Prosecution Insights
Last updated: April 19, 2026
Application No. 18/557,401

CLUBROOT RESISTANCE IN BRASSICA

Non-Final OA §102§103§112
Filed
Oct 26, 2023
Examiner
CHATTERJEE, JAYANTA
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Pioneer Hi-Bred International Inc.
OA Round
1 (Non-Final)
82%
Grant Probability
Favorable
1-2
OA Rounds
2y 8m
To Grant
99%
With Interview

Examiner Intelligence

Grants 82% — above average
82%
Career Allow Rate
9 granted / 11 resolved
+21.8% vs TC avg
Strong +40% interview lift
Without
With
+40.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
48 currently pending
Career history
59
Total Applications
across all art units

Statute-Specific Performance

§101
4.7%
-35.3% vs TC avg
§103
35.9%
-4.1% vs TC avg
§102
18.7%
-21.3% vs TC avg
§112
33.6%
-6.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 11 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant's election with traverse of Group I, comprising claims 15-19, in the reply filed on 02/19/2026 is acknowledged. The Applicant also elects the following species: a) CrM3 located on chromosome N3 interval flanked by and including 113.88 cM and 115.57 cM; in claim 15. b) Position 24,092,908 to position 25,040,472 of Chr 3; in claim 16. c) one or more CrM3 resistance alleles identified in Table 1; in claim 17. d) N88673-001-Q001 (SEQ ID NO: 10); in claim 18. The traversal is on the ground(s) that claims 20-24 (assigned to Group II by the Office Action) are directly or indirectly dependent on and include all the limitations of claim 15 (assigned to Group I by the Office Action). Therefore, … Groups I and II should not have been restricted from each other; and “Choi neither teaches or suggests the QTLs and/or haplotypes disclosed in Applicants specification”. Applicant’s arguments are fully considered but not found persuasive. The special technical feature of “a Brassica plant/germplasm comprising a clubroot disease resistance locus and screening the germplasm for a sequence comprising a molecular marker linked to clubroot resistance” is not based on any particular QTL and/or haplotype. However, the species election is withdrawn for fast and compact prosecution. The requirement is still deemed proper and is therefore made FINAL. Claim Status Claims 15-26 are pending. Claims 20-26 are withdrawn as being part of non-elected claims. Claims 15-19 are being examined. Specification The specification is objected to as failing to provide proper antecedent basis for the claimed subject matter. See 37 CFR 1.75(d)(1) and MPEP § 608.01(o). Correction of the following is required: Claim 16 recites, “reference line DH12075”. The Applicant does not describe the reference line DH12075 in the instant specification. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 16 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. It is not clear to the Examiner if- the reference line DH12075 is relevant only to Markush group (v) comprising position 14,959,178 to position 17,536,263 of Chr 3, OR the reference line DH12075 is relevant to all the members if the Markush group (i) to (v) in claim 16; i.e., any position from 10,411,130 to position 25,040,472 of Chr 3. For compact prosecution, the Examiner interprets that the reference line DH12075 is relevant only to Markush group (v) in claim 16. Locations of the clubroot resistance loci, as recited in (i) to (iv) of the Markush group, can in reference to any Brassica plant. Claim Rejections - 35 USC § 102(a)(1) In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 15-16 and 19 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Christianson et al. (US 2018/0305774 Al). Christianson et al. teaches that Mendel and Tosca, two winter canola varieties, both originated in a resynthesized B. Napus and possess clubroot resistance (page 1, para 0010, line 1-4). Christianson et al. describes SEQ ID NOs: 1-8 listing SNP markers associated with a clubroot resistance QTL on chromosome N3 (A03) in canola variety Tosca and SEQ ID NOs: 9-12 listing SNP markers associated with a clubroot resistance in the same chromosome in canola variety Mendel (page 2, para 0019). The clubroot QTL identified in Tosca differs (about 52 cM apart) from a Mendel-derived clubroot resistance locus on chromosome N3 previously identified (page 23, para 0260, line 3-5). The molecular markers associated with clubroot resistance in Tosca is around 116 cM position in chromosome 3 (page 23, table 2) (as recited in claim 15), which corresponds to 13,757,171 to 14,389,227 physical positions on B. napus genomic map (page 24, table 3), which is within the range of physical position as recited in claim 16. The Applicant describes several clubroot resistance locus flanked by specific markers in different Brassica lines including Mendel where the clubroot locus is CrM3, located within 14,777,622 to position 16,528,042 of Chr 3, as recited in claim 16. It is noted by the Examiner that the Applicant describes a proprietary DH mapping population, which is not described any further in the instant specification, containing the clubroot resistance loci CrN3 flanked by and including positions 62.4 cM and 77.3 cM, and corresponds to nucleotide position 14,959,178 to position 17,536,263 on chromosome 3 (page 35, para 0082, line 1-7). The instant specification does not mention “line DH12075” recited in instant claim 16. The Examiner is interpreting that the clubroot resistance locus in the proprietary DH mapping population corresponds to the location in the reference line DH12075, as recited in claim 16. Christianson et al. describes creating canola hybrids using five different male containing the Tosca-derived clubroot resistance lines (reads on to “first Brassica plant”) crossed with multiple female lines (reads on to “second Brassica plant”) and selecting (reads on to “screening”) one or more progeny comprising at least one clubroot resistance loci (page 25, para 0269; Table 9), as recited in claims 15 and 19. Christianson et al. teaches a canola plant comprising the Tosca derived clubroot resistance (“first Brassica plant”) being crossed with an elite canola line (reads on to “second Brassica plant”) comprising a desirable trait (e.g., improved yield under drought, cold, heat stress conditions) but susceptible to clubroot. F1 progeny plants from this cross are assayed (reads on to “screening”) for one or more SNP markers to select for the clubroot QTL present in Tosca. A selected F1 progeny plant is then backcrossed with the parent elite canola line comparing the desirable trait (recurrent parent). Plants from the (backcrossed) BC1 generation are also genotyped (screened) using SNP markers to select for the (Tosca-derived) clubroot resistance QTL, as recited in claim 19. After multiple rounds of backcrossing ( e.g., 5-7 generations), a new elite canola line (which can include a hybrid line) is obtained comparing both clubroot resistance and the desirable trait in the recurrent parent elite line (page 25, para 0270). Christianson et al. describes isolating nucleic acids from each germplasm, assaying said nucleic acids for one or more markers closely linked to a QTL providing resistance to specific P. brassicae pathotype, and selecting germplasm (i.e., progeny plants) having resistance to the specific P. brassicae pathotype based on the marker assay (page 9, para 0082, line 4-9). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 17-18 are rejected under 35 U.S.C. 103 as being unpatentable over Christianson et al. (US 2018/0305774 Al) as applied to claims 15-16 and 19 above, and in evidence of Nadeem et al. (DNA molecular markers in plant breeding: current status and recent advancements in genomic selection and genome editing, 2018, Biotechnology & Biotechnological Equipment, 32:261–285). Claim 17 depends from claim 15 and is drawn to the method (of claim 15) further comprisng screening the sample for the presence of the molecular marker or haplotype, wherein the molecular marker or haplotype comprises one or more CrM3 resistance alleles identified in Table 1 herein, one or more CrS3 resistance allele identified in Table 2 herein, one or more CrT3 resistance allele identified in Table 3 herein, one or more CrB3 alleles identified in Table 4 herein, or one or more CrN3 resistance alleles identified in Table 5 herein. Christianson et al. describes a method of introducing at least one clubroot resistance locus into a Brassica plant by crossing a first parent Brassica plant comprising at least one clubroot resistance locus with a second Brassica plant to produce progeny plants, screening different progeny plants using molecular marker alleles linked to clubroot resistance located on chromosome N3 interval around 116 cM, and selecting one or more progeny plants comprising the one or more clubroot resistance loci, as discussed above. Christianson et al. discusses different pathotypes of Plasmodiophora brassicae (P. brassicae, the causal agent of clubroot disease in brassica) (page 1, para 0005, line 2-3), which appear to dominate in different canola growing regions in Canada (page 1, para 0006), which is equally valid for canola growing regions around the world. Christianson et al. teaches a canola plant comprising the Tosca derived clubroot resistance (“first Brassica plant”) being crossed with an elite canola line (reads on to “second Brassica plant”) comprising a desirable trait (e.g., improved yield under drought, cold, heat stress conditions) but susceptible to clubroot. F1 progeny plants from this cross are assayed (reads on to “screening”) for one or more SNP markers to select for the clubroot QTL present in Tosca. A selected F1 progeny plant is then backcrossed with the parent elite canola line comparing the desirable trait (recurrent parent). Plants from the (backcrossed) BC1 generation are also genotyped (screened) using SNP markers to select for the (Tosca-derived) clubroot resistance QTL. After multiple rounds of backcrossing ( e.g., 5-7 generations), a new elite canola line (which can include a hybrid line) is obtained comparing both clubroot resistance and the desirable trait in the recurrent parent elite line (page 25, para 0270). Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to develop new molecular markers that are closely linked to clubroot resistance gene(s), as described by Christianson et al. Such molecular markers would have enabled the artisan to introduce at least one clubroot resistance locus into a clubroot susceptible Brassica plant, as described by Christianson et al. The Applicant describes relative position of the loci in the reference B. napus genome (spec, page 3, para 0009, line 10-15). The CrM3 locus corresponds to physical position 24,092,908 to position 25,040,472 of chromosome 3 (Chr 3); the CrS3 locus corresponds to physical position 23,965,482 to position and 24,955,776 of Chr 3; the CrT3 locus corresponds to the physical position 14,777,622 to position 16,528,042 of Chr 3; the CrB3 locus corresponds to position 10,411,130 to position 15,959,930 of Chr 3; and the CrN3 locus corresponds to position 14,959,178 to position 17,536,263 on Chr 3 of a B. napus reference genome (spec, page 3, para 0009, line 10-15). Moreover, precise location of genes in a chromosome is known to change, especially in different varieties of the same plant species (developed from other varieties or wild type relatives), due to recombination. Specific markers needed to screen/tag the same gene in different varieties would also change depending on experimental design choice of an ordinarily skilled artisan based on specific plant/variety being used. For example, a standard BLAST (in Phytozome website: https://phytozome-next.jgi.doe.gov/blast-search) using the marker comprising SEQ ID NO: 3; comprising two degenerate nucleotides, “N’ and “K”, and linked to a specific clubroot resistance gene/locus on chromosome 3; as described by Christianson et al., indicates that the marker aligns with different locations in the Brassica genome ranging from (physical map location) 15522521 to 29123960 (data not shown) in chromosome 3 of different B. rapa and B. juncea varieties/cultivars, as shown below. PNG media_image1.png 260 883 media_image1.png Greyscale Same standard BLAST search using known Brassica genomes and the molecular marker comprising SEQ ID NO: 149 gives a 100% sequence identical sequence in chromosome 3 around physical location 19531383, in B. rapa, ssp. Chinensis, var. communis_PCGlu v2.1 (https://phytozome.jgi.doe.gov/info/Brapassp_chinensisvar_communis PCGlu_v2_1), as shown below. >jgi:Chr03_712 BrapasspchinensisvarcommunisPCGlu|712|v2.1 Length=45104816 Score = 39.2 bits (42), Expect = 0.022 Identities = 21/21 (100%), Gaps = 0/21 (0%) Strand=Plus/Minus Query 1 AACAGTTATTCCTTTTACTCG 21 ||||||||||||||||||||| Sbjct 19531383 AACAGTTATTCCTTTTACTCG 19531363 Development of molecular markers and its applications in plant breeding, especially for plants like Brassica where its genome is sequenced, is a routine and standard process in the art (Nadeem et al., abstract). Christianson et al. teaches that genomes of several Brassica species have been sequenced (page 5, para 0056, line 37-41) and molecular markers have been widely used to determine genetic composition in canola as well. Christianson et al. describes that additional markers can be designed and tested based on the available genome sequences of various canola species (page 5, para 0056, line 31-34). Use of specific markers comprising specific sequence(s) (as recited in claims 17 and 18) to identify and/or screen specific clubroot resistance gene(s) including CrM3, CrS3, CrB3, and CrN3 are the experimental design choice of the artisan and are functional equivalents. Before the effective filing date of the invention, an ordinarily skilled artisan would have been motivated to introducing at least one clubroot resistance into a commercially important elite Brassica crop variety not having clubroot resistance by crossing the elite variety with a sexually compatible Brassica plant comprising clubroot resistance and using specific marker(s) to screen progenies having clubroot resistance. Conclusion No claim is allowed. Communication Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm.. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Jay Chatterjee Patent Examiner Art Unit 1662 /Jay Chatterjee/Examiner, Art Unit 1662 /BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
Read full office action

Prosecution Timeline

Oct 26, 2023
Application Filed
Feb 18, 2026
Examiner Interview (Telephonic)
Feb 18, 2026
Examiner Interview Summary
Mar 10, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12570986
SEC12-LIKE PROTEIN GENE CPU1 AND APPLICATION THEREOF IN IMPROVING SOYBEAN PHOSPHORUS EFFICIENCY
2y 5m to grant Granted Mar 10, 2026
Patent 12527270
PROMOTING REGENERATION AND TRANSFORMATION IN PLANTS
2y 5m to grant Granted Jan 20, 2026
Patent 12497630
USE OF SWEETPOTATO IBSAP15 GENE IN REGULATING LEAF SHAPE AND FLOWER SHAPE OF SWEETPOTATO
2y 5m to grant Granted Dec 16, 2025
Patent 12467059
RICE WHITE LEAF AND PANICLE GENE WLP3 AND APPLICATION THEREOF IN RICE STRESS RESISTANCE AND YIELD INCREASE
2y 5m to grant Granted Nov 11, 2025
Study what changed to get past this examiner. Based on 4 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
82%
Grant Probability
99%
With Interview (+40.0%)
2y 8m
Median Time to Grant
Low
PTA Risk
Based on 11 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month