Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
The instant application is in response to the papers filed on June 6, 2024. Pursuant to the amendment filed on June 6, 2024, claims 1, 51-53, 60-65, 69, 71, 73, 75, 77, 88, 121-122 and 144 are currently pending of which claims 1, 51, 53, 60, 62, 63, 69, 71, 73, 77, 88, 121, 122, and 144 have been amended and claims 2-50, 54-59, 66-68, 70, 72, 74, 76, 78-87, 89-120, 123-143, and 145-167 have been cancelled. No new claims have been added.
Therefore, claims 1, 51-53, 60-65, 69, 71, 73, 75, 77, 88, 121-122 and 144 are currently under examination to which the following grounds of rejection are applicable.
Priority
The present application is a 35 U.S.C. 371 national stage filing of the International Application No. PCT/US2022/025945 filed on April 22, 2022. Applicant’s claim for the benefit of a prior-filed parent provisional application 63/178,269 filed on April 22, 2021 filed under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on October 20, 2023 and April 16, 2026 were filed. The submissions are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 51-53, 60-65, 69, 71, 73, 75, 77, 88, 121-122 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for the first subunit and said second subunit each comprising an amino acid sequence of SEQ ID NO: 1, it does not reasonably provide enablement for 80% sequence identity to SEQ ID NO: 1. The claims are directed to a broad range in relation to SEQ ID NO: 1 which encodes the Wild-type I-CreI endonuclease subunit sequence.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
The factors to be considered in determining whether undue experimentation is required are summarized In re Wands 858 F.2d 731, 8 USPQ2nd 1400 (Fed. Cir, 1988). The Court in Wands states: "Enablement is not precluded by the necessity for some experimentation such as routine screening. However, experimentation needed to practice the invention must not be undue experimentation. The key word is 'undue,' not 'experimentation.' " (Wands, 8 USPQ2d 1404). Clearly, enablement of a claimed invention cannot be predicated on the basis of quantity of experimentation required to make or use the invention. "Whether undue experimentation is needed is not a single, simple factual determination, but rather is a conclusion reached by weighing many factual considerations." (Wands, 8 USPQ2d 1404). The factors to be considered in determining whether undue experimentation is required include: (1) The breadth of the claims; (2) The nature of the invention; (3) The state of the prior art; (4) The level of one of ordinary skill; (5) The level of predictability in the art; (6) The amount of direction provided by the inventor; (7) The existence of working examples; and (8) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. While all of these factors are considered, a sufficient amount for a prima facie case is discussed below.
(1) The breadth of the claims. The invention encompasses both compositions and methods of the claimed meganuclease recited in claim 1 as described above. Furthermore, and in relation to the scope of enablement, claim 1 encompasses the wild-type I-CreI nuclease subunit sequence at a scope of at least 80% sequence similarity.
(2) The nature of invention. The invention is directed to a meganuclease that recognizes mitochondrial DNA for nuclease activity wherein the enzyme comprises a mitochondrial transit peptide (MTP) on the N-terminus (SEQ ID NO: 8) and a nuclear export sequence (NES) on the C-terminus (SEQ ID NO: 9), in addition to methods of using the enzyme and compositions comprising it.
(3) State of the prior art. The art describes the I-CreI nuclease as a homodimeric meganuclease belonging to the LAGLIDADG family of meganucleases (LMN) wherein “the LAGLIDADG motif that forms a helix at the dimer interface, with the conserved penultimate acidic residues forming part of the active site.” (Arnould et al. 2011, p 28 , col 2). The review further describes I-CreI derivatives in which individual protein residues contacting the DNA have been mutated while not disrupting catalytic efficiency. The process for this engineering is summarized as “First, the protein specificity toward two nucleotide-triplets of one half of the pseudo-palindromic I-CreI target is locally altered by mutating protein residues in the vicinity of these nucleotides. Next, the two groups of mutations are merged using a combinatorial strategy. Alternatively, computational approaches based on protein-DNA interaction energy calculations have been used to modify the specificity of LMNs” (Arnould et al. 2011, p 28 , col 2).
LMNs can be modified to acquire new binding or cleavage specificities. One approach is domain swapping between nucleases, to obtain a hybrid nuclease. Another approach in view of I-CreI as described above, is using design algorithms and high throughout sequencing to derive thousands of novel proteins from I-CreI derivatives that cleave chosen sites/targets as depicted in Figure 1 of Arnould et al. 2007. The four central nucleotides of I-CreI target site are critical for cleavage activity, and therefore should be constant across mutants these are 5′-GTAC-3′ at positions -2 to +2, or activity will decrease (Arnould et al. 2007, p 53, col 2; p 61, col 1). The reasoning behind this is due to the topology imparted by this core sequence wherein a single substitution has major impacts on binding. The authors describe that there can be mutations in distinct DNA-binding sub-domains to create I-CreI derivatives, particularly at positions ±8, ±9, and ±10 (10NNN) or ±3, ±4, and ±5 (5NNN) (Fig. 1b). Altogether, the authors only found one mutation that is directly linked to an improvement in catalytic activity (p 61, col 2). In summary, the prior art reveals portions of the I-CreI are required to be conserved, and furthermore select sub-domains can be mutated for altered binding, but require extensive testing for target binding while maintaining catalytic activity.
(4) The level of one of ordinary skill. There is a high level of skill required as seen in requiring a molecular engineering skills and knowledge in addition to experience with sequencing technologies and computational/prediction models for engineering the I-CreI nuclease.
(5) The level of predictability in the art. The art is unpredictable. As described above, the engineering of endonucleases, particularly I-CreI reveal that select nucleotides, and therefore the respective amino acids can be altered while some should be conserved to maintain catalytic activity. Moreover, there is no single approach for determining such modifications in addition to the specific methods of altering the I-CreI nuclease accordingly. Altogether, the 80% sequence similarity scope for SEQ ID NO: 1 is not enabled as it is not clear that the full range of sequence differences with the wild-type would allow for a functional nuclease.
(6) The amount of direction provided by the inventor; (7) The existence of working examples of working examples.. The Specification describes SEQ ID NO: 1 as encoding a wild type I-CreI sequence, and moreover that the amino acid sequence similarity may be as low as 80% for which the claims are directed. Furthermore, stating that “the first subunit and the second subunit each comprise an amino acid sequence having at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 7-153 of SEQ ID NO: 1” (p 3).
Section 2.6 describes “Variants” wherein it describes “Variant polypeptides encompassed by the embodiments are biologically active. That is, they continue to possess the desired biological activity of the native protein; for example, the ability to bind and cleave recognition sequences found in mtDNA”. Therefore, variants of the wild-type sequences are encompassed albeit they retain functional properties.
In relation to particular modifications, Table 1 lists potential substitutions in engineered meganuclease variants to alter the recognition sites, describing that “A substantial number of amino acid modifications to the DNA recognition domain of the wild-type I-CreI meganuclease have previously been identified (e.g., U.S. 8,021,867) which, singly or in combination, result in engineered meganucleases with specificities altered at individual bases within the DNA recognition sequence half-site, such that the resulting rationally-designed meganucleases have half-site specificities different from the wild-type enzyme. (p 68); “Certain modifications can be made in an engineered meganuclease monomer or subunit to modulate DNA-binding affinity and/or activity. For example, an engineered meganuclease monomer or subunit described herein can comprise a G, S, or A at a residue corresponding to position 19 of I-CreI SEQ ID NO: 1 (WO 2009001159), a Y, R, K, or D at a residue corresponding to position 66 of I-CreI, and/or an E, Q, or K at a residue corresponding to position 80 of I-CreI (US8021867).” (p 69). The section then states the challenges of predicting the outcomes of particular modifications, and screening for the peptide to both bind and cleave were therefore conducted. Therefore, despite the Specification stating the I-CreI nuclease may be a variant wherein functional activity is maintained obtaining such variant appears challenging as select modifications may impact nuclease activity, and therefore requires a combination of methods to obtain such variants.
In relation to the working examples, Example 1 teaches an engineered meganuclease recognizing the mutated (m.5024C>T) mouse mtDNA sequence (ATAAGGATTGTAAGACTTCATC, SEQ ID NO: 3). The Sequence Listing lists SEQ ID No: 2 and 4 as meganucleases, as reflected in Table 2 in which SEQ ID NO: 2 is the MTEM meganuclease with wild-type 1-Crel subunits and SEQ ID NO: 4 is the MIT l l-12x.40 meganuclease that targets a particular mutation in the mitochondrial genome, i.e. m.5024C>T point mutation in the tRNAAla gene. The remaining examples employed these two nucleases, and Example 4 also employed the APC l l-12L.330 nuclease which has a nuclear target site. This example explored differences in nuclear export sequences. Altogether the examples, are limited to the two nucleases encoded in SEQ ID Nos: 2 and 4 wherein the nuclease employ the wild-type version of sequences or modified versions to target a specific mitochondria gene mutation. Altogether, it does not account for the 80% sequence similarity to the wild-type sequence.
(8) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. There would be extensive experimentation required to determine the which parts of the endonuclease sequence can be modified in addition to how it can be modified wherein the binding capacity and catalytic activity are preserved in the scope of 80% sequence similarity to the wild-type I-CreI sequence as listed in SEQ ID NO: 1.
Conclusion: The claims are enabled for the full sequence of the endonuclease that is supported by the full disclosure. In view of the prior art and in view of the Specification, there is much uncertainty regarding the particular modifications to the wild-type I-CreI endonuclease that would maintain a functional enzyme. Therefore, the scope of at least 80% similarity to the wild type I-CreI sequence is not fully enabled. The endonuclease sequences listed in the Sequence Listing, e.g. SEQ ID NO: 1, 2, and 4, are enabled at 100% sequence similarity , or rather at 95% identity wherein the functional properties are preserved wherein the central four nucleotides as recited above are the same.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 51-53, 60-65, 69, 71, 73, 75, 77, 88, 121-122 and 144 are rejected under 35 U.S.C. 103 as being unpatentable over Bacman et al. (Nature medicine 24.11 (2018): 1696-1700; of record IDS 10/20/2023) in view of Smith et al. (US 8,021,867 B2), Minczuk et al. (US 9,139,628 B2), and Pereira et al. (EMBO molecular medicine 10.9 (2018): EMMM201708084).
Claim 1 is directed to a mitochondria-targeting engineered meganuclease (MTEM) that acts with two subunits, i.e. dimer, and comprises SEQ ID NO: 1 with at least 80% similarity, a mitochondrial transit peptide (MTP) fused to the N-terminus that comprises an amino acid sequence set forth in SEQ ID NO: 8, and a nuclear export sequence (NES) that is fused to the C-terminus that comprises an amino acid sequence set forth in SEQ ID NO: 9.
Regarding claims 1, Bacman teaches the generation of mitochondrial-targeted TALENs (mitoTALENs) directed against the m5024C> T mutation in the mitochondrial DNA (Abstract; p. 1696, left-hand column, line 15 to right-hand column, line 3). The mitoTALENs have been administered to a mouse model comprising the m.5024C> T mutation in its mitochondrial DNA using an AAV9 vector. This resulted in a robust reduction in mutant mtDNA that was stable over time (Abstract). Furthermore, Bacman teaches the endonuclease as having a mitochondrial localization signal that is a modified COX8A/Su9 for which instant SEQ ID No: 8 encodes as seen in Table 2 (p 1701, col 1, par 1).
Bacman does not teach SEQ ID NOs: 1, 8, and 9.
The Sequence Search for the listed sequences revealed that SEQ ID NO: 1 was known prior to the filing of the instant application as it comprises the wild-type version of the I-CreI nuclease sequence as described in Smith et al. (US 8,021,867 B2) wherein the instant sequence is 100% identical to Smith SEQ ID NO: 1 (alignment provided with Office Action; U.S. Application No. 11/583,368). Furthermore, Smith states the meganuclease can be modified in having an altered specificity for the recognition site, thereby producing recombinant I-CreI meganucleases (col 3, ln 54-67; Table 1).
In respect to SEQ ID NO: 9, the nuclear export sequences was known prior to the filing of the instant application as taught in Minczuk et al. (US 9,139,628 B2) wherein the instant sequence is 100% identical to Minczuk SEQ ID NO: 23 (alignment provided with Office Action; U.S. Application No. 12/143,886) that is described as “NES sequence from NS2 protein of MVM” (col 33, ln 50-56).
In respect to SEQ ID NO: 8, the sequence encodes a mitochondrial transit peptide (MTP) that is further described in Table 2 as “COX VIII-SU9 MTP” is a combination of the Neurospora crassa F0 ATPase subunit 9 (SU9) and human cytochrome c oxidase subunit VIII (Cox8) (p 39). Furthermore, SEQ ID NO: 8 is the combination of SEQ ID NOs: 6 and 7. The Sequence Search did not uncover any sequence that is 100% identical initially. However, Pereira teaches this sequence in stating they employed “a mitochondrial localization sequence (COX8/Su9)” that is attached to the N-terminus of TALEN ( p 2, col 1; p 7, col 2), and furthermore including such sequence in the Supplemental Section which is 100% identical to the instant SEQ ID NO: 8 (p EV 2, “MitoTev-TALE (8.5RVD)”; alignment is provided with the Office Action).
It would have been prima facie obvious for one of ordinary skill in the art at the time of the effective filing date to have modified the I-CreI endonuclease as taught by Smith in instant SEQ ID No: 1 by combining the NES sequence taught Minczuk in instant SEQ ID NO: 9 and the MTP sequence as taught by Pereira in instant SEQ ID NO: 8 to obtain a mitochondrial targeting endonuclease as was previously shown by Bacman. Altogether, the elements of the total combination were known prior to filing of the instant application, and therefore the combination of such elements would have been an obvious step wherein the clear outcome is an expected I-CreI endonuclease that targets mitochondria DNA (mtDNA), and more specifically mtDNA located in the nucleus.
Regarding claims 51, 52, 53, 60-63 the rejection to claim 1 is applied herein as it teaches the limitations recited in these claims.
Regarding claims 64 and 65, Bacman teaches the construct is driven by a CMV promoter (p 1701, col 1), similarly Pereira teaches the same (p 7, col 1). \
Regarding claims 69 and 71, Bacman teaches these claims as seen in administration of the TALEN via AAV wherein saline is used (p 1701, col 1, par 5).
Regarding claims 73, 75, 77, 88, 121-122, Bacman teaches the administration of the endonuclease comprised in an AAV viral vector to either mice cells (“tRNAAla m.5024C> T mouse model” ) or human cells (Hela cells) as reading on genetically-modified eukaryotic cells that are human cells. Furthermore, Bacman teaches the methods related to delivery, and subsequently methods of producing a population of eukaryotic cells or altering such cells as seen by describing these methods and respective outcomes (p 1701, col 1-2; Figs. 2, 3).
Regarding claim 144, that is directed to a method of treatment, Bacman states, “Our results, as well as the ones described in a companion paper by Gammage et al. using mitoZFN19, show that mitochondrial targeted DNA editing enzymes can be effective in vivo without apparent toxicity. Total elimination of mutant mtDNA may not be necessary, as even small decreases in the mutant mtDNA load can have marked beneficial clinical outcomes. Further studies to deliver effective concentrations of mitoTALENs to other tissues that are commonly involved in mitochondrial diseases will greatly facilitate the implementation of this approach.” (p 1699). Therefore, it can be seen that Bacman teaches a method that can be used for treatments regarding mitochondrial DNA mutations.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 51-53, 60-65, 69, 71, 73, 75, 77, 88, 121-122 and 144 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-24 of U.S. Patent No. US 11,866,747 B2 (hereinafter ‘747).
Claim 1 of ‘747 is directed to a mitochondria-targeting engineered meganuclease (MTEM) that binds and cleaves a recognition sequence consisting of SEQ ID NO: 1 in mitochondrial genomes of a eukaryotic cell, wherein said MTEM comprises an engineered meganuclease attached to a mitochondrial transit peptide (MTP), and wherein said engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 9.
Claim 2 of ‘747 is directed to the MTEM of claim 1, wherein said MTP comprises an amino acid sequence set forth in SEQ ID NO: 45, and wherein said MTP is attached at the N-terminus of said engineered meganuclease.
Claim 3 of ‘747 is directed to the MTEM of claim 1, wherein said MTEM is attached to a nuclear export sequence (NES) comprising the amino acid sequence of SEQ ID NO: 46, wherein said NES is attached at the C-terminus of said MTEM.
Claim 1 of the instant application is directed to a mitochondria-targeting engineered meganuclease (MTEM) that binds and cleaves a recognition sequence in mitochondrial genomes of a eukaryotic cell, wherein said MTEM comprises an engineered meganuclease attached to a mitochondrial transit peptide (MTP), wherein said engineered meganuclease comprises a first subunit and a second subunit, wherein said first subunit binds to a first recognition half-site of said recognition sequence and comprises a first hypervariable (HVR1) region, wherein said second subunit binds to a second recognition half-site of said recognition sequence and comprises a second hypervariable (HVR2)region, and wherein said first subunit and said second subunit each comprise an amino acid sequence having at least 80% sequence identity to a sequence set forth in SEQ ID NO: 1, wherein said engineered meganuclease is a single-chain meganuclease comprising a linker that covalently joins said first subunit and said second subunit, wherein said MTP is fused to the N-terminus of said engineered meganuclease and comprises an amino acid sequence set forth in SEQ ID NO: 8, wherein a nuclear export sequence (NES) is fused to the C-terminus of said engineered meganuclease and comprises an amino acid sequence set forth in SEQ ID NO: 9.
The claims are similar due to the meganucleases encoded as being similar to each other. In particular instant SEQ ID NO: 1 is within 80% sequence similarity or higher to ‘747 SEQ ID NO: 9, and furthermore the MTP and NES sequences recited in instant claim 1 (instant SEQ ID NOs: 8, 9) are identical to the sequences listed in ‘560 claims 2 and 3, i.e. SEQ ID NOs: 45, 46 (all alignments provided with Office Action). Furthermore, in reference to the subunits recited in the instant claim 1, these subunits are encompassed by the MTEM of ‘747 since it encodes a I-CreI endonuclease which structurally is a homodimer. Therefore, it can be seen that the encoded MTEMs are identical.
Claims 1, 51-53, 60-65, 69, 71, 73, 75, 77, 88, 121-122 and 144 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 80, 82-89, 105, 106, 116, 119, 120, 122, 124-126, and 196- 198 of copending Application No. 18/516,247 (hereinafter ‘247).
Claim 1 of ‘247 is directed to a method for producing a genetically-modified eukaryotic cell, said method comprising introducing into a eukaryotic cell a polynucleotide comprising a nucleic acid sequence encoding a mitochondria-targeting engineered meganuclease (MTEM), wherein said MTEM is expressed in said eukaryotic cell; wherein said MTEM comprises an engineered meganuclease attached to a mitochondrial transit peptide (MTP), wherein said engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 9, and wherein said MTEM produces a cleavage site at said a recognition sequence consisting of SEQ ID NO: 1 in mutant mitochondrial genomes of said eukaryotic cell.
Claim 196 of ‘247 is directed to the method of claim 80, wherein said MTP comprises the amino acid sequence of SEQ ID NO: 45, and wherein said MTP is attached at the N-terminus of said engineered meganuclease.
Claim 197 of ‘247 is directed to the method of claim 80, wherein said MTEM is attached to a nuclear export sequence (NES) comprising the amino acid sequence of SEQ ID NO: 46, wherein said NES is attached at the C-terminus of said MTEM.
Claim 1 of the instant application is directed to a mitochondria-targeting engineered meganuclease (MTEM) that binds and cleaves a recognition sequence in mitochondrial genomes of a eukaryotic cell, wherein said MTEM comprises an engineered meganuclease attached to a mitochondrial transit peptide (MTP), wherein said engineered meganuclease comprises a first subunit and a second subunit, wherein said first subunit binds to a first recognition half-site of said recognition sequence and comprises a first hypervariable (HVR1) region, wherein said second subunit binds to a second recognition half-site of said recognition sequence and comprises a second hypervariable (HVR2)region, and wherein said first subunit and said second subunit each comprise an amino acid sequence having at least 80% sequence identity to a sequence set forth in SEQ ID NO: 1, wherein said engineered meganuclease is a single-chain meganuclease comprising a linker that covalently joins said first subunit and said second subunit, wherein said MTP is fused to the N-terminus of said engineered meganuclease and comprises an amino acid sequence set forth in SEQ ID NO: 8, wherein a nuclear export sequence (NES) is fused to the C-terminus of said engineered meganuclease and comprises an amino acid sequence set forth in SEQ ID NO: 9.
Claim 77 of the instant application is directed to a method for producing a genetically-modified eukaryotic cell, said method comprising introducing into a eukaryotic cell: (a) a polynucleotide comprising a nucleic acid sequence encoding said MTEM of claim 1, wherein said MTEM is expressed in said eukaryotic cell; or (b) said MTEM of claim 1; wherein said MTEM produces a cleavage site at said recognition sequence in mitochondrial genomes of said eukaryotic cell.
The claims are similar due to the meganucleases encoded and corresponding method of production as being similar to each other. In particular instant SEQ ID NO: 1 is within 80% sequence similarity or higher to ‘247 SEQ ID NO: 9, and furthermore the MTP and NES sequences recited in instant claim 1 (instant SEQ ID NOs: 8, 9) are identical to the sequences listed in ‘247 claims 196 and 197, i.e. SEQ ID NOs: 45, 46 (the sequences described for ‘247 are the same as those described for ‘747, therefore refer to these alignment with ‘747). Furthermore, in reference to the subunits recited in the instant claim 1, these subunits are encompassed by the MTEM of ‘247 since it encodes a I-CreI endonuclease which structurally is a homodimer. Therefore, it can be seen that the encoded MTEMs and corresponding method for producing a genetically-modified eukaryotic cell are identical.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
Claims 1, 51-53, 60-65, 69, 71, 73, 75, 77, 88, 121-122 and 144 are rejected. No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to MICHAEL A RIGA whose telephone number is (571)270-0984. The examiner can normally be reached Monday-Friday (8AM-6PM).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Maria G Leavitt can be reached at (571) 272-1085. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/MICHAEL ANGELO RIGA/Examiner, Art Unit 1634
/TERESA E KNIGHT/Primary Examiner, Art Unit 1634