Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Claims 1, 5, 6, 8-15, 18, 19, 21-23, 25, 32, 33 and 60 are pending and under consideration.
Priority
It is acknowledged that this application is a 371 of International Application No. PCT/US2022/025536 filed April 20, 2022, which claims the benefit of priority to U.S. Provisional Patent Appl. No. 63/177,528 filed April 21, 2021. The priority date has been established as April 21, 2021.
Information Disclosure Statement
The Information Disclosure Statement filed on 11/15/2024 has been considered and entered by examiner.
Drawings
Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification:
The patent or application file contains at least one drawing executed in color. For example, the brief description of the figures describe different colors for Figs. 3A-C, 4A-C, 5A-B, 6A-F, S1A-C, S2A-C, S3, S6, however no color drawings were submitted. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2).
The drawings are objected to because the sheets of drawing should be numbered in consecutive Arabic numerals, starting with 1 (see 37 CFR 1.84 (t)). In the instant application, FIG. 7 is followed by FIG. S1A. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings (e.g. Fig. 7) are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 9, 23 and 33 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 9 includes the phrase "such as", rendering the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. Furthermore, the text in parentheses stating "eliminate or enhance" after the word "alter'' also renders the claim indefinite because it is unclear whether the limitation(s) following the word "alter'' are part of the claimed invention, or merely exemplary. See MPEP § 2173.05(d).
Claim 9 also uses multiple acronyms that are not clarified such as "LALA, LALA-PG, N297, GASD/ALIE, DHS, YTE, and LS". It is unclear if these are amino acid sequences or acronyms, or a mixture of both in the same list, thus rendering this claim indefinite.
Claim 23 includes the phrase "such as", rendering the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. Furthermore, the text in parentheses stating "eliminate or enhance" after the word "alter'' also renders the claim indefinite because it is unclear whether the limitation(s) following the word "alter'' are part of the claimed invention, or merely exemplary. See MPEP § 2173.05(d).
Claim 23 also uses multiple acronyms that are not clarified such as "LALA, LALA-PG, N297, GASD/ALIE, DHS, YTE, and LS". It is unclear if these are amino acid sequences or acronyms, or a mixture of both in the same list, thus rendering this claim indefinite.
Claim 33 includes the phrase "such as", rendering the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. Furthermore, the text in parentheses stating "eliminate or enhance" after the word "alter'' also renders the claim indefinite because it is unclear whether the limitation(s) following the word "alter'' are part of the claimed invention, or merely exemplary. See MPEP § 2173.05(d).
Claim 33 also uses multiple acronyms that are not clarified such as "LALA, LALA-PG, N297, GASD/ALIE, DHS, YTE, and LS". It is unclear if these are amino acid sequences or acronyms, or a mixture of both in the same list, thus rendering this claim indefinite.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 5, 6, 8-15, 18, 19, 21-23, 25, 32, 33 and 60 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a WRITTEN DESCRIPTION rejection.
The rejected claims encompass a broad genus of antibody combinations. By reciting “comprises heavy and light chain sequences having 70%, 80%, 90% or 95% sequence identity to SEQ ID NOS: 3 and 4, respectively, wherein said second antibody or antibody fragment comprises heavy and light chain sequences having 70%, 80%, 90% or 95% sequence identity to SEQ ID NOS: 13 and 14, respectively” (see claims 6, 19), the claims encompass billions of possible variants of SEQ ID NO: 3, SEQ ID NO:4, SEQ ID NO: 13, SEQ ID NO: 14. In addition, the claims also encompass a broad genus of Fc variants comprising Fc mutated to increase therapeutic efficacy (see claims 9, 23 and 33). This would generate an even larger combinations of variable domain variants and Fc variants which might have different two- and/or three-dimensional structures. Other than the general description, the specification only disclose a specific antibody cocktail wherein the first antibody comprises heavy and light chain sequences of SEQ ID NOS: 3 and 4, respectively, wherein the second antibody comprises heavy and light chain sequences of SEQ ID NOS: 13 and 14, respectively. In addition, the specification discloses only a few mutations (such as LALA, LALA-PG, etc.) which may increase therapeutic efficacy. Thus, the specification provides insufficient written description to support the genus encompassed by the claims.
Vas-Gath, Inc. v" Mahurkar, 19 USPQ2d 1111, makes clear that "to satisfy the written description requirement, an applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention, and that the invention, in that context, is whatever is now claimed".
Regarding up to 30% variation to SEQ ID NO: 3, 4, 13 or 14, although the claims recite HCDRs 1-3 and LCDRs 1-3 for the antigen-binding moiety, it is well known that in the variable domain of an antibody, even outside the CDRs, can significantly impact antibody binding. Mutations in the framework regions (non-CDR areas) can alter the structure and dynamics of the antibody, affecting its ability to bind to its target antigen. For example, even single amino acid change in antigen-distal framework position can result in different conformational space and potentially different binding functions, see § Significance on page E486 of Koenig (Koenig et al., PNAS, E486-E495, Publication Date: 01/05/2017). The specification discloses antibody cocktail of EBOV-442 and EBOV-515 which comprises SEQ ID NO: 3, 4, 13 and 14. However, EBOV-442 and EBOV-515 would not tell the structure of all variants encompassed by the claims.
Regarding mutations that increase the therapeutic efficacy, the specification gives the examples of "LALA, LALA-PG, N297, GASD/ALIE, DHS, YTE, or LS". While it is unclear what these mutations are and/or where they are located, as described in the 112(b) rejection; the art is unpredictable regarding which mutations will increase the therapeutic efficacy of an antibody. The specification has not established the relationship between the recited function (increase the therapeutic efficacy) and the structure of mutated Fc. Thus this set of examples fails to describe a representative number of species to describe the claimed genus, thus fails to meet the requirement of the written description.
Furthermore, the written description provision of 35 USC § 112 is severable from its enablement provision; and adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method for isolating it. Fiers v. Revel, 25 USPQ2d 1601, 1606 (CAFC 1993). And Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016. The Guidelines for Examination of Patent Applications under the 35 USC §112 paragraph 1, "Revision 1" of Written Description Requirement (66 FR 1099-1111, March 25, 2008) state, "[p]ossession may be shown in a variety of ways including description of an actual reduction to practice, or by showing the invention was 'ready for patenting' such as by disclosure of drawings or structural chemical formulas that show that the invention was complete, or by describing distinguishing identifying characteristics sufficient to show that the Applicant was in possession of the claimed invention (Id. At 1104). Moreover, an adequate written description of the claimed invention must include sufficient description of at least a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics sufficient to show that Applicant was in possession of the claimed genus. However, factual evidence of an actual reduction to practice has not been disclosed by Applicant in the specification; nor has Applicant shown the invention was "ready for patenting" by disclosure of drawings or structural chemical formulas that show that the invention was complete; nor has the Applicant described distinguishing identifying characteristics sufficient to show that Applicant were in possession of the claimed invention at the time the application was filed.
The ordinary artisan could reasonably conclude based on a survey of the data shown in the instant specification in support of the breadth and scope of the instant claimed antibodies or antibody fragments that Applicants were not in possession of the innumerable variants for the antibodies or antibody fragments. Taken together, the instant specification has not provided a sufficient description for the broad genus of antibodies or antibody fragments encompassed by the claims.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 14, 18, 19, and 21-23 are rejected under 35 U.S.C. 102(a)(1)/(a)(2) as being anticipated by Crowe (Crowe et al., WO 2020/014443 A1, Publication Date: 01/16/2020, cited in IDS of 11/15/2024).
Crowe teaches that EBOV-442 and EBOV-515 potently neutralize EBOV and BDBV (the bridging paragraph of pages 96-97). As evidenced by paragraphs [0082] -[0085] of the instant publication US 2024/0287160 A1, EBOV-442 comprises a heavy chain and light chain of SEQ ID NO: 3 and SEQ ID NO: 4, respectively; EBOV-515 comprises a heavy chain and light chain of SEQ ID NO: 13 and SEQ ID NO: 14, respectively (also see Table 2 of Crowe). Thus, EBOV-442 and EBOV-515 read on the antibodies of instant claims 14, 18, and 19.
Crowe teaches that EBOV-442 can enhance the binding of EBOV-515 to intact GP ~3 to 5-fold. Such a cooperative binding effect could facilitate recognition of intact GP by broadly neutralizing mAbs in polyclonal plasma or therapeutic antibody mixtures. (Fig. 5E, and page 101, para. 2).
Crowe teaches that combination therapy with a cocktail of several potent mAbs has been considered necessary for treatment of ebolavirus infections (the bottom paragraph of page 107).
Crowe teaches that cocktails are preferred for prevention or treatment of viral infections to accomplish breadth of coverage against diverse virus species and to prevent emergence of antibody escape mutant virus (page 132, para. 2).
Crowe teaches various antibodies for ebolavirus listed in Table 2 (page 5, lines 21-25).
Crowe teaches vaccine formulation comprising one or more antibodies from Table 2 (the bridging paragraph of pages 6-7, claims 47 and 51). It is noted that Table 2 discloses 21 antibodies, including EBOV-442 (on page 154) and EBOV-515 (on page 156). Thus, Crowe anticipates a vaccine formulation comprising antibody EBOV-442 and EBOV-515, which would read the composition of instant claims 14, 18, 19.
Regarding claim 21, Crowe teaches that at least one of said antibody fragments is a recombinant scFv (single chain fragment variable) antibody, Fab fragment, F(ab')2 fragment, or Fv fragment (claim 53).
Regarding claim 22, Crowe teaches that at least one of said antibodies is a chimeric antibody, or is bispecific antibody (claim 54).
Regarding claim 23, Crowe teaches antibody is an IgG, or a recombinant IgG antibody or antibody fragment comprising an Fc portion mutated to alter (eliminate or enhance) FcR interactions, to increase half-life and/or increase therapeutic efficacy, such as a LALA, N297, GASD/ALIE, YTE or LS mutation or glycan modified to alter (eliminate or enhance) FcR interactions such as enzymatic or chemical addition or removal of glycans or expression in a cell line engineered with a defined glycosylating pattern (claim 55).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 5, 6, 8-13, 15, 25, 32, 33 and 60 are rejected under 35 U.S.C. 103 as being unpatentable over Crowe (Crowe et al., WO 2020/014443 A1, Publication Date: 01/16/2020, cited in IDS of 11/15/2024), as applied to claims 14, 18, 19, and 21-23 above.
Examiner’s Note: the term “delivering” an antibody was interpreted as “administering” an antibody. Thus, does not include the act of transporting the antibody.
Crowe teaches the composition of the instant claim 14, as set forth above.
In addition, Crowe teaches that filovirus entry is a complex process involving cathepsin-mediated cleavage of GP into GP intermediate (lines 1-2 on page 99). Antibodies EMOV-442, -515 and -520 inhibited cleavage in a dose-dependent manner. EBOV-442 was the most efficient mAb and completely inhibited GP cleavage at 0.3 μM (page 99, lines25-31).
Crowe teaches EBOV-437 and EBOV-442, which are glycan cap-specific mAbs that recognize all three pathogenic ebolaviruses and do not compete for binding with the base region specific mAbs, such as EBOV-515. Antibody EBOV-442 appears to be an optimal partner for enhancing the activity of the base region antibodies. EBOV-442 potently neutralize EBOV, BDBV and to a lesser extent SUDV, partially protected mice from lethal EBOV challenge, exhibited multiple effector functions in in vitro assays, efficiently inhibited GP cleavage in vitro, and cooperated in binding with EBOV-515. EBOV-442 appears to be promising candidate for inclusion in a combination therapy with EBOV-515 or EBOV-520 as a next-generation therapeutic antibody cocktail for ebolavirus treatment (page 108, lines 19-30).
Crowe teaches a method of treating a subject infected with ebolavirus or reducing the likelihood of infection of a subject at risk of contracting ebolavirus, comprising delivering to the antibodies of Table 2 (claims 13 and 17).
Crowe teaches as set forth above. However, Crowe does not “deliver” the claimed antibody cocktail to a subject for the claimed method. It would have prima facie been obvious to one of ordinarily skilled in the art at the time the invention was filed to administer EBOV-442 and EBOV-515 (e.g. the vaccine comprising EBOV-442 and EBOV-515) for treating a subject infected with ebolavirus or reducing the likelihood of infection of ebolavirus. One of ordinary skill in the art would have had a reasonable expectation that administering EBOV-442 and EBOV-515 can enhance the therapeutic activity compared to single antibody treatment, because Crowe teaches that both 1) antibodies can be used to treat a subject infected with ebolavirus or to reduce the likelihood of infection of a subject at risk of contracting ebolavirus; 2) both EBOV-442 and EBOV-515 can potently neutralize EBOV; 3) EBOV-442 does not compete for binding with the base region specific mAb EBOV-515; 4) EBOV-442 can enhance the binding of EBOV-515 to intact GP ~3 to 5-fold; 5) EBOV-442 is an optimal partner for enhancing the activity of the base region antibodies; 6) combination therapy with a cocktail of several potent mAbs has been considered necessary for treatment of ebolavirus infections; 7) vaccine formulation comprising antibodies: EBOV442 and EBOV-515. The motivation would have been to develop a better treatment for ebolavirus related conditions.
Regarding claim 8, Crowe teaches that said antibody fragments is a recombinant scFv (single chain fragment variable) antibody, Fab fragment, F(ab')2 fragment, or Fv fragment (claim 20).
Regarding claim 9, Crowe teaches that said antibody is an IgG, or a recombinant IgG antibody or antibody fragment comprising an Fc portion mutated to alter (eliminate or enhance) FcR interactions, to increase half-life and/or increase therapeutic efficacy, such as a LALA, N297, GASD/ALIE, YTE or LS mutation or glycan modified to alter (eliminate or enhance) FcR interactions such as enzymatic or chemical addition or removal of glycans or expression in a cell line engineered with a defined glycosylating pattern (claim 21).
Regarding claim 10, Crowe teaches that said antibody is a chimeric antibody, or is bispecific antibody (claim 22).
Regarding claims 11 and 12, Crowe teaches that said antibody or antibody fragment is administered prior to infection or after infection (claim 23). It would have prima facie been obvious to one of ordinarily skilled in the art at the time the invention was filed to treat a subject diagnosed with an ebolavirus infection (after infection) with the antibody cocktail, because the cocktail can be used to subject infected with ebolavirus.
Regarding claim 13, Crowe teaches wherein delivering comprises antibody or antibody fragment administration, or genetic delivery with an RNA or DNA sequence or vector encoding the antibody or antibody fragment (claim 25).
Regarding claim 15, Crowe teaches the composition of instant claim 14. In addition Crowe teaches that the DNA sequences encoding EBOV-442 light chain (SEQ ID NO: 6) and heavy chain (SEQ ID NO: 5); EBOV-515 light chain (SEQ ID NO: 24) and heavy chain (SEQ ID NO: 23). As shown below: SEQ ID NO: 5 of Crowe is 100% identical to SEQ ID NO: 1 of the instant claim; SEQ ID NO: 6 of Crowe is 100% identical to SEQ ID NO: 2 of the instant claim; SEQ ID NO: 23 of Crowe is 99.6% identical to SEQ ID NO: 11 of the instant claim; SEQ ID NO: 24 of Crowe is 100% identical to SEQ ID NO: 12 of the instant claim.
SEQ ID NO: 5 of Crowe alignment with SEQ ID NO: 1 of the instant claim:
SEQ ID NO: 5 of Crowe is identical to SEQ ID NO: 1 of the instant claim:
Query Match 100.0%; Score 408; Length 408;
Best Local Similarity 100.0%;
Matches 408; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAGGTGCAGTTGGTGGAGTCTGGGGGAGGCCTCGTAAAGCCGGGGGGGTCCCTTAGACTC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 GAGGTGCAGTTGGTGGAGTCTGGGGGAGGCCTCGTAAAGCCGGGGGGGTCCCTTAGACTC 60
Qy 61 TCCTGTACAGGCTCTGGAGGCACTGGATTCACTTTCAAGTATGCCGGGATGAGCTGGGTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 TCCTGTACAGGCTCTGGAGGCACTGGATTCACTTTCAAGTATGCCGGGATGAGCTGGGTC 120
Qy 121 CGCCAGGCTCCAGGGAAGGGGCCGGAGTGGATTGGCCGTATTAAAAGCAGGATTGATGGT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 CGCCAGGCTCCAGGGAAGGGGCCGGAGTGGATTGGCCGTATTAAAAGCAGGATTGATGGT 180
Qy 181 GGGACAACAGACTACGCTGCACCCGTGAAAGACAGATTCATTGTCTCAAGAGATGATTCA 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 GGGACAACAGACTACGCTGCACCCGTGAAAGACAGATTCATTGTCTCAAGAGATGATTCA 240
Qy 241 AGAAATACACTCTATCTGCAAATGAACAGCCTGAAGACCGAGGACACAGCCGTCTATTAT 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 AGAAATACACTCTATCTGCAAATGAACAGCCTGAAGACCGAGGACACAGCCGTCTATTAT 300
Qy 301 TGTGCCACAGGATCGGGAAAGGGGCCCTCTGCGTCGTTCGGGGAGTCATACTACTACTAC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 TGTGCCACAGGATCGGGAAAGGGGCCCTCTGCGTCGTTCGGGGAGTCATACTACTACTAC 360
Qy 361 GACTTCATTAACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCA 408
||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 GACTTCATTAACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCA 408
SEQ ID NO: 6 of Crowe alignment with SEQ ID NO: 2 of the instant claim:
Query Match 100.0%; Score 324; Length 324;
Best Local Similarity 100.0%;
Matches 324; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAAAGTGTGTTGACGCAGTCTCCAGGCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 GAAAGTGTGTTGACGCAGTCTCCAGGCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACC 60
Qy 61 CTCTCGTGCAGGGCCAGTCAGAGTATTAGCAGGAAGTACTTAGCCTGGTACCAGCAGAAA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 CTCTCGTGCAGGGCCAGTCAGAGTATTAGCAGGAAGTACTTAGCCTGGTACCAGCAGAAA 120
Qy 121 CCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTTCATCCAGCAGGGCCACTGGCATCCCA 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 CCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTTCATCCAGCAGGGCCACTGGCATCCCA 180
Qy 181 GACAGATTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 GACAGATTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAG 240
Qy 241 CCTGAAGATTTTGCAGTGTATTACTGTCATCAGTATGAAAGCTCACCTTGGACGTTCGGC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 CCTGAAGATTTTGCAGTGTATTACTGTCATCAGTATGAAAGCTCACCTTGGACGTTCGGC 300
Qy 301 CAAGGGACTAAGGTGGAAATCAAA 324
||||||||||||||||||||||||
Db 301 CAAGGGACTAAGGTGGAAATCAAA 324
SEQ ID NO: 23 of Crowe alignment with SEQ ID NO: 11 of the instant claim:
Query Match 99.6%; Score 364.4; Length 366;
Best Local Similarity 99.7%;
Matches 365; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 1 CAGGTGCAGCTGCACGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTC 60
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Db 1 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTC 60
Qy 61 ACCTGCACTGTCTCTGGTGGGTCCATCAACAGTGCTGGTTACTACTGGACCTGGATCCGC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 ACCTGCACTGTCTCTGGTGGGTCCATCAACAGTGCTGGTTACTACTGGACCTGGATCCGC 120
Qy 121 CAGCACCCGGGGAAGGGCCTGGAGTGGATTGGGTACATCGATTATACTGGGAGGACCTAC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 CAGCACCCGGGGAAGGGCCTGGAGTGGATTGGGTACATCGATTATACTGGGAGGACCTAC 180
Qy 181 TACAACCCGTCCCTTGAGAGCCGAGTGATCATTTCAATAGACACGTCTAAGAACCACTTC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 TACAACCCGTCCCTTGAGAGCCGAGTGATCATTTCAATAGACACGTCTAAGAACCACTTC 240
Qy 241 TCCCTGAGACTGACCTCTGTGTCTGCCGCGGACACGGCCGTGTATTACTGTGCGCGAGAA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 TCCCTGAGACTGACCTCTGTGTCTGCCGCGGACACGGCCGTGTATTACTGTGCGCGAGAA 300
Qy 301 TCGTCGTGGGTATCCGAGTTAGGGCGTGACAACTGGGGCCAGGGAACCCTGGTCACCGTC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 TCGTCGTGGGTATCCGAGTTAGGGCGTGACAACTGGGGCCAGGGAACCCTGGTCACCGTC 360
Qy 361 TCTTCA 366
||||||
Db 361 TCTTCA 366
SEQ ID NO: 24 of Crowe alignment with SEQ ID NO: 12 of the instant claim:
Query Match 100.0%; Score 321; Length 321;
Best Local Similarity 100.0%;
Matches 321; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAAATAGTGATGACGCAGTCTCCAGCCACCCTGCCTGTGTCTCCAGGGGAAGGAGCCACC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 GAAATAGTGATGACGCAGTCTCCAGCCACCCTGCCTGTGTCTCCAGGGGAAGGAGCCACC 60
Qy 61 CTCTCCTGCAGGGCCAGTCAGAGTGTTTTCACCAACTTAGCCTGGTACCAGCAAAAACCT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 CTCTCCTGCAGGGCCAGTCAGAGTGTTTTCACCAACTTAGCCTGGTACCAGCAAAAACCT 120
Qy 121 GGCCAGGCTCCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTGGTATCCCAGCC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 GGCCAGGCTCCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTGGTATCCCAGCC 180
Qy 181 AGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 AGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCT 240
Qy 241 GAAGACTTTGCAGTTTATTATTGTCAGCAGTATAATAACTGGCCTCGGACGTACGGCCAA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 GAAGACTTTGCAGTTTATTATTGTCAGCAGTATAATAACTGGCCTCGGACGTACGGCCAA 300
Qy 301 GGGACCAGGGTGGAAGTCAAA 321
|||||||||||||||||||||
Db 301 GGGACCAGGGTGGAAGTCAAA 321
Although Crowe does not teach the exact same DNA sequence of SEQ ID NO: 11, it would have been prima facie obvious at the time the invention was made to generate the nucleic acids encoding the therapeutic antibodies taught by Crowe because disclosure of the polypeptide makes the nucleic acid encoding the protein obvious as the methods of obtaining the nucleic acids are routine in the art and can be obtained with a reasonable expectation of success. See MPEP 2143(E)(Example 3), Ex parte Kubin, 83 USPQ2d 1410 (Bd. Pat. App. & Int. 2007), and In re Kubin 90 USPQ2d 1417 (U. S. Court of Appeals Fed. Cir. 2009).
Regarding claim 25, Crowe teaches a hybridoma or engineered cell encoding an antibody or antibody fragment wherein the antibody or antibody fragment comprise light and heavy chain variable sequences of Table 2 (claims 36 and 40). It is noted that Table 2 discloses 21 antibodies, including EBOV-442 (on page 154) and EBOV-515 (on page 156). Although Crowe does not teach the engineered cell encoding both EBOV-442 and EBOV-515, It would have prima facie been obvious to one of ordinarily skilled in the art at the time the invention was filed to make an engineered cell encoding both EBOV-442 and EBOV-515 for making an antibody cocktail, because the cocktail would have had a better therapeutic activity for treating subject infected with ebola virus or reducing the likelihood of infection of a subject at risk of contracting ebola virus, as taught by Crowe. Given that the sequences of these antibodies are well known in the art, one of ordinary skilled in the art would have had a reasonable expectation of success to reach the claimed invention.
Regarding claim 32, Crowe teaches the engineered cells of claims 36-42, wherein the antibody fragment is a recombinant scFv antibody, Fab fragment, F(ab’)2 fragment, or Fv fragment (claim 43); or wherein the antibody is a chimeric antibody or a bispecific antibody (claim 44).
Regarding claim 33, Crowe teaches the engineered cells of claims 36-43, wherein said antibody is an IgG, or a recombinant IgG antibody or antibody fragment comprising an Fc portion mutated to alter (eliminate or enhance) FcR interactions, to increase half-life and/or increase therapeutic efficacy, such as a LALA, N297, GASD/ALIE, YTE or LS mutation or glycan modified to alter (eliminate or enhance) FcR interactions such as enzymatic or chemical addition or removal of glycans or expression in a cell line engineered with a defined glycosylating pattern (claim 45).
Regarding claim 60, Crowe teaches the composition of instant claim 14. Crowe further teaches a method of protecting the health of a placenta and/or fetus of a pregnant a subject infected with or at risk of infection with ebolavirus comprising delivering to said subject an antibody of Table 2 (page 7, para. 3; claims 61, 66). Thus, It would have prima facie been obvious to one of ordinarily skilled in the art at the time the invention was filed to use the combination of EBOV-442 and EBOV-515 for the claimed method for enhancing the therapeutic efficacy of the treatment. Given the teachings from Crowe, one of ordinary skill in the art would have had a reasonable expectation of success because EBOV-442 can enhance EBOV-515 ebolavirus neutralizing activity. The motivation would have been to develop a better treatment.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHENG LU whose telephone number is (571)272-0334. The examiner can normally be reached Monday-Friday 8-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Samira Jean-Louis can be reached at (571)270-3503. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CHENG LU/ Examiner, Art Unit 1642
/SAMIRA J JEAN-LOUIS/ Supervisory Patent Examiner, Art Unit 1642