components linked together.
In paragraph (B)(2), above, the words “recognized class of chemical compounds” mean that there is an expectation from the knowledge in the art that members of the class will behave in the same way in the context of the claimed invention. In other words, each member could be substituted one for the other, with the expectation that the same intended result would be achieved.
In order for the members of the Markush group to belong to “recognized class of chemical compounds” there must be an expectation that the members of the class will behave in the same way in the context of the claimed invention. In other words, each member of the class could be substituted one for the other with the expectation that the same intended result would be achieved. In the instant case, activity of any specific gRNA is dependent upon the specific sequence of nucleotides. There is no expectation that any one of the nucleotide sequences as claimed can be substituted for any of the other with a completely different sequence with the expectation of the same activity.
As set forth in MPEP2117, “Note that where a Markush group includes only materials from a recognized scientific class of equivalent materials or from an art-recognized class, "the mere existence of such a group in an application tend[s] to prove the equivalence of its members and when one of them [is] anticipated the group [is] therefore rendered unpatentable, in the absence of some convincing evidence of some degree of non-equivalency of one or more of the remaining members." In re Ruff, 256 F.2d 590, 598-99, 118 USPQ 340, 348 (CCPA 1958)("[A]ctual equivalence is not enough to justify refusal of a patent on one member of a group when another member is in the prior art. The equivalence must be disclosed in the prior art or be obvious within the terms of Section 103." Id. at 599, 118 USPQ at 348).”
In the instant case, art against any one gRNA would not be evidence against any of the remaining members that have completely different sequences and do not have identical activity.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 173 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 173 recites that the first nucleotide sequence is a first viral vector and the second nucleotide sequence is a second viral vector. The nucleotide sequence as claimed encodes a RNA-guided nuclease or a gRNA, but is not the actual vector. The claims are therefore not definite.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 169 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Tsai et al. (Ophthalmology, 2018 May 11, 125(9), 1421-1430).
Tsai et al. teaches an ablate-and-replace system comprising two AAV vectors: one AAV encoded SpCas9 (RNA-guided nuclease) and the second AAV encoded two gRNAs targeting Rho plus a human RHO cDNA replacement sequence. The vectors were administered in a composition together via subretinal injection to mice, meeting the instant limitation of a pharmaceutical composition (pages 1422 and 1424) (instant claim 169).
Therefore, the claim is anticipated by Tsai et al.
Claim(s) 169-174 is/are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Diner et al. (WO 2020/176552 A1).
Diner et al. teach: Fig. 2 is a schematic of an exemplary dual AAV delivery system that may be used for a variety of applications, including without limitation, the alteration of the RHO target position, according to certain embodiments of the disclosure. Vector 1 shows an AAV5 genome, which encodes ITRs, a GRK1 promoter, and a Cas9 molecule flanked by NLS sequences. Vector 2 shows an AAV5 genome, which encodes ITRs, a minimal RHO promoter, a. RHO cDNA molecule, a U6 promoter, and a gRNA. In certain embodiments, the AAV vectors may be delivered via subretinal injection (instant claim 169).
The gRNA comprises any of instant SEQ ID NOs: 100-110, for example (Example 8)(instant claim 170).
Diner et al. teach: Fig. 16 is a schematic of an exemplary AAV vector (SEQ ID NO: 11) according to certain embodiments of the disclosure. The schematic shows an AAV5 genome comprising and encoding an ITR (SEQ ID NO:92), a first U6 promoter (SEQ ID NO:78), a first RHO-7 gRNA (comprising a RHO-7 gRNA targeting domain (SEQ ID NO:606) (DNA) and SEQ ID NO: 12), a second U6 promoter (SEQ ID NO:78), a second RHO-7 gRNA (comprising a RHO-7 gRNA targeting domain (SEQ ID NO:606) (DNA) and SEQ ID NO: 12), a minimum RHO Promoter (250 bp) (SEQ ID NO: 44), an SV40 Intron (SEQ ID NO: 94), a codon optimized RHO cDNA (SEQ ID NO: 18), HBA1 3’ UTR (SEQ ID NO:38), a minipolyA (SEQ ID NO:56), and a right ITR (SEQ ID NO:93). In certain embodiments, the AAV vector may be delivered via subretinal injection.
Diner et al. teach: Fig. 17 is a schematic of an exemplary AAV vector (SEQ ID NO: 10) according to certain embodiments of the disclosure. The schematic shows an AAV5 genome comprising and encoding an ITR (SEQ ID NO:92), a minimum RHO Promoter (250 bp) (SEQ ID NO:44), an SV40 Intron (SEQ ID NO:94), an NLS sequence, an S. aureus Cas9 sequence, an SV40 NLS, an HBA1 3’ UTR (SEQ ID NO:38), and a right ITR (SEQ ID NO:93). In certain embodiments, the AAV vector may be delivered via subretinal injection.
Diner et al. teach: Fig. 18 is a schematic of an exemplary AAV vector (SEQ ID NO:9) according to certain embodiments of the disclosure. The schematic shows an AAV5 genome comprising and encoding an ITR (SEQ ID NO:92), a minimum RHO Promoter, an SV40 SA/SD, an NLS, an S. aureus Cas9 sequence, an SV40 NLS, a minipolyA (SEQ ID NO:56), and a right ITR (SEQ ID NO:93). In certain embodiments, the AAV vector may be delivered via subretinal injection (instant claim 172).
Diner et al. teach: delivery of 1: 1 vectors (examples) (instant claims 173 and 174).
Therefore, the claims are anticipated by Diner et al.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 170 is/are rejected under 35 U.S.C. 103 as being unpatentable over Tsai et al. (Ophthalmology, 2018 May 11, 125(9), 1421-1430) as applied to claim 169 above, and further in view of Doench et al. (Nature Biotechnology, 2014, 32, 12, 1262-1269), Guo et al. (Journal of Human Genetics (2010) 55, 571-576), and Nelles et al. (US 2021/0009987 A1).
The claims are rejected as being directed to an improper Markush group, as set forth above. The instant rejection is directed to the alternative of the gRNAs being obvious as a matter of design choice; and to the specific elected species SEQ ID NO: 102.
Tsai et al. teaches an ablate-and-replace system comprising two AAV vectors: one AAV encoded SpCas9 (RNA-guided nuclease) and the second AAV encoded two gRNAs targeting Rho plus a human RHO cDNA replacement sequence. The vectors were administered in a composition together via subretinal injection to mice, meeting the instant limitation of a pharmaceutical composition (pages 1422 and 1424) (instant claim 169).
It was known to design gRNAs to RHO, as taught by Tsai et al. (page 1424, gRNA1 and gRNA2). Selection of a gRNA within instant SEQ ID NOs: 100-502 would have been an obvious selection as a matter of design choice, as blanketing a target sequence with all possible gRNA sequences was known, as evidenced by Doench et al. (instant claim 170).
Doench et al. teach experimental testing of 1,841 sgRNAs tiled across six mouse and three human genes and teach rationale design of sgRNAs.
Additionally, before the effective filing date, Guo et al. taught the mRNA sequence of the rhodopsin gene was publicly available as evidenced by NCBI Reference Sequence NM_000539.3. The human RHO gene sequence (NM_000539.3) was taught by Guo et al. (page 63, left column) more than one year prior to the effective filing date of the instant application.
Alignment of instant SEQ ID NO: 102 to the sequence of NM_000539.3:
Instant SEQ ID NO: 102
1 AGUAUCCAUGCAGAGAGGUGUA 22
Db
402 AGTATCCATGCAGAGAGGTGTA 381
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to choose instant SEQ ID NO: 102 or any of the recited gRNAs targeting exon1 or exon 5, as taught by Guo et al., as a matter of design choice (instant claims 169 and 170).
Furthermore, Nelles et al. teach an “exemplary rhodopsin (RHO) targeting gRNA spacer, SEQ ID 2984” that comprises instant SEQ ID NO: 102 for CRISPR gene replacement strategies. Selection of an exemplary RHO targeting gRNA spacer of the prior art for targeting the same target is certainly a matter of design choice given that it was known in the art for the same purpose.
There would be a reasonable expectation of success, because Guo et al. teach the RHO mRNA sequence was known before the effective filing date, and alignment of the instant sequence with the RHO mRNA sequence is shown. One of ordinary skill in the art would have been motivated to provide a guide RNA of SEQ ID NOs: 102 for use in the method of Tsai et al. because each have the same intended use.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Art of Interest
It is noted that claims 172-174 would be subjected to a rejection under 35 USC 103(a), as explained below, but are dependent from claim 171, which recites a promoter sequence that is free of the prior art.
With regards to claim 172, the claims are directed to incorporation of known design elements for expressing Cas9 and gRNAs. The specific sequence selection of each is considered to be a matter of design choice, as each would be expected to achieve the required function.
For example, Ibraheim et al. (Nature Communications, 2021, 12:6267, 1-17) teach AAV vectors for expression of Cas9 and gRNAs, wherein the vectors comprise a 5’ITR, Cas9 under the expression of a U1a promoter, SV40, donor sequence, polyA sequence, 3’UTR and 3’ ITR. It would have been obvious to incorporate these components to express the cDNA and gRNAs of Tsai et al. with a reasonable expectation of successful expression as the components were known to be used for the same intended purpose.
The limitations of claim 173 is taught by Tsai et al., but the claim is dependent upon a claim that is free of the prior art.
Tsai et al. teach delivery of 25 ng/uL of gRNA to 30 ng/uL of Cas9 (2:1 Cas9:gRNA) and injection of 1:1 (page 1422) (instant claim 174).
The specific ITR sequences of claim 171 are known, as taught by Tang et al. However, the recited promoter is free of the prior art.
Tang et al. (WO 2005/037226 A2) teach a sequence that is 100% identical to instant SEQ ID NO: 1011 (see SEQ ID NO: 2) and teach that the sequence is a left adeno-associated virus 2 inverted terminal repeat; and Tang et al. teach a sequence that is 100% identical to instant SEQ ID NO: 93 (see SEQ ID NO: 11) and teach that the sequence is a right adeno-associated virus 2 inverted terminal repeat . Tang et al. expressly teach that the nucleotide sequences of AAV ITR regions are known and may be altered, e.g., by the insertion, deletion or substitution of nucleotides. Additionally, AAV ITRs may be derived from any of several AAV serotypes, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc. Tang et al. teach that expression constructs are flanked by AAV2 ITRs for expression.
Tang et al. teach a construct as follows: Left AAV2 ITR (SEQ ID NO:2); CMV promoter (SEQ ID NO:3); Intron (SEQ ID NO:4); PPI cDNA (SEQ ID NO:5); SV40 polyA/SV40 enhancer (SEQ ID NO:6); SV40 Promoter (SEQ ID NO:7); EGFP cDNA (SEQ ID NO:8); Intron (SEQ ID NO:9); hGH polyA (SEQ ID NO: 10); Right AAV2 ITR (SEQ ID NO: 11).
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 169-174 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 119 and 121-129 of copending Application No. 17/433,975 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of application ‘975 are directed to a gRNA comprising a targeting domain that is complementary to RHO, wherein the targeting domain comprises one of instant SEQ ID NOs: 100-103 (claim 119)(instant claims 169 and 170); a sequence encoding the gRNA (claim 121)(instant claim 169); further comprising a sequence encoding Cas9 (claims 122 and 123)(instant claim 169); further comprising a RHO cDNA (claim 124)(instant claim 169); wherein one of the gRNAs comprise one of instant SEQ ID NOs: 100-502 (claims 125 and 126)(instant claims 169 and 170); wherein the molecules are AAV vectors (clam 128)(instant claim 169). The claims are obvious variations of each other, wherein the specification of application ‘975 defines the expression constructs as having the same configuration as instantly claimed.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/ Primary Examiner, Art Unit 1636