Prosecution Insights
Last updated: July 17, 2026
Application No. 18/556,185

PRIMER SET, REAGENT COMPOSITION AND METHOD FOR THE DETECTION OF METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS (MRSA)

Non-Final OA §102§103§112
Filed
Dec 27, 2023
Priority
Apr 22, 2021 — PL P.437660 +1 more
Examiner
TURPIN, ZACHARY MARK
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Genomtec S A
OA Round
1 (Non-Final)
0%
Grant Probability
At Risk
1-2
OA Rounds
1y 5m
Est. Remaining
0%
With Interview

Examiner Intelligence

Grants only 0% of cases
0%
Career Allowance Rate
0 granted / 18 resolved
-60.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
47 currently pending
Career history
79
Total Applications
across all art units

Statute-Specific Performance

§101
0.9%
-39.1% vs TC avg
§103
50.7%
+10.7% vs TC avg
§102
9.2%
-30.8% vs TC avg
§112
0.5%
-39.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 18 resolved cases

Office Action

§102 §103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of inventive Group I (claims 1-2, 7-9, and 14-20), drawn to primers and kits comprising said primers (i.e. products) in the reply filed on March 31, 2026 is acknowledged. Claim Status Claims 1-20 are pending in the present application Claims 3-6 and 10-13 are withdrawn as directed to a non-elected invention. Claims 1-2, 7-9, and 14-20 are under examination. Priority/Effective Filing Date The present application, filed on December 27, 2023, is a 371 of PCT/PL2022/050025, filed April 21, 2022, and claims foreign priority to POLAND P.437660, filed on April 22, 2021. It is noted that no English language translation of the foreign priority document is present in the application. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide and/or amino acid sequences appearing in the specification are not identified by sequence identifiers in accordance with 37 CFR 1.821(d) (see page 8-9 of the specification). Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Specific deficiency – This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.831(a) and 1.831(b). However, this application fails to comply with the requirements of 37 CFR 1.831-1.834. The examiner has noted that “the sequence 5’ AGGTTCTTTTTTTATCTTCGGTTA 3’ (SEQ ID NO: 6)” recited in claim 1 does not match the SEQ ID NO: 6 provided in the sequence listing. The sequence recited in the claim comprises 7 consecutive “T” nucleotides, underlined above. The SEQ ID NO: 6 in the sequence listing “aggttcttttttatcttcggtta” only comprises 6 consecutive “T” nucleotides at the corresponding position(s). Applicant must provide: • A replacement “Sequence Listing XML” part of the disclosure, as described above in item 1. or 2., as well as • A statement that identifies the location of all additions, deletions, or replacements of sequence information in the “Sequence Listing XML” as required by 1.835(b)(3); • A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.835(b)(4); • A statement that the “Sequence Listing XML” includes no new matter in accordance with 1.835(b)(5); and • A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation by reference paragraph as required by 37 CFR 1.835(b)(2), consisting of: o A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); o A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Specification The use of the terms “WarmStart”, “EvaGreen”, “Biotium”, “New England Biolabs”, “ThermoFisher Scientific”, “SYTO”, and “Lucigen”, which are each a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Interpretation It is noted that, as presently recited (i.e. not requiring a “TTTT bridge” of indefinite length as recited in line 3 of steps a) and b) of claim 1 ), a sequence having at least 90% identity to each of the recited sequences encompasses sequences having the following number of single nucleotide differences (e.g. SNVs, insertions, deletions, etc.) located at any position within the recited sequences (e.g. at the 5’ and/or 3’ terminus of the recited sequences): SEQ ID NO: Length (nt) Number of allowed SNVs with at least 90% identity 1 22 2 2 21 2 3 25 2 4 24 2 5 25 2 6 23 2 7 25 2 Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claims 1-2, 7-9, and 14-20 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention. Regarding claim 1, the phrase “preferably” renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP 2173.05(d). It is unclear whether the claims require that SEQ ID NO: 3 and SEQ ID NO: 4 are linked by a bridge having the specific sequence “TTTT”, any homopolymeric thymine “bridge” sequence, or encompasses a polynucleotide wherein SEQ ID NO: 3 is directly linked to SEQ ID NO: 4 with no intervening “bridge” sequence between the 3’ end of SEQ ID NO: 3 and the 5’ end of SEQ ID NO: 4 (i.e. the “bridge” is not required). The same lack of clarity applies to the recitation of “preferably by a TTTT bridge” in component (b) reciting SEQ ID NO: 5 and SEQ ID NO: 6. Claims 7 and 14 are rejected as indefinite because it is not clear what additional structural limitations and/or components, if any, are intended to be comprised within “a kit… characterized in that it comprises the set of primers as defined in (a previous claim)”. As presently recited, claims 7 and 14 do not positively recite any additional structures or limitations upon the claims upon which they depend. Claims 8 and 15 contain the trademark/trade names “WarmStart” and “NEB”. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe the source of a commercial master mix for LAMP amplification, which is subject to change and is not specifically defined by the claims or the specification. Accordingly, the identification/description is indefinite. Regarding claims 18 and 20, the phrase “a fluorescent marker interacting with double-stranded DNA” renders the claims indefinite because it is unclear what structures/products are encompassed by the functional language “interacting with…”. The recited kit component could reasonably be interpreted as requiring a fluorescent marker that is coupled to (i.e. is interacting with) a double-stranded DNA component of said kit (i.e. a fluorescently-labeled oligonucleotide) OR “a fluorescent marker capable of interacting with double-stranded DNA” (i.e. a fluorescent dye such as “EvaGreenTM”). Dependent claims 2, 7-9, and 14-20 are rendered indefinite because they necessarily include the indefinite limitation(s) of the claim(s) upon which they depend. While claims 4 and 11 are not presently under examination, as they are withdrawn as directed to non-elected method claims, it is noted that these claims do not end in a period. If these claims are eventually rejoined, they will be rejected as indefinite because they do not end in a period. As provided in MPEP 608, each claim begins with a capital letter and ends with a period. Claim Rejections - 35 USC § 112(d) The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 7 and 14 are rejected under 35 U.S.C. 112(d) as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claims 7 and 14 are rejected as indefinite because it is not clear what additional structural limitations and/or components, if any, are intended to be comprised within “a kit… characterized in that it comprises the set of primers as defined in (a previous claim)”. As presently recited, claims 7 and 14 do not positively recite any additional structures or limitations upon the claims upon which they depend. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Interpretation In the interest of compact prosecution, the sequence listing discrepancy identified above between SEQ ID NO: 6 in the sequence listing files and SEQ ID NO: 6 recited in claim 1 has been interpreted as requiring the sequence comprising 6 consecutive “T” nucleotides because this sequence matches the known sequence of the MRSA mecA gene, whereas a sequence comprising 7 consecutive “T” nucleotides would apparently comprise an insertion mutation relative to the target gene. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1 and 7 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wang et al., “Rapid Detection of Staphylococcus Aureus by Loop-Mediated Isothermal Amplification” Appl Biochem Biotechnol (2015) 175:882-891 (previously cited on December 27, 2023 IDS as NPL # 1 and in the Requirement for Restriction dated March 13, 2026). Regarding claims 1 and 7, Wang et al. teach a set of LAMP primers (i.e. a kit) for amplifying the nucleotide sequence of the Staphylococcus aureus mecA gene. Wang et al. teach: A mecA FIP “mecA-2-FIP” that is 97.96% identical to the claimed SEQ ID NO: 3 linked to SEQ ID NO: 4: PNG media_image1.png 250 839 media_image1.png Greyscale Note: the “Sbjct” sequence is Wang et al. mecA-2-FIP; the “Query” sequence is the claimed 5’-SEQ3+SEQ4-3’; AND the “A” nucleotide present in the claimed sequence is at the 3’ end of SEQ ID NO: 3. As shown above, SEQ ID NO:3 matches the corresponding portion of mecA-2-FIP with 2 nucleotide differences out of a total length of 25 nucleotides (i.e. SEQ ID NO: 3 and the corresponding portion of mecA-2-FIP are 92% identical), wherein mecA-2-FIP comprises one additional nucleotide at the 5’ terminus and is missing one nucleotide at the 3’ terminus (i.e. mecA-2-FIP is shifted one nucleotide on the target sequence relative to SEQ ID NO: 3). A mecA BIP “mecA-2-BIP” that is 100% identical to the claimed SEQ ID NO: 5 linked to SEQ ID NO: 6: PNG media_image2.png 262 820 media_image2.png Greyscale *Note: the “Sbjct” sequence is Wang et al. mecA-2-BIP; the “Query” sequence is the claimed 5’-SEQ5+SEQ6-3’. A mecA F3 “mecA-2-F3” that is 100% identical to the claimed SEQ ID NO: 1: PNG media_image3.png 283 803 media_image3.png Greyscale *Note: the “Sbjct” sequence is Wang et al. mecA-2-F3; the “Query” sequence is the claimed SEQ ID NO: 1. A mecA B3 “mecA-2-B3” that is 100% identical to the claimed SEQ ID NO: 2: PNG media_image4.png 280 812 media_image4.png Greyscale Therefore, Wang et al. teach each and every limitation of the claimed products as recited by claim 1, arranged as required by the claim. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-2, 7, and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al., “Rapid Detection of Staphylococcus Aureus by Loop-Mediated Isothermal Amplification” Appl Biochem Biotechnol (2015) 175:882-891 (previously cited on December 27, 2023 IDS as NPL # 1 and in the Requirement for Restriction dated March 13, 2026) in view of Nagamine et al., “Accelerated reaction by loop-mediated isothermal amplification using loop primers” Molecular and Cellular Probes (2002) 16, 223-229 and Lucigen “LavaLampTM DNA Component Kit” (2017). It is noted that the Lucigen reference has been applied to claims 1-2, 7, and 14 to address the “preferred” embodiment wherein the claimed FIP and BIP primers comprise a “TTTT bridge” linking the constituent sequences recited in the claim. Regarding claims 1 and 7, Wang et al. teach a set of LAMP primers (i.e. a kit) for amplifying the nucleotide sequence of the Staphylococcus aureus mecA gene. Wang et al. teach: A mecA FIP “mecA-2-FIP” that is 97.96% identical to the claimed SEQ ID NO: 3 linked to SEQ ID NO: 4: PNG media_image1.png 250 839 media_image1.png Greyscale Note: the “Sbjct” sequence is Wang et al. mecA-2-FIP; the “Query” sequence is the claimed 5’-SEQ3+SEQ4-3’; AND the “A” nucleotide present in the claimed sequence is at the 3’ end of SEQ ID NO: 3. As shown above, SEQ ID NO:3 matches the corresponding portion of mecA-2-FIP with 2 nucleotide differences out of a total length of 25 nucleotides (i.e. SEQ ID NO: 3 and the corresponding portion of mecA-2-FIP are 92% identical), wherein mecA-2-FIP comprises one additional nucleotide at the 5’ terminus and is missing one nucleotide at the 3’ terminus (i.e. mecA-2-FIP is shifted one nucleotide on the target sequence relative to SEQ ID NO: 3). A mecA BIP “mecA-2-BIP” that is 100% identical to the claimed SEQ ID NO: 5 linked to SEQ ID NO: 6: PNG media_image2.png 262 820 media_image2.png Greyscale *Note: the “Sbjct” sequence is Wang et al. mecA-2-BIP; the “Query” sequence is the claimed 5’-SEQ5+SEQ6-3’. A mecA F3 “mecA-2-F3” that is 100% identical to the claimed SEQ ID NO: 1: PNG media_image3.png 283 803 media_image3.png Greyscale *Note: the “Sbjct” sequence is Wang et al. mecA-2-F3; the “Query” sequence is the claimed SEQ ID NO: 1. A mecA B3 “mecA-2-B3” that is 100% identical to the claimed SEQ ID NO: 2: PNG media_image4.png 280 812 media_image4.png Greyscale PNG media_image5.png 88 985 media_image5.png Greyscale Regarding claims 2 and 14, Wang et al. teach a loopF primer “mecALF” complementary to the MRSA mecA gene having the sequence: 5’TCACCTGTTTGAGGGTGGA3’ which is substantially overlapping with the presently claimed loopF primer 5’CCTGTTTGAGGGTGGATAGCAGTAC3’ (SEQ ID NO: 7) on the MRSA mecA gene sequence (SEQ ID NO: 8): The loopF primer “mecALF” taught by Wang et al. was chosen a small number of possible loop primers designed for the optimized LAMP primer set “2m” (i.e. the “mecA-2…” primers described above) (Wang et al., page 886, paragraph 6). The mecALF primer taught by Wang et al., which shares 16 of its 19 nucleotides with the claimed seq 7, which shares 16 of its 25 nucleotides with mecALF (see overlap on target sequence above) (i.e. mecALF is a sequence that is 84% overlapping with the claimed sequence) (i.e. SEQ ID NO: 7 is a sequence that is 64% overlapping with mecALF), is not “at least 90% identical” to SEQ ID NO: 7. This alternative, “shifted” primer is the only structural limitation distinguishing claim 2 from the prior art, Wang et al. However, Nagamine et al. teach that loop primers are selected from the sequence of the target nucleic acid between the sequences F1 and F2 or B1 and B2 (i.e. between the constituent sequences of mecA-2-FIP or mecA-2-BIP) and that loop primers advantageously reduce the time required to complete a LAMP reaction (Nagamine et al., page 225, column 1, paragraph 2-3). In the present case, therefore, the teachings of Nagamine et al. suggest selecting a loop primer from the highlighted sequence below: PNG media_image6.png 115 1003 media_image6.png Greyscale Wherein: lcl|Query_2870562 mecA_2-FIP_F1 lcl|Query_2870563 mecA_2-FIP_F2_rc lcl|Query_2870564 mecALF lcl|Query_2870565 SEQ7_loopF Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention to one of ordinary skill in the art that the claimed loop primer “SEQ ID NO: 7” is an obvious variant/alternative of the prior art primer “mecALF”, taught by Wang et al. because of the teaching/suggestion of Nagamine et al. that a loop primer, selected from the finite number of possible sequences in the naturally occurring, short target sequence between the sequences of F1 and F2 (i.e. the constituent sequences of a FIP LAMP primer) advantageously speeds up LAMP reactions. Regarding the “preferred” embodiment of claim 1 wherein “SEQ ID NO: 3 [is] linked from the 3’ end, preferably by a TTTT bridge, to… SEQ ID NO: 4” and “SEQ ID NO: 5 [is] linked… preferably by a TTTT bridge to… SEQ ID NO: 5”, Lucigen teach “additional tips for successful primer design include: Poly T linkers” wherein “Some reports suggest the addition of a Poly T linker in the FIP and BIP between F2-F1C and B2-B1C (i.e. between seq 3 and 4 and between seq 5 and 6) can improve loop formation and reaction speed” (Lucigen, page 12, paragraph 1). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the LAMP FIP and BIP primers taught by Wang et al. to further comprise a “poly T linker” (i.e. “a TTTT bridge”) between the F2 and F1C sequences (separated by a dash character in Wang et al.) and between the B2 and B1C sequences taught by Wang et al. The ordinary artisan would have been motivated to include a “poly T linker”, “a TTTT bridge” in the FIP and BIP primers taught by Wang et al. because of the teaching of Lucigen et al. that inclusion of a poly T linker between the two constituents of the FIP and BIP primers can improve loop formation and reaction speed (Lucigen, page 12, paragraph 1). Claims 8-9 and 15-16 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al. in view of Nagamine et al., as applied to claims 1-2, 7, and 14 above, and further in view of NEB_manualE1700 (originally published January 2020) and Lucigen “LavaLampTM DNA Component Kit” (2017). Regarding claims 8 and 15, Wang et al. in view of Nagamine et al. do not teach supplying LAMP primers with the particular commercial buffer system “WarmStart LAMP Master Mix (NEB)” recited by the present claims. However, NEB teaches WarmStartTM LAMP kit E1700 comprising a 2x master mix is an optimized LAMP buffer solution that is compatible with multiple detection methods including real-time fluorescence detection and end-point visualization (NEB page 1, “introduction”). Regarding claims 9 and 16, Wang et al. and NEB teach supplying primers at the following concentrations: Primer NEB concentration (µM) Wang et al. concentration (µM) FIP 1.6 1.6 BIP 1.6 1.6 F3 0.3 0.2 B3 0.3 0.2 LoopF/B (each) 0.4 0.4 The primer concentrations taught by NEB and Wang et al. differ from the recited primer concentrations (i.e. 1.6 µM vs. 1.06 µM of each of the internal primers (FIP, BIP), 0.2-0.3 µM vs 0.13 µM of each of the outer primers (F3, B3), and 0.4 µM vs 0.27 µM of each of the loop primers (LF/LB). However, Lucigen teach optimizing the concentrations of each of the LAMP primers for each target nucleic acid to avoid background amplification (Lucigen, page 10, paragraph 1). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have utilized the widely available, commercially produced WarmStart LAMP master mix (taught/supplied by NEB) and have titrated (i.e. optimized) the LAMP primers as part of routine optimization steps for any particular nucleic acid target sequence (as taught by Lucigen). The ordinary artisan would have been motivated to use the NEB buffers by the teachings of NEB that the “optimized LAMP buffer solution that is compatible with multiple detection methods including real-time fluorescence detection and end-point visualization”. Furthermore, the ordinary artisan would have been motivated to optimize the primer concentrations by the teachings of Lucigen that “it may be necessary to optimize primer concentration after the optimal reaction temperature is identified. Certain primer sets may be prone to background amplification at or near the commonly used LAMP primer concentrations. If undesired background amplification is still observed after other optimizations, the primer concentration should be titrated from 0.25X-1X”. Claims 17-20 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al. in view of Nagamine et al., NEB, and Lucigen as applied to claims 1-2, 7-9 and 14-16 above, and further in view of Hayashida et al., (2015) “Direct Blood Dry LAMP: A Rapid, Stable, and Easy Diagnostic Tool for Human African Trypanosomiasis” PLoS Negl Trop Dis 9(3): e0003578. Regarding claims 17 and 19, Wang et al. in view of Nagamine et al., NEB, and Lucigen do not teach supplying Trehalose as a component of a LAMP detection kit. However, Hayashida et al. teach improvements in LAMP kits and protocols to further extend the technique to on-site diagnoses of infectious diseases in remote areas (Hayashida et al., abstract). Hayashida et al. teach incorporating trehalose into LAMP reagents as a cryoprotectant to prolong shelf-life of freeze-dried LAMP reagents at ambient temperatures and during lyophilization (i.e. freeze-drying) (Hayashida et al., abstract and page 7, paragraph 2). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the LAMP primer sets/kits taught by Wang et al. in view of Nagamine et al., NEB, and Lucigen to further comprise trehalose as a protectant during freeze-drying (i.e. lyophilization) of LAMP kit reagents. The ordinary artisan would have been motivated to modify LAMP kits to comprise trehalose for lyophilization of the necessary LAMP reagents by the express teachings of Hayashida et al. that such a modification greatly increases the shelf-life of LAMP reagents and utility of LAMP as a point-of-need diagnostic in remote areas where access to sophisticated laboratory equipment and necessity of cold-chain maintenance would otherwise be limiting for access to diagnosis (Hayashida et al., abstract). Regarding claims 18 and 20, Wang et al. in view of Nagamine et al., NEB, and Lucigen do teach the use of various fluorescent dyes, including calcein and direct DNA-binding fluorescent dyes as alternative components in LAMP kits for detection of LAMP products. Furthermore, Hayashida et al. teach that calcein is a conventional reagent for LAMP amplification detection that can be pre-mixed into a reaction without inhibiting the LAMP reaction, however, because calcein detects Mg2+ ion depletion in the LAMP reaction associated with polymerase activity rather than the accumulation of DNA (i.e. reaction products) directly, calcein detection is not compatible with blood samples containing EDTA directly (a common preservative used in blood draws) without a DNA purification step. Hayashida et al. teach that DNA-binding dyes such as SYTO-9, SYBR-green, SYBR-gold, and GelGreen allow for direct amplification of DNA, even in samples containing EDTA that are not compatible with calcein-detection (Hayashida et al., page 9-10, bridging paragraph). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the LAMP kits for detecting infection with MRSA taught by Wang et al. in view of Nagamine et al., NEB, and Lucigen comprising indirect fluorescence detection with calcein or DNA-binding fluorescent dyes to select a direct DNA-binding fluorescent dye such as GelGreen rather than calcein. The ordinary artisan would have been motivated to select DNA-binding fluorescent dye rather than calcein because of the teaching of Hayashida et al. that DNA-binding fluorescent dyes allow for direct detection of LAMP-amplified DNA even in the presence of EDTA (a common preservative in many sample types including blood draws), whereas calcein is not compatible with EDTA-containing samples without a DNA purification step prior to detection (or detection and amplification if the detection reagent is pre-mixed with the LAMP reagents) (Hayashida et al., page 9-10, bridging paragraph). Conclusion No claims are allowed. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Each of the following references teach primers for LAMP detection of mecA for detection of MRSA. Primers taught by the following references vary, but are all targeted to similar sequences within the MRSA mecA gene. It is particularly noted that KR102126429 (description translation provided) teach a mecA LAMP primer set SEQ 25, 26, 27, and 28 that are: 100% identical to SEQ ID NO: 1, 100% identical to SEQ ID NO: 2, 4 nucleotides shorter than the claimed fusion of SEQ ID NO: 3_4, and 1 nucleotide shorter than the claimed fusion of SEQ ID NO: 5_6, respectively. KR102126429 further teach a loop primer that is entirely comprised within the recited SEQ ID NO: 7 (missing 6 nt at the 5’ end). KR102126429 JP2006271370-A Nanayakkara et al., “Demonstration of a quantitative triplex LAMP assay with an improved probe-based readout for the detection of MRSA” Analyst 2019, 144, 3878. Lin et al., “Direct bacterial loop-mediated isothermal amplification detection on the pathogenic features of the nosocomial pathogen - Methicillin resistant Staphylococcus aureus strains with respiratory origins” Microbial Pathogenesis 109 (2017) 183-188 Xu et al., “Development and application of loop-mediated isothermal amplification assays on rapid detection of various types of staphylococci strains” Food Research International 47 (2012) 166-173 Li et al., “Platinum ions mediate the interactions between DNA and carbon quantum dots: diagnosis of MRSA infections” J. Mater. Chem B, 2020, 8, 3506 Jiang et al., “Nanoparticles-Based Biosensor Coupled with Multiplex Loop-Mediated Isothermal Amplification for Detection of Staphylococcus aureus and Identification of Methicillin-Resistant S. aureus” Infection and Drug Resistance 2020:13 1251-1262 Chen, X. et al., “The rapid and visual detection of methicillin-susceptible and methicillin-resistant Staphylococcus aureus using multiplex loop-mediated isothermal amplification linked to a nanoparticle-based lateral flow biosensor” Antimicrobial Resistance and Infection Control (2020) 9:111 Kim et al., “Development of MRSA and MRAB detection kit employing loop–mediated isothermal amplification and colorimetric indicator dye” Dyes and Pigments 170 (2019) 107618 Chen, C. et al., “Identification of Methicillin-Resistant Staphylococcus aureus (MRSA) Using Simultaneous Detection of mecA, nuc, and femB by Loop-Mediated Isothermal Amplification (LAMP)” Curr Microbol (2017) 74:965-971 Li, Bofan “Simultaneous Detection of Antibiotic Resistance Genes on Paper-Based Chip Using [Ru(phen)2dppz]2+ Turn-on Fluorescence Probe” ACS Appl. Mater. Interfaces 2018, 10, 4494-4501 Chen, Shu-Ling et al., “An integrated microfluidic system for live bacteria detection from human joint fluid samples by using ethidium monoazide and loop-mediated isothermal amplification” Microfluid Nanofluid (2017) 21:87 Nawattanapaiboon et al., “Hemoculture and Direct Sputum Detection of mecA-Mediated Methicillin-Resistant Staphylococcus aureus by Loop-Mediated Isothermal Amplification in Combination With a Lateral-Flow Dipstick” Journal of Clinical Laboratory Analysis 30: 760-767 (2016) Sudhaharan et al., “Evaluation of LAMP Assay Using Phenotypic Tests and Conventional PCR for Detection of nuc and mecA genes Among Clinical Isolates of Staphylococcus spp” Journal of Clinical and Diagnostic Research. 2015 Vol-9(8). Hanaki et al., “Loop-mediated isothermal amplification assays for identification of antiseptic- and methicillin-resistant Staphylococcus aureus” Journal of Microbiological Methods 84 (2011) 251-254 Koide et al., “Rapid detection of mecA and spa by the loop-mediated isothermal amplification (LAMP) method” Letters in Applied Microbiology 50 (2010) 386-392. Misawa et al., “Application of loop-mediated isothermal amplification technique to rapid and direct detection of methicillin-resistant Staphylococcus aureus (MRSA) in blood cultures” J Infect Chemother (2007) 13:134-140. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ZACHARY MARK TURPIN whose telephone number is (703)756-5917. The examiner can normally be reached Monday-Friday 8:00 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at 5712723157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Z.M.T./Examiner, Art Unit 1682 /WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Dec 27, 2023
Application Filed
Jun 23, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
0%
Grant Probability
0%
With Interview (+0.0%)
4y 0m (~1y 5m remaining)
Median Time to Grant
Low
PTA Risk
Based on 18 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month