Prosecution Insights
Last updated: October 04, 2026
Application No. 18/555,846

METHODS AND COMPOSITIONS FOR GENETIC MODIFICATION AND THERAPEUTIC USE OF IMMUNE CELLS

Final Rejection §101§102§103
Filed
Oct 17, 2023
Priority
Apr 20, 2021 — provisional 63/177,053 +2 more
Examiner
VYAS, KEYUR ANILKUMAR
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Board of Regents of the University of Texas System
OA Round
2 (Final)
49%
Grant Probability
Moderate
3-4
OA Rounds
8m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 49% of resolved cases
49%
Career Allowance Rate
38 granted / 77 resolved
-10.6% vs TC avg
Strong +61% interview lift
Without
With
+60.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
42 currently pending
Career history
123
Total Applications
across all art units

Statute-Specific Performance

§101
5.2%
-34.8% vs TC avg
§103
35.7%
-4.3% vs TC avg
§102
17.0%
-23.0% vs TC avg
§112
25.5%
-14.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 77 resolved cases

Office Action

§101 §102 §103
CTNF 18/555,846 CTNF 97139 DETAILED ACTION Notice of Pre-AIA or AIA Status 07-03-aia AIA 15-10-aia The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. Claim Status Claims 1-18, 61, 74, 81 and 82 are pending and examined here. Priority The claim to benefit of 63/177,053, filed on 04/20/2021, via its PCT/US2022/025612, filed on 04/20/2022, is recognized. All the claims enjoy the filing date of ‘053 filing. Information Disclosure Statement 06-52 The information disclosure statement (IDS) submitted on 06/24/2024 and 11/12/2025 were filed before the mailing date of this Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. 06-49-06 AIA The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited in the IDS or by the examiner on form PTO-892, they have not been considered. Drawings 06-22 AIA The drawings are objected to because the sequences in Fig. 1B are illegible . Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Fig. 1B has sequences greater than 9 nt. and are missing sequence identifiers. Required response – Applicant must provide: Amended drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers (i.e., “SEQ ID NO:X” or the like) into the Brief Description of the Drawings, consisting of: • A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); • A copy of the amended specification without markings (clean version); and • A statement that the substitute specification contains no new matter. Claim Rejections - 35 USC § 101 07-04-01 AIA 07-04 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. 07-04-03 AIA 07-04-01 Section 33(a) of the America Invents Act reads as follows: Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism. Claim s 61, 74, and 81 are rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability , 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). The subject to be treated is a human subject (see cl. 1, 82), thus cells of the human subject will comprise the claimed genetic modification. Therefore, the claims would encompass cells in a human organism and the human organism itself . Amending the claim to an isolated cell or a cell in vitro or ex vivo will be remedial . Claim Rejections - 35 USC § 102 07-06 AIA 15-10-15 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. 07-07-aia AIA 07-07 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – 07-08-aia AIA (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. 07-12-aia AIA (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. 07-15-03-aia AIA Claim s 1, 2, 3, 4, 6, 7, 8, 11, 12, 15, 16, 17, 18, 61, 74, 81, and 82 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Martin (US20250127811, pub. 04/24/2025 (“Martin”); one priority document (63/145448) claims priority to 02/03/2021 (‘448)) . Regarding instant cl. 1 , Martin discloses T-cell adoptive immunotherapy for cancer treatment utilizing isolated human T-cells in the hopes designing "off the shelf" CAR T cells to avoid expense and the autologous approach (i.e. use of patient's own T-cells), thus using T-cells derived from 3rd party and cells expressing TGF-B leads to activation of pathway that negatively impact immune cell proliferation and activation (par. 3-5; ‘448, pg. 1-2, lines 18-21). Martin discloses the intracellular stimulatory domain that transmit a proliferative and/or cell-survival signal after ligand binding; CD8 is one of the domains (par. 284, ‘488, pg. 52, line 9-14). Martin discloses T-cells may require activation prior to introduction of nuclease, i.e. can be contacted with anti-CD3 and anti-CD28 antibodies (par. 419; ‘488, pg. 90, line 26-29); these will result in CD8 expression on T-cells. Martin discloses knocking down/out expression of TGF-B using a genetically modified eukaryotic cell comprising in its genome an inactivated TGF-B1 gene with the gene encoding TGFB protein is disrupted (cl. 31) along with nucleic acid sequence encoding an engineered antigen receptor. Cl. 35 and 36 disclose use of nucleases system, including CRISPR system for modifying TGFB-1 gene (also see par. 36; ‘488, pg. 7, lines 23-30). Alternatively, Martin, in a different embodiment, demonstrates isolated and stimulated T-cells that were transduced with AAV6 vectors containing TGFB1-specific shRNAmiR sequences in Table 1 (par. 439-440; ‘488, pg. 96-97) and demonstrates knockdown in Fig. 1, with vector 72175 demonstrating ~90% knockdown. Martin discloses that TGFB1 knockdown may perform better for some cancer alone or in combination with TGFB receptor modifications and discloses a CRISPR system to knockout target gene expression (par. 445). Regarding instant cl. 2 , the cell “does not express TGF-B1” is a result of the process of the active steps of cl. 1. Using the CRISPR system results in cells not expressing TGF-B1 protein. In an alternative embodiment, similar percentage knockdown using a AAV6 driven vector of shRNAmiR targeting TGFB1 resulted in ~90% knockdown of TGF-B1 expression, see Fig. 1. Regarding instant cl. 4 , as noted above, Martin discloses utilizing isolated human T-cells (par. 3-5) and the cells can be activated by contact with anti-CD3 and anti-CD28 antibodies (par. 419; ‘488, pg. 90, line 26-29); these will result in CD8 expression on T-cells. Regarding instant cl. 3, 6, 7, 8 , Martin discloses the use of site-specific nuclease to make a DNA break in the genome followed by non-homologous end-joining (NHEJ) repair to inactivate an allele via generation of early stop codons, frameshift mutations producing aberrant non-functional proteins, insertions, deletions or trigger mechanisms such as nonsense-mediated mRNA decay (par. 389; ‘488, pg. 82, lines 24 to pg. 83, line 2); thus by use of CRISPR system, the inherent outcome is the formation of mutation(s) in the TGFB1 gene that may result in a mutant TGFB1 protein and may result in nonsense mutation. Regarding instant cl. 11, 12, Martin discloses T cell adoptive immunotherapy has been utilized as a clinical therapy for various types of cancers, including melanoma, and it is known a cancer can be a recurrent cancer if it is not eliminated and/or is a malignancy (par. 3; ‘488, pg. 1, line 25-29). Regarding instant cl. 15, Martin discloses administering the genetically modified eukaryotic cells to a subject in an effective amount (cl. 192, 195). Regarding instant cl. 16, 17 , Martin discloses a subject is further administered an additional therapeutic, such as chemotherapeutic agent (par. 428, ‘488, pg. 94, line 8-11). Regarding instant cl. 18 , Martin discloses that CRISPR system includes Cas9 endonuclease and a guide RNA that directs nucleic acid cleavage by Cas9 following hybridization to a recognition site in a polynucleotide (par. 237; ‘488, pg. 37, line 7-30). It is noted above that Martin discloses targeting TGFB-1 gene using CRISPR system. Regarding instant cl. 61, 74, 81, Martin discloses the invention provides a pharmaceutical composition comprising a genetically-modified eukaryotic cell/or population of genetically modified eukaryotic cells and a pharmaceutically-acceptable carrier (par. 425, ‘488, pg. 93, line 10-26); it is known carriers are species of the excipient genus. Regarding instant cl. 82 , Martin discloses administration of an effective amount of genetically-modified eukaryotic cells to a subject with cancer (par. 430-431; ‘488, pg. 94-95) . Claim Rejections - 35 USC § 103 07-06 AIA 15-10-15 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. 07-20-aia AIA The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 07-23-aia AIA The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. 07-20-02-aia AIA This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 07-22-aia AIA Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over Martin (US20250127811, pub. 04/24/2025 (“Martin”); one priority document (63/145448) claims priority to 02/03/2021 (‘448)) as applied to claim s 1, 2, 3, 4, 6, 7, 8, 11, 12, 15, 16, 17, 18, 61, 74, 81, and 82 , above, and further in view of Boldt (pub. 4/15/2021, www.mdanderson.org/cancerwise/what-is-tumor-infiltrating-lymphocyte-til-therapy--6-things-to-know.h00-159460056.html, accessed 03/23/2026) . Disclosure of rejection of cl. 1, 2, 3, 4, 6, 7, 8, 11, 12, 15, 16, 17, 18, 61, 74, 81, and 82 is noted above. Martin discloses that TGFB1 knockdown may perform better for some cancer alone or in combination with TGFB receptor modifications and notes a CRISPR system to knockout target gene expression (par. 445). Martin does not disclose CD8+ T cell is a tumor-infiltrating lymphocyte. Boldt discloses that tumor-infiltrating lymphocytes (TILs) recognize abnormal cells and penetrate the tumor and begin to kill cancer cells but may be prevented by inherent signaling that weaken the immune response (pg. 1-2). Since TILs come directly from tumor, they already recognize many targets on the cancer cells since targeting is not required, as opposed to CAR T cells that may need further targeting engineering (pg. 2). Boldt discloses performing biopsy to isolate the TILs and expanding them (pg. 2). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified CAR-T cells of Martin in view of Boldt and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Martin’s inhibition of TGF-B1 expression leading to improved expansion of CAR-T cells, and Boldt’s disclosure that TILs are isolated tumor-penetrative cells with recognition marker for tumors and can go further genetic engineering processing, a skilled artisan can modify the TILs with guide RNA targeting TGF-B1 gene and Cas9 for cleave following hybridization to shut-down expression of immunosuppressive TGF-B1 signaling. Thus cl. 5 is obvious . 07-22-aia AIA Claim s 9 and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Martin (US20250127811, pub. 04/24/2025 (“Martin”); one priority document (63/145448) claims priority to 02/03/2021 (‘448)) as applied to claim s 1, 2, 4, 11, 12, 15, 16, 17, 18, 61, 74, 81, 82 , above, and further in view of Labun et al. (2019, Nucleic Acid Res., 47, W171-W174, “Labun”) and CHOPCHOP TGFB1 results printout as an appendix of the paper . Martin discloses that TGFB1 knockdown may perform better for some cancer alone or in combination with TGFB receptor modifications and notes a CRISPR system to knockout target gene expression (par. 445). Martin discloses the Chopchop web tool for genome editing to identify recognition sequences, including gRNAs (par. 237). Martin does not disclose targeting exon 1 of TGFB1, nor the specific SEQ ID NO: 1 to be targeted. Labun discloses the release of a CHOPCHOP version 3 webtool used to identify guide RNAs to introduce mutations in the genome (abstract, pg. W172). Using the Chopchop site (chopchop.cbu.uib.no/) and entering “TGFB1” gene name provided 17 results, and the sequence of result number 6 matched instant SEQ ID NO: 1 (GGCCGACTACTACGCCAAGGAGG, T = U; chopchop.cbu.uib.no/results/eb77376c-4bcf-4511-8bf8-f7b3b40801f6/, accessed 03/23/2026; relevant to instant cl. 10 ). The sequence of result #6 inherently targets exon 1 ( relevant to instant cl. 9 ). One of the KSR’s rationale for supporting conclusion of obviousness is “obvious to try,” requiring the following three findings: (1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success. Although Martin discloses that TGFB1 knockdown may perform better for some cancer alone or in combination with TGFB receptor modifications and notes a CRISPR system to knockout target gene expression, Martin does not disclose any gRNAs. Labun discloses a Chopchop software tool that a skilled artisan can use to identify definite number of gRNAs to try to knockout expression of the target gene by using the CRISPR system. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried introducing a TGFB1 knockdown of Martin in view of Labun to have arrived at the claimed invention with a reasonable expectation of success. Martin demonstrates TGFB1 knockdown may perform better for some cancer alone or in combination with TGFB receptor modifications (par. 445; ‘488, p. 98, line 21-22), and Labun’s Chopchop software tool provides definite number of gRNAs to target TGFB1 gene, thus a skilled artisan would reasonably expect success in knocking out TGFB1 gene by using a CRISPR system as taught by Martin, by trying the various gRNAs, including gRNA sequence of result #6, provided by Chopchop site. Thus, cl. 9 and 10 are obvious. Allowable Subject Matter No claim allowed. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEYUR A VYAS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600 Application/Control Number: 18/555,846 Page 2 Art Unit: 1637 Application/Control Number: 18/555,846 Page 3 Art Unit: 1637 Application/Control Number: 18/555,846 Page 4 Art Unit: 1637 Application/Control Number: 18/555,846 Page 5 Art Unit: 1637 Application/Control Number: 18/555,846 Page 6 Art Unit: 1637 Application/Control Number: 18/555,846 Page 7 Art Unit: 1637 Application/Control Number: 18/555,846 Page 8 Art Unit: 1637 Application/Control Number: 18/555,846 Page 9 Art Unit: 1637 Application/Control Number: 18/555,846 Page 10 Art Unit: 1637 Application/Control Number: 18/555,846 Page 11 Art Unit: 1637 Application/Control Number: 18/555,846 Page 12 Art Unit: 1637 Application/Control Number: 18/555,846 Page 13 Art Unit: 1637
Read full office action

Prosecution Timeline

Oct 17, 2023
Application Filed
Apr 07, 2026
Non-Final Rejection mailed — §101, §102, §103
Jul 07, 2026
Response Filed
Oct 01, 2026
Final Rejection mailed — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12747273
HTT REPRESSORS AND USES THEREOF
5y 2m to grant Granted Sep 29, 2026
Patent 12723260
AAV-COMPATIBLE LAMININ-LINKER POLYMERIZATION PROTEINS
5y 9m to grant Granted Sep 01, 2026
Patent 12708608
METHODS OF TREATING SCHIZOPHRENIA AND OTHER NEUROPSYCHIATRIC DISORDERS
5y 8m to grant Granted Aug 18, 2026
Patent 12703863
AN RNA G-QUADRUPLEX STRUCTURE IN PRE-miRNA-1229 AS A THERAPEUTIC TARGET FOR ALZHEIMER'S DISEASE AND VARIOUS CANCERS
5y 3m to grant Granted Aug 11, 2026
Patent 12703865
SMALL INTERFERING RNA TARGETING C3 AND USES THEREOF
2y 3m to grant Granted Aug 11, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
49%
Grant Probability
99%
With Interview (+60.8%)
3y 8m (~8m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 77 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month