DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1-5, 7-8, 11-12, 15-18, 61, 74, 81 and 82 are pending and examined here.
Priority
The claim to benefit of 63/177,053, filed on 04/20/2021, via its PCT/US2022/025612, filed on 04/20/2022, is recognized. All the claims enjoy the filing date of ‘053 filing.
Drawings
The objection is withdrawn, the sequence of Fig. 1B is legible.
Nucleotide and/or Amino Acid Sequence Disclosures
The objection regarding sequence disclosure specifically of Fig. 1B is withdrawn, Fig. 1B description discloses SEQ ID NOs for relevant sequences in the figure. However, the sequence listing of sequences submitted on 07/07/2026 is recognized as defective (See Sequence listing report of 07/16/2026), thus the objection is maintained.
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
1) 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
a) In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
i) the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
b) In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
i) the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
c) In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
d) In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
1) When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
a) If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
b) If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - This application fails to comply with the requirements of 37 CFR 1.821 - 1.825 because it does not contain a "Sequence Listing" as a separate part of the disclosure and the CRF of the “Sequence Listing” is defective.
Required response - Applicant must provide:
A "Sequence Listing" part of the disclosure, as described above in item 1); together with
An amendment specifically directing its entry into the application in accordance with 37 CFR 1.825(a)(2);
A statement that the "Sequence Listing" includes no new matter as required by 37 CFR 1.825(a)(4); and
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(a)(3)
If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
If the "Sequence Listing" part of the disclosure is submitted according to item 1) c) or d) above, Applicant must also provide:
A CRF in accordance with 37 CFR 1.821(e)(1) or 1.821(e)(2) as required by 37 CFR 1.825(a)(5); and
A statement according to item 2) a) or b) above.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 15 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 15 is an incomplete sentence: it ends by reciting “and wherein the human CD8+ T cell.”
Based on the prior version of the claim and instant claim 1, the claim will be interpreted to read “and wherein the human CD8+ T cell does not secrete TGF-β1”
Claim Rejections - 35 USC § 101
Rejection of claims 61, 74, and 81 under 101 is withdrawn, the claims recite “isolated human” T-cell.
Claim Rejections - 35 USC § 102
Rejection of claims 1, 2, 3, 4, 6, 7, 8, 11, 12, 15, 16, 17, 18, 61, 74, 81, and 82 is withdrawn due to amendment to claim 1.
Claim Rejections - 35 USC § 103
Rejection of claims 9, 10 under 103 in view of Martin, Labun and Chopchop TGFB1 results is withdrawn due to claim 1 amendment. Rejection of claim 5 under 103 in view of Martin and Boldt is withdrawn due to claim 1 amendment. Upon further consideration, the claims are rejected as noted below.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-4, 7-8, 11-12, 15-18, 61, 74, 81 and 82 are rejected under 35 U.S.C. 103 as being unpatentable over Martin (US20250127811, pub. 04/24/2025 (“Martin”); one priority document (63/145448) claims priority to 02/03/2021 (‘448)) in view of Labun et al. (2019, Nucleic Acid Res., 47, W171-W174, “Labun”) and CHOPCHOP TGFB1 results printout as an appendix of the paper.
Martin discloses T-cell adoptive immunotherapy for cancer treatment utilizing isolated human T-cells to design "off the shelf" CAR T cells to avoid expense and the autologous approach (i.e. use of patient's own T-cells), thus using T-cells derived from 3rd party and discloses that cells expressing TGF-B1 (transforming growth factor beta-1) leads to activation of pathway that negatively impacts immune cell proliferation and activation (par. 3-5; ‘448, pg. 1-2, lines 18-25). Martin discloses the intracellular stimulatory domain that transmits a proliferative and/or cell-survival signal after ligand binding; CD8 is one of the domains (par. 284, ‘488, pg. 52, line 9-14, relevant to instant cl. 1). Martin discloses T-cells may require activation prior to introduction of nuclease, i.e. can be contacted with anti-CD3 and anti-CD28 antibodies (par. 419; ‘488, pg. 90, line 26-29); these will result in CD8 expression on T-cells (relevant to instant cl. 1). Martin discloses knocking down/out expression of TGF-B1 using a genetically modified eukaryotic cell comprising in its genome an inactivated TGF-B1 gene with the gene encoding TGFB1 protein is disrupted (cl. 31) along with nucleic acid sequence encoding an engineered antigen receptor. Cl. 35 and 36 disclose use of nucleases system, including CRISPR system for modifying TGFB-1 gene (also see par. 36; ‘488, pg. 7, lines 23-30). Alternatively, Martin, in a different embodiment, demonstrates isolated and stimulated T-cells that were transduced with AAV6 vectors containing TGFB1-specific shRNAmiR sequences in Table 1 (par. 439-440; ‘488, pg. 96-97) and demonstrates knockdown in Fig. 1, with vector 72175 demonstrating ~90% knockdown. Martin discloses that TGFB1 knockdown may perform better for some cancer alone or in combination with TGFB receptor modifications and notes a CRISPR system to knockout target gene expression (par. 445). Martin discloses the Chopchop web tool for genome editing to identify recognition sequences, including gRNAs (par. 237).
Martin does not disclose targeting exon 1 of TGFB1, nor the specific SEQ ID NO: 1 to be targeted.
Labun discloses the release of a CHOPCHOP version 3 webtool used to identify guide RNAs to introduce mutations in the genome (abstract, pg. W172). Using the Chopchop site (chopchop.cbu.uib.no/) and entering “TGFB1” gene name provided 17 results, and the sequence of the result number 6 matched instant SEQ ID NO: 1 (GGCCGACTACTACGCCAAGGAGG, T = U; chopchop.cbu.uib.no/results/eb77376c-4bcf-4511-8bf8-f7b3b40801f6/, accessed 03/23/2026; relevant to instant cl. 1). The sequence of result #6 inherently targets exon 1 (relevant to instant cl. 1).
One of the KSR’s rationale for supporting conclusion of obviousness is “obvious to try,” requiring the following three findings: (1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
Although Martin discloses that TGFB1 knockdown may perform better for some cancer alone or in combination with TGFB receptor modifications and notes a CRISPR system to knock out target gene expression, Martin does not disclose any gRNAs. Labun discloses a Chopchop software tool that a skilled artisan can use to identify definite number of gRNAs to try to knockout expression of the target gene by using the CRISPR system.
Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried introducing a TGFB1 knockdown of Martin in view of Labun to have arrived at the claimed invention with a reasonable expectation of success. Martin demonstrates TGFB1 knockdown may perform better for some cancer alone or in combination with TGFB receptor modifications (par. 445; ‘488, p. 98, line 21-22), and Labun’s Chopchop software tool provides definite number of gRNAs to target TGFB1 gene, thus a skilled artisan would reasonably expect success in knocking out TGFB1 gene by using a CRISPR system as taught by Martin, by trying the various gRNAs, including gRNA sequence of result #6, provided by Chopchop site. Thus, cl. 1 is obvious.
Regarding instant cl. 2, the cell “does not express TGF-B1” is a result of the process of the active steps of cl. 1. Using the CRISPR system results in cells not expressing TGF-B1 protein. In an alternative embodiment, similar percentage knockdown using a AAV6 driven vector of shRNAmiR targeting TGFB1 resulted in ~90% knockdown of TGF-B1 expression, see Fig. 1.
Regarding instant cl. 4, as noted above, Martin discloses utilizing isolated human T-cells (par. 3-5) and the cells can be activated by contact with anti-CD3 and anti-CD28 antibodies (par. 419; ‘488, pg. 90, line 26-29); these will result in CD8 expression on T-cells.
Regarding instant cl. 3, 7, 8 Martin discloses the use of site-specific nuclease to make a DNA break in the genome followed by non-homologous end-joining (NHEJ) repair to inactivate an allele via generation of early stop codons, frameshift mutations producing aberrant non-functional proteins, insertions, deletions or trigger mechanisms such as nonsense-mediated mRNA decay (par. 389; ‘488, pg. 82, lines 24 to pg. 83, line 2); thus by use of CRISPR system, the inherent outcome is the formation of mutation(s) in the TGFB1 gene that may result in a mutant TGFB1 protein and may result in nonsense mutation.
Regarding instant cl. 11, 12, Martin discloses T cell adoptive immunotherapy has been utilized as a clinical therapy for various types of cancers, including melanoma, and it is known a cancer can be a recurrent cancer if it is not eliminated and/or is a malignancy (par. 3; ‘488, pg. 1, line 25-29).
Regarding instant cl. 15, Martin discloses administering the genetically modified eukaryotic cells to a subject in an effective amount (cl. 192, 195; ‘488, pg. 8, line 13-14).
Regarding instant cl. 16, 17, Martin discloses a subject is further administered an additional therapeutic, such as chemotherapeutic agent (par. 428, ‘488, pg. 94, line 8-11).
Regarding instant cl. 18, Martin discloses that CRISPR system includes Cas9 endonuclease and a guide RNA that directs nucleic acid cleavage by Cas9 following hybridization to a recognition site in a polynucleotide (par. 237; ‘488, pg. 37, line 7-30). It is noted above that Martin discloses targeting TGFB-1 gene using CRISPR system.
Regarding instant cl. 61, 74, 81, Martin discloses the invention provides a pharmaceutical composition comprising a genetically-modified eukaryotic cell/or population of genetically modified eukaryotic cells and a pharmaceutically-acceptable carrier (par. 425, ‘488, pg. 93, line 10-26); it is known carriers are species of the excipient genus. Further, Martin demonstrates use of T-cells tested for CD8 expression and that expressed exemplary shRNAmiR sequences targeting TGFB1 (‘488, pg. 96-7).
Regarding instant cl. 82, Martin discloses administration of an effective amount of genetically-modified eukaryotic cells to a subject with cancer (par. 430-431; ‘488, pg. 94-95).
Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over Martin (US20250127811, pub. 04/24/2025 (“Martin”); one priority document (63/145448) claims priority to 02/03/2021 (‘448)) in view of Labun et al. (2019, Nucleic Acid Res., 47, W171-W174, “Labun”) and CHOPCHOP TGFB1 results printout as an appendix of the paper, as applied to claims 1, 2, 3, 4, 7, 8, 11, 12, 15, 16, 17, 18, 61, 74, 81, and 82, above, and further in view of Boldt (pub. 4/15/2021, www.mdanderson.org/cancerwise/what-is-tumor-infiltrating-lymphocyte-til-therapy--6-things-to-know.h00-159460056.html, accessed 03/23/2026).
Disclosure of rejection of cl. 1, 2, 3, 4, 7, 8, 11, 12, 15, 16, 17, 18, 61, 74, 81, and 82 is noted above. Martin discloses that TGFB1 knockdown may perform better for some cancer alone or in combination with TGFB receptor modifications and notes a CRISPR system to knockout target gene expression (par. 445).
Martin does not disclose CD8+ T cell is a tumor-infiltrating lymphocyte.
Boldt discloses that tumor-infiltrating lymphocytes (TILs) recognize abnormal cells and penetrate the tumor and begin to kill cancer cells but may be prevented by inherent signaling that weaken the immune response (pg. 1-2). Since TILs come directly from tumor, they already recognize many targets on the cancer cells since targeting is not required, as opposed to CAR T cells that may need further targeting engineering (pg. 2). Boldt discloses performing biopsy to isolate the TILs and expanding them (pg. 2).
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified CAR-T cells of Martin in view of Boldt and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Martin’s inhibition of TGF-B1 expression leading to improved expansion of CAR-T cells, and Boldt’s disclosure that TILs are isolated tumor-penetrative cells with recognition marker for tumors and can go further genetic engineering processing, a skilled artisan can modify the TILs with guide RNA targeting exon 1 of TGF-B1 gene and Cas9 to shut-down expression of immunosuppressive TGF-B1 signaling. Thus cl. 5 is obvious.
Response to Arguments
Applicant's arguments filed 07/07/2026 (“the Remarks”) have been fully considered but they are not persuasive.
The Remarks argue the following:
1. Neither Martin nor Boldt disclose “the claimed exon 1/SEQ ID NO: 1-edited human CD8+ T cell that does not secrete TGF-β1” (pg. 9, 10). Martin broadly describes reducing TGF-B activity and instant specification is more specific by showing “that depleting endogenous TRGB1 in engineered CD8+ T cells using the exon 1 target comprising SEQ ID NO: 1” and characterizes the results of these cells, including “enhanced cytokine production while not dramatically affecting TRM [resident memory T cells] formation" and increased cytolytic activity based on knocking out TGFB1 gene (pg. 10).
2. Martin and Boldt "concern different therapeutic cell platforms" and the action does not establish “why a skilled artisan would have modified Martin's off-the-shelf CAR T-cell platform using Boldt’s TIL platform and further selected the particular TGFB1 exon 1 region comprising SEQ ID NO: 1 to generate cells that do not secrete TGF-β1” (pg. 10).
3. The “obvious to try” rationale used is insufficient, since the “cited combination identifies a guide-selection tool, [i.e., a ChopChop tool] not a finite set of predictable solutions" (pg. 11). Further argues that "[i]dentification of a candidate guide RNA is not a teaching that the candidate guide RNA will produce the claimed human CD8+ T cell comprising a mutation in exon 1 of TGFB1 and having the required non-secretion phenotype" (pg. 11).
The argument is not persuasive.
Regarding arguments 1 and 2, in response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Thus, arguments solely focused on Martin and Boldt is not persuasive. Regardless, Boldt provides sufficient rationale to modify TILs, since TILs, unlike CAR T cells of Martin, recognize abnormal cells and penetrate the tumor to begin to kill cancer cells (pg. 10 of 04/07/2026 Action). Further Boldt also indicates that CAR T cells would require further engineering for them to target cancer cells (pg. 10 of 04/07/2026 Action). Thus prior Action and this action provides sufficient rationale to use TILs.
Regarding lack of exon 1 or SEQ ID NO: 1 disclosure by Martin and Boldt, the action has indicated that Martin discloses the obvious use of CRISPR system to mutate TGFB1 gene since its activation negatively impacts immune cell proliferation and activation, and Martin provides CHOPCHOP tool to design gRNAs. Further, the use of CHOPCHOP software tool identifies finite gRNAs that a skilled artisan can try to target TGFB1 gene, and the gRNA sequence of result 6 provided by CHOPCHOP tool would target exon 1 of TGFB1.
Regarding argument 3, the purpose of a tool is to use it, and both Martin and Labun provide rationale to use the CHOPCHOP tool, which is to identify gRNAs to target a specific gene of interest.
Regarding arguments 1 and 3, the resulting activity following editing of the TGFB1 gene would be based on performing the active step creating a mutation in a region of exon 1 of TGFB1. Here, the results are mere characterization of the performing the active step of the method claim. Martin, in an alternative way, i.e. by the use of shRNA targeting TGFB1 transcript, demonstrates that targeting the TGFB1 gene resulted in decreased TGFB1 expression (Fig. 1, 72175 shRNA resulted in 90% knockdown of TGFB1 expression) and a consequence of decreased expression would be decreased or non-existent “secretion of TGF-β1”. Here, the Remarks fail to point out why the result of generating a mutation of exon 1 of TGFB1 using gRNAs disclosed by CHOPCHOP tool with Cas9 would not result in knock out of secretion of TGF-β1 or the other downstream results described in the specification; Martin simply demonstrates an alternative embodiment (shRNA targeting TGFB1 transcript) to prevent secretion of TGF-β1 and discloses the obvious CRISPR-system variant to also prevent secretion of TGF-β1 to battle cancer.
Thus examined claims are rejected under 103.
Allowable Subject Matter
No claim allowed.
Closing Paragraph
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600
